Datasets:

gmongaras

/

EleutherAI_the_pile_deduplicated

like 2

This subproject is one of many research subprojects utilizing the resources provided by a Center grant funded by NIH/NCRR. Primary support for the subproject and the subproject's principal investigator may have been provided by other sources, including other NIH sources. The Total Cost listed for the subproject likely represents the estimated amount of Center infrastructure utilized by the subproject, not direct funding provided by the NCRR grant to the subproject or subproject staff. During the spring terms of 2009-10 and 2010-11 academic years, the Directors of the Resource, joined by Center for Biomedical Mass Spectrometry faculty member Prof. McComb, presented the full-semester graduate course, BI-793, MS, Proteomics and Functional Genomics. As has become the traditions,the guest lecture on Oligonucleotide MS and Proteomics was presented by Dr. Bing Wang (Genzyme Corp.). Five students registered for credit, and more than fifteen faculty and post-doctoral scientists, from collaborating groups, Harvard Medical School, Boston College, BU Goldman School of Dental Medicine and others, joined the lectures as auditors. Much of the course material is posted on the Resource Web site and is being used by students and research scientists across the US and around the world. Regulations pertaining to the use of published material require that access to the site is now password-controlled. Investigators from several states, as well as foreign institutions, have been provided with access.

President John F. Kennedy and Jacqueline Kennedy traveling in car, May 1961. Courtesy of John Fitzgerald Kennedy Library President John F. Kennedy and Jacqueline Kennedy in Dallas, Texas; 1963. Narrated by George Clooney, "JFK: One PM Central Standard Time," premiering Wednesday, November 13, 2013 on PBS, recounts the riveting story of the reporting from Dallas and the CBS Newsroom in New York from the moment President Kennedy was shot until Cronkite’s emotional pronouncement of his death at 1 p.m. CST. In 1962, Cronkite accepted the offer to anchor the CBS Evening News, but with one condition: to be the Managing Editor as well. Though the term Managing Editor was not used in television, Cronkite knew he’d be able to determine which stories would be aired and how they would be handled. Having the final decision rest with him would be key on that fatal day one year later in Dallas as he employed all of his journalistic skills to report the story of a lifetime. In September 1963, Cronkite launched the extended CBS Evening News with an interview with Kennedy. He was 46, the same age as the President. Both men were Second World War veterans; Cronkite had been a war correspondent in Europe and Kennedy had commanded a Torpedo patrol-boat in the Pacific; and both men knew how to effectively use the new medium of television. Eight weeks later, on November 22, Cronkite and Kennedy would be forever linked in history. Through re-enactments of the CBS newsroom in New York and anecdotal accounts from those in Dallas, the chaos of that day unfolds. Bennett and Hampton vividly recall the actions of UPI correspondent Merriman Smith, who after hearing gunshots, grabbed the one phone in the press pool car and started dictating to his desk in Dallas, “Three shots were fired at the motorcade!” Cronkite had been a distinguished wire-service reporter. He relied on the wires and knew Smith’s reporting would be accurate. Though he wanted to be the first to break the news, at that point Smith didn’t know if Kennedy had been hit or even if he was wounded. Faced with the story of a lifetime, how does Cronkite choose to handle the story? From the first reporting of the shooting to his announcement of Kennedy’s death, “Walter turned in his best day and one of the best days the business of news has ever had…and he happened to do it on what was the worst day in modern times,” says Brian Williams.

Q: Convertir Fecha de un objeto en Formato ddMMyy tengo una fecha de un que viene de un objeto y es de tipo DATETIME y se necesita que tenga el formato dd/MM/yy DateTime fechaInicialAsoc = DateTime.Parse(objFecha, "ddMMyy"); Como puedo convertir sin pasar a realizarlo a string y luego a datetime nuevamente para una consulta en linq? A: El objetivo del formato de fecha está restringido a la visualización. Un objeto DateTime no tiene un formato como tal, su formato es la representación en string. Si lo que deseas es hacer cálculos o búsquedas entre fechas, lo harás siempre con el objeto DateTime, y cuando quieras representarlo le darás el formato que desees, por ejemplo con un objFecha.ToString("dd/MM/yyyy").

i asked if he wanted to come to bed he came out 173 shares

The elusive land of promise in 1984, at a time when there was an air of expectancy in the country, I delivered a course of lectures entitled Envisioning New Zealand’s Future. It was shortly after the Economic Summit Conference. We had come to the end of the Muldoon era and were looking into the future with very positive hope. I explored the need to prioritise our values and clarify our goals if we were going to achieve any worthwhile ends. Since that time New Zealand, both in the economy and in society generally, has experienced a great deal of restructuring. The degree to which we have achieved our goals, however, is debatable. There is no longer the sense of buoyant expectancy we had then. What we were hoping for has proved to be more elusive than we thought. Now that we have entered a new century – and a new millennium to boot – it is a suitable time to look again at where we want to go, both as a nation and as part of the wider world. Even since 1984 the global scene has changed considerably. We are much more aware of the process of globalisation than we were then. We are being forced to acknowledge our interdependence with the rest of the world. We can no longer ignore environmental and ecological issues. The Cold War is over, for the time being at least; yet there are many pockets of deep unrest and local violence around the world. What sort of better world can we now expect or would we like to see? We shall address these questions particularly in the second chapter. In the third we shall explore how to go about trying to reach the world we hope for, and in the fourth we shall examine the obstacles in the way. First, however, we shall be looking into the past to get a better understanding of how we got here. The most basic question to begin with is actually this: Why should we even bother thinking about a world better than this one? Why are we not satisfied with what we have? The very fact that we are so often yearning for a better world points to something deeply embedded in the culture which has shaped us. We owe it in part to the Bible, which has provided so much of the content of western culture in the last two millennia. The quest for a better world is a theme that runs through the Bible from beginning to end, even though that future world came to be envisioned in a wide variety of forms. Abraham and the Promised Land It started with the story of Abraham, who was later to become, for Jew, Christian and Muslim, the very model of a person who walked forward into the future with faith. All that we know of Abraham has come down to us in the form of a legendary saga. Even that was shaped by later generations, who used it express their own aspirations. It is not the historicity of these ancient legends but their symbolic meaning that is important for us. Abraham is portrayed as a voluntary migrant setting off on a journey in answer to a divine call. He heard a voice which said: “Go from your country, away from you family and neighbours, to the land that I will show you.” Very much later an unknown New Testament writer added to the saga by saying that Abraham was “looking for the city which has foundations, whose builder and maker is God”. But the earlier Hebrew people simply referred to the destination as a land. Abraham was making his way to “the land of promise”. The hope of reaching a land promised by God not only initiated the Judeo-Christian cultural path, but has sustained it for nearly 4000 years. The Abraham legend does reflect historical facts. Early in the second millennium before Christ various nomadic pastoral tribes migrated from Aramaea in Northern Mesopotamia to settle permanently among the more highly cultured city-states of Canaan. It is worth examining the patriarchal legends which that migration gave rise to. First, they describe life as a journey. This has long been a useful way for us individuals to understand the nature of our personal life. But the metaphor is just as true of the human species as a whole. Only in the past 150 years have we been able to appreciate that fact: it is only since then that we have become aware of the long evolution of life on this planet. An important part of that story is not only the biological evolution of the human species but also, subsequently, the evolution of human culture. By culture I mean the mode of thought and style of living which make us human. For some two million years humankind has been engaged in a cultural journey, and still is. It is a journey in which we are not at all clear where we are going. We are like Abraham, of whom the New Testament said “he went out, not knowing where he was to go”. An urge to go somewhere We humans as a species do not know where we are heading on this planet – or even whether we are going anywhere. Yet from time to time we experience an inner urge that we ought to go somewhere. This manifested itself in the European motivation to explore the world and colonise it. It is reflected in the widespread desire in the scientific world to be continually making progress. It was shown in the passion to put a man on the moon. It is felt by individuals in the urge to climb the highest mountain, or simply set off on what they call their OE. It is reflected in a term dear to all economists – the achievement of economic growth. We are told we should be always improving our material standard of living. Deeply embedded in the culture that shapes us is this urge to go somewhere. It was not always so. For most of the two million years of human cultural evolution, so far as we can tell from scanty evidence, our far distant forebears were chiefly intent on preserving the way of life they had inherited from their ancestors. They looked back to the mythical time of origins as the golden age; since that time any change they usually judged to be for the worse. We, too, often show a bit of that nostalgia for better times in the past, even though we have a tendency to look at the past through rose-coloured spectacles. But from around the time of Abraham, human culture began to change. Starting with a few pioneering souls at first, humans began to look ahead and picture another kind of world better than the one they knew. It was this shift of attention from the past to the future which, among other things, led to the Axial Period in the first millennium BCE – the period which gave rise to the so-called “world religions”. The term “Axial Period” was used to describe how human culture seemed to make a giant shift on its axis. For the first time humans were no longer content simply to preserve the status quo, but chose to take the initiative in changing things for the better. They began to develop the notion that human society was also on a journey. This is one of the symbolic and permanent meanings of the Abraham saga. A pivotal change Our widespread concern with history – the human story – came to birth in this period. Previously time had been experienced as a matter of going round in circles – days, months, years, generations – in which one kept returning to where one had started. From the Axial Period onwards time came to be seen as a line stretching out into the unknown future. You never pass the same point twice. Each moment is unique. Each generation can build on the products of the past. Culture can be accumulative and progressive. Now there are goals to be reached. As the Bible tells it, all this began with Abraham. The second aspect of the Abraham legend which remains very relevant is that Abraham was looking for a land to possess. This element of the legend also reflected a fact – the cultural change that was taking place quite generally in the ancient world. The cultural event that is described symbolically in the story of one man was spread over several millennia. This was the change from the migratory life of food-gatherer, hunter and pastoralist to the settled life of the agriculturist, a change that involved settling down in permanent residence. The agriculturists needed to possess and protect the land on which they depended for food. This cultural transition is reflected also in the ancient myth of Cain and Abel, where there is hostility between Cain the agriculturist and Abel the pastoralist. In the end it was the agriculturist who won, but at a cost. This myth was shaped by memories from the patriarchal period of the clash between the incoming Hebrew tribes and the indigenous Canaanites. The transition to an agricultural way of life made land possession a necessity. Yet this cultural transition is quite recent relative to the total period of human habitation of this planet. Before that, the earth was one vast common, owned by nobody. There were no humanly created boundaries and people were free to wander wherever they chose. Since the time of the agricultural revolution, that has no longer been wholly the case. This is why, when the population of a society suddenly expanded, it felt obliged to go out and take possession of more land, if necessary by conquest. This is why, even in more recent times, the European nations went out and colonised the world. As European population expanded during and after the Industrial Revolution, nations found it desirable to export their surplus population. In the 20th century the expansionist designs of Japan, Italy and Germany led to major wars. Today land possession has become a more urgent issue than ever, and will become the source of increasing tension and dispute during this century. It is sadly ironic that the Israelis and the Palestinians are today both vying with each other to possess the very same piece of land over which the Canaanites and the Hebrews fought 3000 years ago. And Israelis still claim it is theirs by divine right, since it is the land promised by God to Abraham long ago. The urban revolution There is still a third aspect of the agricultural revolution which remains relevant. It not only brought about a population increase, but it led to the building of walled cities for self-protection. Life in the city led in turn to a diversification of skills other than agriculture. Urban life had some great advantages, but there was a price to pay. It was the loss of the complete freedom experienced by the pastoralist – a freedom jealously preserved by the Middle East Bedouin to this day. The biblical myth of Cain itself connects this loss of freedom with the advent of urban life, though in a rather quaint way. Cain the agriculturalist had to bear the mark of a murderer because he had killed the life of the pastoralist, as symbolised in Abel; so he went off and built a city. When humankind lived the life of the hunter and food-gatherer, and even the life of the pastoralist, people were the passive recipients of the fruits of the earth. When humankind developed the life of the agriculturalist, people became active developers of the earth. By their skills they increased the fruits of the earth. Then, as humankind developed an urban existence, people began to live not only from the fruits of the earth, but also from the products of their own cultural activities. To a degree they began to be separated from the forces of nature. All these changes followed after land possession became important. This possession of the land of divine promise has remained an article of faith in Judaism ever since. It has sustained Jews through many centuries of being forcefully exiled from the land and of being shamelessly persecuted by the Gentiles, even to the point of genocide in the Nazi Holocaust. The symbolic words “next year Jerusalem”, spoken at the celebration of every annual Passover, kept alive the hope of their ultimate return to the land of promise some time in the future. As the long history of the people of Israel makes clear, it is not sufficient merely to possess the land. Equally important is the kind of society in which people live on the land. Further basic components of a desirable world are social order and harmony. The very entry of the ancient Hebrews to the land of Canaan, both under the patriarchs and under Joshua, led initially to a period of social upheaval bordering on chaos. The Bible describes it simply as a time when “everybody did what was right in his own eyes”. That is a euphemistic way of referring to anarchy. The ancient Israelites overcame anarchy by establishing a kingdom. The one period when the institution of monarchy was relatively successful for the Israelites was the short period of 40 years under King David. So much was this the case that the kingdom of David came to be regarded as a golden age which, once lost, all later generations wished to be restored. Yet for centuries their hopes for this future eluded them. Jesus’ kingdom At the time of Christian origins the restoration of the kingdom of David was still a paramount concern for many Jews. Even the disciples are reported to have asked Jesus: “Lord, will you at this time restore the kingdom to Israel?” It is widely acknowledged today that the chief message of Jesus was certainly about a kingdom – but a very different kingdom from that of the past. After all, the human rulers of the Davidic kingdom, including even David himself, had proved far from ideal. Some of them, like his son Solomon, had shown themselves to be eastern despots. Jesus called the kingdom he talked about “the kingdom of God”; and much of his teaching, particularly in his parables, was intended to describe what such a kingdom would be like. Since God was conceived as the source of all justice, love and righteousness, then any domain ruled by God would be one in which those virtues prevailed, shaping people’s relationships and the general life of the community. It is now becoming doubtful if the first Christians ever adequately understood the teaching of Jesus about the kingdom. They expected God to establish this kingdom by some cataclysmic event, and went out proclaiming its imminent arrival. Although that expectation is clearly evident in the New Testament, many scholars today question whether that was ever taught by Jesus. In any case, that original expectation was never fulfilled; it was the failure of that kingdom suddenly to arrive that led, during the second, third and fourth centuries, to the mental formation of quite a different world to come. A spiritual alternative Eventually Christians lost all hope of ever seeing a better world in the here and now. They transferred their hopes to a more spiritual world beyond this physical world of space and time. This transition took place over some four centuries, and occurred unconsciously more than consciously. Some of it went back to ideas already taking root in pre-Christian Judaism. In Maccabaean times, 150 years before the Christian era, even the Jewish hopes of the restoration of the Davidic kingdom were being sorely tested, particularly when their young men were being killed in their prime in defence of the faith of their fathers. Jews began to entertain the hope of a great Last Judgment, when God would justify the righteous and punish the wicked. To make this possible God would need to resurrect the dead to hear the final sentence and receive their just reward. This is all clearly stated in the Book of Daniel: “And many of those who sleep in the dust shall awake, some to everlasting life, and some to shame and everlasting contempt.” We now know that many of these ideas which were taking root in the Jewish thought of the time emanated from the Persian religion of Zoroastrianism. They were particularly dominant among the Pharisees – one linguistic theory is that the term “Pharisees” started as a nickname for those Jews who adopted Persian or Farsi ideas. One of many elements in Jewish thought which reflects this Persian influence is the word paradise. It was the Persian name for a garden park with trees and flowers, something for which Iran (or Persia) is famous to this day. When the Jews translated their Bible into Greek some 200 years before the Christian era, they borrowed this word “paradise” to translate the “garden” in which Adam and Eve were placed. By the time of the Jewish philosopher Philo (a contemporary of Jesus), many Jews had come to refer to the Garden of Eden simply as Paradise. Not only was this usage carried on by the Christians but, as their ideas about a new world beyond the grave began to develop, they increasingly referred to the new life of bliss to which the righteous would be sent as “paradise”. This usage is reflected very succinctly in the great classics of John Milton, Paradise Lost and Paradise Regained. The original Christian hope, as we have seen, was for the transformation of the world of here and now into the kingdom of God. The words of the Lord’s Prayer make it clear: “May your kingdom come. May your will be done here on earth, just as it is in heaven.” But though the prayer remained, all talk of the kingdom of God on earth became muted in the course of time. The kingdom of God came to be associated exclusively with God’s dwelling-place in the sky. This transition was aided, incidentally, by a linguistic accident. You may have noticed that whereas the Gospels of Mark and Luke speak frequently of the kingdom of God, the Gospel of Matthew refers nearly always to “the kingdom of heaven”. This is because Matthew’s Gospel was intended for readers with a strongly Jewish background. The fourth commandment forbids Jews to take the name of God in vain, so to be on the safe side they avoided using the word God altogether. They replaced it with a synonym. Heaven, the dwelling-place of God, was such a synonym. The kingdom of heaven was simply another way of referring to the kingdom of God. In time, however, it had the effect of causing Christians to associate the kingdom of God with heaven rather than the earth. Even St John’s Gospel refers only twice to the kingdom of God. By the time of the creeds it found no mention at all. Hopes transferred to heaven In what became the classical form of Christianity, all the earlier hopes of a better world to come were thus transferred from this earth to the heaven above. Devout human imagination eventually created an elaborate mental picture of this spiritual world to be reached after death; it was divided into paradise, purgatory and hell. Only with the Renaissance did the focal point of attention begin to return to the earth. In the 16th century there began, step by step, the deconstruction of this spiritual world that had been constructed by ancient Christian imagination. The Reformers abolished purgatory in one fell swoop. By the 19th century theologians were raising moral objections to the concept of hell as a place of eternal punishment. During the 20th century the reality of heaven began to lose conviction, so much so that in 1999 even Pope John Paul II declared that “heaven is not a place but a state of mind”. For much more than 1000 years, Christian hopes of a better world were fastened firmly on an unseen world above. It was to this that the spires of the great mediaeval cathedrals pointed. But eventually this world also proved to be elusive. From Galileo onwards our whole understanding of this world of space and time began to change and to expand even beyond the limits of our imagination. It completely engulfed the heavenly spaces. It is fascinating that during the very time when the superstructure of the heavenly world was being dismantled, Christians began to sing hymns about building the kingdom of God here on earth. William Blake, strange visionary and theological conservative though he was, expressed it in his famous Jerusalem in the early 19th century. Note the words: I will not cease from mental fight . . .Till we have built JerusalemIn England’s green and pleasant land. Those words would have seemed heretical in the High Middle Ages. These modern Christians were learning again to speak of the kingdom of God coming here on earth. Later Charles Kingsley wrote a hymn which ends: And hasten, Lord, that perfect dayWhen pain and death shall cease,And thy just rule shall fill the earthWith health, and light, and peace. When ever blue the sky shall gleam,And ever green the sod:And man’s rude work deface no moreThe Paradise of God. Christians were rediscovering that this earth could be the paradise they sought. But, whereas the first Christians fully expected God to establish his kingdom by some cataclysmic event, the Christians of the 19th and early 20th centuries knew they had to build it themselves. That is why they began to sing such hymns as: Rise up, O men of God!His kingdom tarries long;Bring in the day of brotherhood,And end the night of wrong. Christian and other socialisms This is why a Christian Socialist movement arose about 1840, led by such people as Charles Kingsley and the theologian F.D. Maurice. The seventh Earl of Shaftesbury (1801-1885), even though he was a deeply committed evangelical Christian who expected the imminent return of Christ, nevertheless became one of the most effective social and industrial reformers in 19th-century England. In 1891 Pope Leo XIII issued an encyclical, Rerum Novarum, which was considered to be extremely progressive. It enunciated the Roman Catholic position on social justice, especially in relation to the problems created by the Industrial Revolution. While critical of socialism, it showed deep concern for the condition of the working classes. The western world entered the 20th century with considerable expectations that this world could be turned into an earthly paradise. Christians thought it would come by the spread of Christianity over the whole globe. Even the British Labour Party had its roots in the Methodist Church. From the early Christian socialists through to the liberation theologians of South America, the more liberal modern Christians have been working for the new world here on earth, and believe that it will come only if humans take the initiative. But because so much attention was now being focused on the earth rather than on heaven, the Christian West was becoming secularised. (The word secular simply means “having to do with this world of space and time”.) Besides Christian visionaries like Blake and Maurice, there were now secular visionaries intent on building a new world. Robert Owen and Karl Marx became so critical of the church for continuing to defend the spiritual superstructure that they felt the church was a stumbling block that prevented the coming of the new world order here on earth. They dismissed the churches as offering only “pie in the sky when you die”. Then came World War I, a bloody struggle fought by the very nations which had been Christian for the longest time. It was a great blow to Christian expectations. Liberal Protestantism has never wholly recovered from this. Yet the western world generally, still motivated by its Christian past, tried to interpret the disaster of World War I as “the war to end all wars”. It proceeded in 1919 to found the League of Nations for the express purpose of preventing all war in the future. In the late 1920s and early 1930s there was a widespread wave of pacifism among Christians and secularists alike. All these efforts largely came to nothing. The new warless world did not eventuate. The League failed because of the refusal of member nations to put international interests before national interests. It was powerless in the face of German, Italian and Japanese expansionism. In the meantime social reform began to develop at the national level in the western world. Most drastic was the Russian Revolution, by which Lenin tried to implement Marx’s vision of the classless society. Elsewhere there was considerable social change, though less dramatic, resulting in pensions for the aged, free medical care for all, and the dole for the unemployed. These moves came to fruition in various social security systems, commonly known now as the welfare state. Michael Savage, in introducing New Zealand’s social security policies, referred to them as “applied Christianity”. For many people it seemed that the earthly paradise was at last coming within reach. It did not mean that the kingdom of God had fully arrived. Certainly there was much about the new secular world that seemed consistent with the Christian teaching about the kingdom of God. Yet too many things seemed to be going badly wrong – the Great Depression, World War II, the Nazi Holocaust, the Cold War and the threat of an all-out nuclear war. Humans, both Christian and secular, had been working hard to try to build paradise on earth, but despite some success, the setbacks were massive. Rising tempo of cultural change We have seen how the ancient biblical myths and legends reflected in symbolic ways the drastic cultural changes taking place in human existence both before and during the Axial Period. In the past 300 years there has been a parallel transition. We have moved from agriculturalism to industrialisation, with the consequent explosion in global population. There has been a sudden increase in urbanisation. Only 200 years ago less than three per cent of the world’s population lived in cities of 20,000 or more; today more than half of humanity is living an urban existence. We humans are increasingly becoming divorced not only from our rural roots, but also from our kinship with the forces of nature. As we have moved into the modern global world the same changes which marked the first transition have suddenly become magnified and cultural change has increased in tempo. From Abraham up until today our forebears have been looking for a better world. This they have successively referred to as the Promised Land, the kingdom of David, a kingdom ruled by God, a paradise in heaven, a paradise on earth, a classless society, a warless world, the welfare state. Sometimes the vision ahead seemed almost within reach, but each time the vision has faded. Each time paradise has eluded us there may have been a feeling of failure. Yet as we look back over this long cultural journey we can also see that, in cultural as well as material terms, we have come a long way. None of us really wants to go back even to the 19th century, let alone to the distant past. We have learned certain things about paradise in the course of our cultural journey. We now know that the only paradise we can hope for will be in this world of space and time. If we are to reach it, it will be by human effort and not by appeal to any supernatural forces. Further, it will come only by our collective efforts as a community, as a species. We must surrender any hopes of a paradise to come which are primarily for our own personal benefit. For us as for Moses, paradise will always be ahead of us: others are likely to benefit much more from our efforts to reach it than we ourselves do, and this will test our virtue to the limit. As we stand at the beginning of this new millennium, amid the pressures of rapid cultural change, globalisation and dramatic technological progress, what sort of “brave new world” can we now envisage as the paradise to come? We shall explore that in the next chapter.

Q: Oracle SQL: Use IN operator with inline array Is it possible to define an inline array to use with the IN operator in Oracle SQL 12c? Pseudo code: SELECT * FROM T_AUDIO_PLAYERS WHERE NAME IN {'foo', 'bar'}; Background: I have a Java tool, that's reading in valid .SQL files and replaces SQL-Variables like :NAME before execution. A: I am not sure if I understand your question correctly. However, if you change your {-brackets to (-brackets, this should already work: SELECT * FROM T_AUDIO_PLAYERS WHERE NAME IN ('foo', 'bar');

Increased plate and osteosynthesis related complications associated with postoperative concurrent chemoradiotherapy in oral cancer. Plate osteosynthesis is a widely used technique in head and neck reconstructive surgery. The objective of this study was to determine whether postoperative chemoradiotherapy, which was recently introduced for high-risk head and neck cancer, affects plate and osteosynthesis related complications. Fifty-two consecutive patients, who had undergone plate osteosynthesis for mandibular reconstruction between October 2003 and September 2006, were included in the study. The patients were divided into 3 groups: (1) surgery alone (n = 19), (2) surgery with postoperative radiotherapy (n = 14), and (3) surgery with concurrent chemoradiotherapy (n = 19). Outcome measures included any bone or plate related complications. The plate and osteosynthesis related complications occurred in 10.5% of patients in surgery-alone group, 28.6% in surgery with postoperative radiation group, and 63.2% in surgery with postoperative concurrent chemoradiotherapy group. The differences in the complication rates among these 3 groups were statistically significant (p = .003). In univariate analysis, postoperative radiation (p = .007) and concurrent chemotherapy (p = .003) were found to be significantly associated with complications. In multivariate analysis, only concurrent chemotherapy was found to be statistically significant (p = .002) with odds ratio of 7.72. Postoperative concurrent chemoradiotherapy significantly increases plate and osteosynthesis related complications in oral cancer.

Inductors are passive electrical components that are configured to generate a magnetic field that stores energy. Inductors are used in a wide variety of integrated circuit applications including radio frequency (RF) circuits such as low-noise amplifiers, voltage-controlled oscillators, and power amplifiers. Inductors having relatively small values are often built directly on integrated circuits using existing integrated chip fabrication processes. For example, an integrated inductor may be formed using one or more back-end-of-the-line (BEOL) metal interconnect layers. Inductor designers are commonly interested in an inductance as well as a quality factor (Q-factor) of an integrated inductor. The inductance of an integrated inductor is a measure of an amount of energy stored in an inductor. The Q-factor is a ratio of an amount of energy stored in an inductor to the amount of energy dissipated in the inductor (e.g., an ideal inductor has a high Q-factor).

Potential spatial overlap of heritage sites and protected areas in a boreal region of northern Canada. Under article 8-J of the Convention on Biological Diversity, governments must engage indigenous and local communities in the designation and management of protected areas. A better understanding of the relationship between community heritage sites and sites identified to protect conventional conservation features could inform conservation-planning exercises on indigenous lands. We examined the potential overlap between Gwich'in First Nations' (Northwest Territories, Canada) heritage sites and areas independently identified for the protection of conventional conservation targets. We designed nine hypothetical protected-area networks with different targets for woodland caribou (Rangifer tarandus caribou) habitat, high-quality wetland areas, representative vegetation types, water bodies, environmentally significant area, territorial parks, and network aggregation. We compared the spatial overlap of heritage sites to these nine protected-area networks. The degree of spatial overlap (Jaccard similarity) between heritage sites and the protected-area networks with moderate or high aggregation was significantly higher (p < 0.001) than random spatial overlap, whereas the overlap between heritage sites and the protected-area networks with no aggregation was not significant or significantly lower (p < 0.001) than random spatial overlap. Our results suggest that protected-area networks designed to capture conventional conservation features may protect key heritage sites but only if the underlying characteristics of these sites are considered. The Gwich'in heritage sites are highly aggregated and only protected-area networks that had moderate and high aggregation had significant overlap with the heritage sites. We suggest that conventional conservation plans incorporate heritage sites into their design criteria to complement conventional conservation targets and effectively protect indigenous heritage sites.

Facets: An Open Source Visualization Tool for Machine Learning Training Data - stablemap https://research.googleblog.com/2017/07/facets-open-source-visualization-tool.html ====== jxramos Very impressed to see the confusion matrix consist of the actual images in that deep zoom style rendering. We've implemented something similar in spirit in some image processing machine learning application but instead I have a traditional confusion matrix with counts that are "<a>" anchor links to a webpage that displays all the constituent images. Nice work Facets team. I particularly like this language here... "Dive is a tool for interactively exploring up to tens of thousands of multidimensional data points, allowing users to seamlessly switch between a high-level overview and low-level details. ...Dive makes it easy to spot patterns and outliers in complex data sets." [https://github.com/pair-code/facets#facets- dive](https://github.com/pair-code/facets#facets-dive) That's key functionality to drill into our data with powerful navigable dashboards and visualization tools. We're creating this seamless transition with some Python and Flask and Bokeh tooling but nothing as impressive is Facets. But we've cued in all the domain specific things of interest, but it's nice to see a general purpose feature set on display with Facets. ------ untangle I'm impressed. I would certainly have loved this when I was a practicing "data miner" (I'm old-ish). Anything that allowed me to better understand my data and models was welcome. I used DataDesk ([https://datadesk.com](https://datadesk.com)) back then. This tool should be useful to classic statistical modeling as well as DL. Given how easy it is to point-click-slide complex data transforms into existence, there's also a danger of mucking things up and creating overfits and so on. But that's a minor consideration given the rather obvious benefits. ------ canada_dry This looks amazing. And... I keep waiting for MS to provide an add-in to Excel that will allow ML analysis and similar visualization. Even better, someone beat MS to it and do one for Libre Calc. ~~~ baconner They've got all the building blocks really. For instance check out sand dance [https://www.microsoft.com/en- us/research/project/sanddance/](https://www.microsoft.com/en- us/research/project/sanddance/) It's just that Microsoft is so focused on getting you into azure services that they're pushing these capabilities up there instead. ------ TheIronYuppie Disclosure: I work at Google. This is one of many things coming up that help make the adoption of ML easier - we'd love to hear more about what else we can do and/or what problems you're running into as you adopt machine learning (either TensorFlow based or something else). Thanks! ------ jamesblonde I am curious about Jupyter support. It seems like it can run as a plugin to Jupyter, which would be ideal. I had a quick go at installing the jupyter plugin, documentation is a bit lacking once you've installed it. ~~~ tomashm Here's how to use Facets Dive inside Jupyter Notebook. 1\. Download and install as explained in "Enabling Usage in Jupyter Notebooks" at [https://github.com/pair-code/facets](https://github.com/pair-code/facets) 2\. Open a new notebook and copy&paste code from here: [https://github.com/PAIR- code/facets/blob/master/facets_dive/...](https://github.com/PAIR- code/facets/blob/master/facets_dive/Dive_demo.ipynb) ------ denzil_correa It's interesting that I can't see any text on Google Blogs on mobile - Safari (iOS) with ad blocker "Focus". I can see the article on Chrome iOS though.

Month: March 2019 Last week the Tampa Bay Buccaneers became the first NFL team in history to hire two women as full-time assistant coaches. This week at NFL league meetings in Phoenix, the man who made that history, Bucs coach Bruce Arians, talked to reporters about his adding Lori Locust and Maral Javadifar to his staff. “It’s time. It’s time and I’ll be happy when it’s not news anymore. That’s where it should be heading. “Two super-qualified people. (Lori Locust and Maral Javadifar.) “I had Dr. (Jen) Welter with me here (in Arizona) and it worked out fine. (Welter became first female … In the immediate aftermath of a SportsbyBrooks.com exclusive report uncovering the connection between Silicon Valley venture capitalist Christopher Schaepe and college admissions scandal kingpin Rick Singer, Connie Loizos of Techcrunch.com reported today that Schaepe is out at the firm he co-founded 19 years ago, Lightspeed Venture Partners. Excerpt: Sources say that soon after the admissions scandal broke, Schaepe hired a lawyer, then told Lightspeed, which made the decision to part ways with him. But seemingly, a sports blogger named Brooks Melchior played his own role in the news and why it burst into public view today. As Melchior noted … On March 14, 2019, 48 hours after the United States Justice Department announced it had caught red-handed dozens of mega-wealthy parents conspiring to fraudulently obtain admission into elite universities for their under-qualified sons and daughters as part of the largest college admissions scandal in United States history, NFL Hall of Fame quarterback Joe Montana shocked his Twitter followers with the following Tweet … What is being characterized by Federal law enforcement as the largest college admissions scandal in U.S. history began with the U.S. Justice Department charging 50 individuals with Federal crimes on March 12, 2019. The 200-page criminal complaint that accompanied those charges identified 58-year-old Californian Rick Singer as the ringleader of a vast conspiracy to admit academically and athletically unqualified children of wealthy parents to elite universities by taking advantage of the lower academic entrance requirements afforded collegiate athletes. … On March 12, 2019, the United States Justice Department announced it was charging 50 individuals with Federal crimes for their roles in what was described as the largest college admissions scandal in United States history. The ringleader of the vast conspiracy was identified as Rick Singer, a self-styled “admissions coach” who helped wealthy parents fraudulently obtain admission into an innumerable number of elite, American universities. Two days after the Federal indictments were made public …

Thursday, 13 February 2014 Women I Admire - THEWONDERFUL Ana White I first came across Ana White while fantasising about building a loft-bed for Sera when she gets older. I haven't done much carpentry in the past but I found her free plans for this loftbed house and I absolutely needed to know more about this woman. The story goes like this: Ana found herself building their own house board by board all on their own. It was then that she discovered her amazing talent for drawing up carpentry plans that anyone can make. She has since offered free of charge hundreds of plans that she says anyone can build. It is more complicated than assembling IKEA furniture but the satisfaction you get from knowing you created something from scratch is amazing. So many women are afraid to take on tasks that they see inherently as male. Some women are even afraid to change a light bulb and Ana teaches us that not only can a woman build and create int his way, but also inspire and teach others as well. I hope that my daughter grows into a woman confident enough to look after her home and environment and also to build it herself. Ana's free plans and inspiration will surely help me to teach at least a little bit of woodworking and carpentry to Sera.

Please note: our site will be unavailable from 22:57 to 23:12 for routine maintenance. We offer limited support for your version of the Internet Explorer browser. You can still use the site and complete a GP consultation, but not everything will work and look great. If you can, try to upgrade to a modern browser NHS 111 Service 111 is the NHS non-emergency number. It’s fast, easy and free. Call 111 and speak to a highly trained advisor, supported by healthcare professionals. They will ask you a series of questions to assess your symptoms and immediately direct you to the best medical care for you. NHS 111 is available 24 hours a day, 365 days a year. Calls are free from landlines and mobile phones. When to use it You should use the NHS 111 service if you urgently need medical help or advice but it's not a life-threatening situation. Call 111 if: you need medical help fast but it's not a 999 emergency you think you need to go to A&E or need another NHS urgent care service you don't know who to call or you don't have a GP to call you need health information or reassurance about what to do next For less urgent health needs, contact your GP or local pharmacist in the usual way. If a health professional has given you a specific phone number to call when you are concerned about your condition, continue to use that number. For immediate, life-threatening emergencies, continue to call 999. How does it work? The NHS 111 service is staffed by a team of fully trained advisers, supported by experienced nurses and paramedics. They will ask you questions to assess your symptoms, then give you the healthcare advice you need or direct you straightaway to the local service that can help you best. That could be A&E, an out-of-hours doctor, an urgent care centre or a walk-in centre, a community nurse, an emergency dentist or a late-opening chemist. Where possible, the NHS 111 team will book you an appointment or transfer you directly to the people you need to speak to. If NHS 111 advisers think you need an ambulance, they will immediately arrange for one to be sent to you. Calls to 111 are recorded. All calls and the records created are maintained securely, and will only be shared with others directly involved with your care.

Yamaha DTX562 Kit review Top of the line electronic kit Our Verdict While the lower-end DTX kits offer a great deal for your wallet, it is worth shelling out the extra for the enhanced response and feel of these TCS pads. Pros TCS pads play very well. DTX module is swift and sounds impressive. Cons Not much! One of the highlights of the Spring Musikmesse and the recent online MusicRadar Drum Expo 2013 was Yamaha's new DTX502. This new module is said to have a "vastly improved sound quality, highly expressive playability and user-friendly functionality". It steps into the place of the DTX500, occupying the lower mid-range position of Yamaha's electronic kits. Build Giving scope for varying budgets and playing applications, Yamaha has produced four five-piece kits to accompany the new module. Here we look at the top of the series DTX562. "The DTX502 has over twice the memory capacity and around 250 more sounds than its predecessor" The module has all the allure of any hi-tech gadgetry, with its shiny black top panel interspersed with a selection of clearly labelled, intuitively placed buttons, LED/LCD displays and the familiar quick access wheel. There is over twice the memory capacity and around 250 more sounds than its predecessor. The DTX502 now gives the user a total of 691 drum and percussion samples and 128 keyboard voices. There is also plenty of space for user kits - 50 of them in fact - that's 30 more than the previous model. While many of the drum samples are taken from Yamaha's classic acoustic drums, this module is the first in the DTX range to incorporate additional sounds created by third-party VST developers. You are not confined to these onboard voices however thanks to the USB port, which gives the user access to the wealth of drum sample libraries readily available. Also, when connected to a computer and using Yamaha's free downloadable Musicsoft app, you can transfer your own samples and midi song data into the module's on-board flash memory and back-up user-created kits and settings. The review set is a combination of two packages: the DMR502 module/rack set and the top of the series DTP562 pad set. The lightweight and robust rack features a resin ball-type snare mount and the DTX502 module. The pad set includes the excellent KP65 kick pad and the triple-zoned XP80 snare which features Yamaha's excellent Textured Cellular Silicone head. As well as on the snare, the DTX562 also features the TCS heads on all three of the 7" toms. There are three 131⁄2" cymbal pads - one each for the crash, ride and hi-hat. The RHH135 hi-hat pad comes in two sections - the pad itself and an additional sensor which sits atop of the supplied hi-hat stand. Hands On When powering on for the first time the module requests the user to input kit type - an initial requirement for pad/triggering optimisation. "The interpretation of the module is both swift and incredibly accurate" The interpretation of the module is both swift and incredibly accurate and the sound is literally striking. The samples are crisp and clean without being clouded or 'improved' with compression or masses of reverb - just a really great drum sound. The selection of intelligently compiled kits and the small but diverse range of songs is equally impressive. Features on the cymbals such as muting, swells and choking is authentic and makes the whole set more enjoyable to play. One particular kit which demonstrates a little of the DTX562 potential is the 'Funk Master' kit - this has the usual snare, hi-hat and kick but two of the toms are used to trigger/halt a funk groove while the other has some snappy organ solos - constructive and fun. So too are the practice routines which makes these kits great platforms for honing those drumming skills. The pads of the DTX562 take a good kit up to a whole new level. It's instantly very playable, and appears extremely dynamic and responsive. The TCS pads respond beautifully and feel completely natural without over-exciting the sticks. The TCS snare, cymbals and KP65 kick are equally impressive. The hi-hat pad mounted on the stand also feels natural and responds superbly. Producing all the usual hi-hat chops appears far easier and accurate than with just the hi-hat controller.

Samsung will likely be offering some new functionality in the Galaxy Note 4 , which is set to be unveiled soon enough, but the company could well be looking to add unique covers to the list of accessories. It's reported that Samsung is developing an ultrasonic cover, specifically designed for those who are visually impaired and wish to use the device. The cover would be able to detect nearby objects and provide appropriate feedback. According to SamMobile sources, three levels of sensitivity are to be available, covering short, medium and long ranges. This won't replace physical aids available today and isn't meant to be utilized without aid from a guide dog or other means, but it's a handy option nonetheless. Samsung isn't shy when it comes to packing as many features and interesting advances in to products as possible, but sometimes it seems as though the company really has some great ideas, this ultrasonic cover being one of them. The cover is expected to be announced alongside the Galaxy Note 4, so we'll hopefully have more details at the start of next month. Let us know what you'd like to see in the Galaxy Note 4. Source: SamMobile

Introduction {#s1} ============ Amyloid diseases, including many neurodegenerative diseases, are increasingly prevalent in aging societies (Eisenberg and Jucker, [@B15]; Dobson, [@B13]). The pathogenesis of these devastating diseases is closely associated with aberrant protein aggregation (Chiti and Dobson, [@B11]). In the progression of amyloid aggregation, soluble proteins undergo a series of conformational changes and self-assemble into insoluble amyloid fibrils (Riek and Eisenberg, [@B49]). Plaques containing amyloid fibrils are one of the histological hallmarks of Alzheimer's and Parkinson's diseases (Lee et al., [@B39]; Spillantini et al., [@B56]; Koo et al., [@B31]). Various strategies have been exploited to interfere with the process of amyloid aggregation by targeting different conformational species, including stabilizing monomers by antibodies (Ladiwala et al., [@B35]), redirecting monomers to nontoxic off-pathway oligomers by polyphenolic compounds (Ehrnhoefer et al., [@B14]), accelerating mature fibril formation by fibril binders (Bieschke et al., [@B7]; Jiang et al., [@B27]), inhibiting fibril growing by peptide blockers (Seidler et al., [@B53]), and disrupting amyloid assembly by nanomaterials (Hamley, [@B21]; Huang et al., [@B24]; Lee et al., [@B38]; Li et al., [@B18]; Han and He, [@B22]). Many of these strategies show promising inhibitory effects against toxic amyloid aggregation (Härd and Lendel, [@B23]; Arosio et al., [@B4]), but so far none has led to clinical drugs because of unsettled issues such as target selectivity, side effects, membrane permeability and penetration of the blood-brain barrier. Amyloid β (Aβ) has long been targeted for drug development and therapeutic treatment of Alzheimer's disease (Caputo and Salama, [@B8]; Haass and Selkoe, [@B20]; Sevigny et al., [@B54]). In addition to the common difficulties in targeting amyloid proteins, Aβ is especially challenging since it contains multiple species with various lengths generated by γ-secretases (Acx et al., [@B2]; Kummer and Heneka, [@B33]; Szaruga et al., [@B57]). Many studies have shown that Aβ~42~ rather than Aβ~40~ is more prone to form toxic aggregates, and the ratio of Aβ~42~/Aβ~40~ is better correlated with the pathology rather than the amount of each individual Aβ species (Lewczuk et al., [@B40]; Jan et al., [@B26]; Kuperstein et al., [@B34]). However, selective inhibition of Aβ~42~ is very difficult because it is only two residues longer than Aβ~40~ at the C-terminus. In this work, we targeted two key amyloid-forming segments of Aβ~42~ (^16^KLVFFA^21^ and ^37^GGVVIA^42^) based on the cryo-EM structure of Aβ~42~ fibrils reported recently (Gremer et al., [@B19]). We designed peptide binders of these two segments using RosettaDesign with the atomic structures of these two segments as templates (Sawaya et al., [@B52]; Colletier et al., [@B12]). The designed sequences showed inhibitory effect to Aβ~42~ fibril formation. We further utilized a macrocyclic β-sheet mimic scaffold (Zheng et al., [@B60]; Cheng et al., [@B9], [@B10]) to constrain the designed peptide inhibitors in β-conformation, which significantly enhanced the inhibitory effect on Aβ~42~ aggregation. Furthermore, we show that the peptide inhibitor designed to target the C-terminus of Aβ~42~ can selectively inhibit Aβ~42~ aggregation, but not to that of Aβ~40~ or other amyloid proteins. Our work shed light on the application of structure-based rational design combined with chemical modification in the development of therapeutics for Alzheimer's disease and other amyloid-related diseases. Materials and Methods {#s2} ===================== Structure-Based Design by Rosetta Software Package {#s2-1} -------------------------------------------------- ### Initial Structure Model for Design {#s2-1-1} We chose two key amyloidogenic Aβ segments, ^16^KLVFFA^21^ and ^37^GGVVIA^42^, for our inhibitor design. The design templates were taken from the crystal structures of KLVFFA (PDB ID: 2Y2A) and GGVVIA (PDB ID: 2ONV). The backbone of the inhibiting pentapeptide was fully extended to mimic β-conformation. This extended peptide was aligned with the N, C, and O backbone atoms of the template. ### Rosetta Design of Fibril-Inhibiting Peptides {#s2-1-2} The peptide inhibitors were subsequently designed to ensure maximal interaction, while keeping the template amino acid sequence fixed. Computational designs were carried out using the RosettaDesign software package[^1^](#fn0001){ref-type="fn"}. This algorithm involves building side-chain rotamers of all L-amino acids onto a fixed peptide backbone. The optimal set of side-chain rotamers at each position with the best interaction energy is then identified, with the guidance of a full-atom energy function containing a Lennard-Jones potential, an orientation-dependent hydrogen bond potential, an implicit solvation term, amino acid-dependent reference energies, and a statistical torsional potential that depends on the backbone and side-chain dihedral angles. Finally, the entire structure was refined by simultaneously optimizing degrees of freedom on: (1) the rigid-body geometry between the inhibiting peptide and template; (2) backbone torsions of each peptide; and (3) side chain torsions of each peptide. The lowest-energy model was picked and the interaction energies of each final model from different peptide inhibitors are listed in [Table 1](#T1){ref-type="table"}. ###### Characteristics of designed peptide inhibitors. Targeting sequence Aβ target Inhibitor ID Inhibitor sequence Predicted binding energy (kcal/mol) Buried area (Å^2^) Shape complementarity (Sc; Lawrence and Colman, [@B36]) -------------------- ----------- -------------- -------------------- ------------------------------------- -------------------- --------------------------------------------------------- ^16^KLVFFA^21^ Aβ~42~ K6A1 TLWYK −16 280 0.65 Aβ~40~ K6A2 EHWYH −13 278 0.7 G6A1 HYFKY −19 271 0.67 ^37^GGVVIA^42^ Aβ~42~ G6A2 HYYIK −15 252 0.72 G6A3 KYYEI −14 270 0.66 Circular Dichroism Spectroscopy (CD) {#s2-2} ------------------------------------ Chirascan spectrometer (Applied Photophysics) equipped with a Peltier temperature controller (Quantum Northwest) is used to acquire the CD spectra. Far UV spectra (240--180 nm) are collected in 0.05 cm path-length quartz cells. Sample concentration is 600 μM. All measurements are conducted at 23°C. Water is used as blank for subtraction from corresponding samples. Secondary structure is predicted from CD using CDPro (Eisenberg and Jucker, [@B15]). Preparation of Aβ~42~ and Aβ~40~ {#s2-3} -------------------------------- Both Aβ~42~ and Aβ~40~ were purified from *E. coli* expression system as reported previously (Dobson, [@B13]). The expression constructs contain an N-terminal His-tag, followed by 19 repeats of Asn-Ala-Asn-Pro, the Tobacco etch virus (TEV) protease site, and the sequence of Aβ~42~ or Aβ~40~. Purification of Aβ~42~ and Aβ~40~ follows the same experimental procedure. Briefly, the Aβ fusion protein was overexpressed into inclusion bodies in *E. coli* BL21(DE3) cells. The inclusion bodies were solubilized in 8 M urea, followed by washing in a high salt and detergent-containing solution. The Aβ fusion proteins were purified through HisTrap^TM^ HP Columns, followed by reversed-phase high-performance liquid chromatography (RP-HPLC). After cleavage by TEV protease, Aβ was released from fusion protein, and purified through RP-HPLC followed by lyophilization. To disrupt preformed Aβ aggregates, lyophilized Aβ powder was resuspended in 100% HFIP and incubated at room temperature for 2 h. HFIP was fully removed by evaporation. Before used in ThT or MTT assay, Aβ was freshly dissolved in 10 mM NaOH, solubilized by sonication. Aβ is further diluted to 200 μM in phosphate buffer saline (PBS) as a stock solution. Synthesis of Designed Macrocyclic Peptides {#s2-4} ------------------------------------------ Designed macrocyclic peptides were synthesized by standard Fmoc solid-phase peptide synthesis. In brief, with Boc-Orn(Fmoc)-OH attached onto 2-chlorotrityl chloride resin, the linear peptide was elongated by standard automated Fmoc solid-phase peptide synthesis. Then, the peptide was cleaved from the resin under mildly acidic conditions, followed by being cyclized to the corresponding protected cyclic peptide by slow addition to HCTU and DIEA in dilute (ca. 0.5 mM) DMF solution. Since the C-terminus of the protected linear peptide comprises an amino acid carbamate (Boc-NH-CHR-COOH), the cyclization condition efficiently avoids problematic epimerization. The final deprotection with TFA solution followed by RP-HPLC purification yielded macrocyclic peptides in 18%--43% overall yield, based on the loading of Boc- Orn(Fmoc)-OH attached onto the resin. ^1^H NMR Spectroscopy {#s2-5} --------------------- ^1^H NMR experiments for the designed macrocyclic peptides were performed in D~2~O with the internal standard 4,4-Dimethyl-4-silapentane-1-ammonium trifluoroacetate (DSA) at 500 MHz (Brüker Avance) or 600 MHz (Brüker Avance). All peptides were studied at 2 mM in D~2~O at 298 K. Sample solutions were prepared gravimetrically by dissolving the macrocyclic peptides directly in solvent. All amino groups were assumed to be protonated as the TFA salts for molecular weight calculation. The data were processed with the Brüker XwinNMR software. ThT Fluorescence Assay {#s2-6} ---------------------- Thioflavin T (ThT) fluorescence assays were performed to monitor the real-time aggregation of Aβ~42~ and Aβ~40~ in the absence or presence of designed peptides. ThT assays were conducted in 96-well plates (black with flat optical bottom) in a Varioskan fluorescence plate reader (Thermo Scientific, 444 nm excitation, 484 nm emission). Each experiment was run in triplicates. The reaction solution contained 30 μM pre-disaggregated Aβ~42~ or Aβ~40~, 10 μM ThT, and designed peptides at indicated concentrations in PBS. The ThT assay was conducted at 37°C, without shaking for the Aβ~42~ aggregation assay, and with shaking (300 rpm) for Aβ~40~ aggregation assay. The fluorescence readings were collected every 2 min. Native Gel Electrophoresis {#s2-7} -------------------------- Purified Aβ~42~ powder was pre-treated by HFIP and dissolved in PBS buffer as described above. Aβ~42~ solution was diluted to a final concentration of 10 μM with or without the macrocyclic peptides mcG6A1, mcG6A2, and mcK6A1 (the final concentration of the inhibitors was 50 μM), and incubated at 37°C for 7.5 h. The samples were separated by a NativePAGE 4%--16% BisTris Gel (Novex, USA) and transferred to a nitrocellulose membrane pre-packed in iBlot 2 NC Mini Stacks (Novex, USA) by iBlot 2 Dry Blotting System (Life technologies, USA). The membrane was probed by β amyloid, 1--16 (6E10) Monoclonal Antibody (Covance, USA) and secondary anti-mouse IgG-HRP (MBL, USA), and detected with SuperSignal West Pico Chemiluminescent Substrate (Thermo, USA). The freshly made Aβ~42~ sample without inhibitors was loaded to a separated native gel and detected by the same method as a 0-h control. The molecular weight of the protein aggregates or monomer were accurately determined by the protein standard especially for native gel (Life technologies; cat. \# LC0725). Transmission Electron Microscopy (TEM) {#s2-8} -------------------------------------- For specimen preparation, 5 μl of each sample was deposited onto a glow-discharged carbon film on 400 mesh copper grids, followed by washing in water twice. The grids were then stained in 0.75% uranyl formate. A Tecnai G2 Spirit transmission electron microscope operating at an accelerating voltage of 120 kV was used to examine and visualize the samples. Images were collected by a 4k × 4k charge-coupled device camera (BM-Eagle, FEI). Cell Viability Assay {#s2-9} -------------------- We performed MTT-based cell viability assays to evaluate the toxicity of Aβ~42~ in the absence or presence of the designed peptides. We used a CellTiter 96 aqueous non-radioactive cell proliferation assay kit (Promega cat. \# G4100). PC-12 cell lines (ATCC; cat. \# CRL-1721) were used to test the cytotoxicity of Aβ~42~ under different conditions. PC-12 cells were cultured in ATCC-formulated RPMI 1640 medium (ATCC; cat. \# 30-2001) with 5% fetal bovine serum and 10% heat-inactivated horse serum. Before the cell viability experiment, PC-12 cells were plated at 10,000 cells per well in 96-well plates (Costar; cat. \# 3596), and cultured for 20 h at 37°C in 5% CO~2~. For the preparation of Aβ~42~ and peptide inhibitors mixture solutions, purified and pre-disaggregated Aβ~42~ samples were dissolved in PBS to a final concentration of 5 μM, followed by the addition of different peptide inhibitors at indicated concentrations. The mixture solution was filtered through a 0.22 μm filter, followed by incubation at 37°C without shaking for 16 h. To initiate the cell viability assay, 10 μl of pre-incubated mixture was added to each well containing 90 μl medium. After incubation at 37°C in 5% CO~2~ for 24 h. Fifteen microliter Dye solution (Promega; cat. \# G4102) was applied into each well. After incubation for 4 h at 37°C, 100 μl solubilization Solution/Stop Mix (Promega; cat. \# G4101) were added. After further incubation at room temperature for 12 h, the absorbance reading was collected at 570 nm with background reading at 700 nm. Four replicates were measured in parallel for each sample. The cell survival rate was normalized by using the PBS-treated cells as 100% and 0.02% SDS-treated cells as 0% viability. Results {#s3} ======= Structure-Based Design of Peptide Inhibitors {#s3-1} -------------------------------------------- To effectively inhibit Aβ fibril formation, we targeted two key amyloid-forming segments of Aβ~42~: ^16^KLVFFA^21^ and ^37^GGVVIA^42^ ([Figure 1A](#F1){ref-type="fig"}). The ^16^KLVFFA^21^ segment has been identified as a key segment accounting for both Aβ~42~ and Aβ~40~ nucleation and fibrillation (Ahmed et al., [@B3]; Colletier et al., [@B12]; Fawzi et al., [@B16]; Lu et al., [@B42]). In the known structures of Aβ fibrils including the recent cryo-EM structure of Aβ~42~ and the previous solid-state NMR structure of Aβ~40~ (Paravastu et al., [@B48]; Ahmed et al., [@B3]), this segment forms extended β-strands and stacks repetitively along the fibril axis to form the Aβ fibril core ([Supplementary Figure S1](#SM1){ref-type="supplementary-material"}). Thus, we selected ^16^KLVFFA^21^ as one of our design targets. In addition, the cryo-EM structure of Aβ~42~ fibril shows that the C-terminal segment ^37^GGVVIA^42^ plays an essential role in the fibril formation ([Supplementary Figure S2](#SM1){ref-type="supplementary-material"}). ^37^GGVVIA^42^ of one protofilament interdigitates *via* side chains with its counterpart of the neighboring protofilament forming a steric-zipper-like interaction to compose the mature fibril. Therefore, preventing the self-assembly of either ^16^KLVFFA^21^ or ^37^GGVVIA^42^ may potentially inhibit the assembly of Aβ~42~ fibrils. {#F1} For structure-based computational design, we used the atomic structures of ^16^KLVFFA^21^ (PDB ID: 2Y2A) and ^37^GGVVIA^42^ (PDB ID: 2ONV) as templates. The atomic structures of these two segments represent their conformations in the context of the full-length Aβ fibrils ([Figures 1A,B](#F1){ref-type="fig"}). Based on the structures of the two targeting templates, we designed pentapeptides that bind the targeting segments to block the stacking of Aβ molecules along the fibril axis, thus inhibiting fibril growth ([Figure 1C](#F1){ref-type="fig"}). We extracted a five-stranded layer from the steric-zipper structure of each segment, and docked a fully extended pentapeptide backbone on one end of the β-sheet. Then, we maximized the backbone interaction with the template by forming a backbone H-bonding network. To further increase the binding affinity and selectivity, we searched for the canonical L-amino acids at each position of the pentapeptide, using RosettaDesign (Leaver-Fay et al., [@B37]) for the side chains and their conformations, that provide maximal interactions with the template. Next, we calculated the binding energy, buried surface area and shape complementarity of the binding interfaces of the predicted binding models, and proceeded with experimental validation for the top-ranking designs. Using ThT fluorescence assay, we observed that the top-5 designs showed inhibitory effects on Aβ~42~ amyloid aggregation by significantly delaying the aggregation lag time (Xue et al., [@B59]; Knowles et al., [@B30]; [Figure 2](#F2){ref-type="fig"}). Among them, two peptide inhibitors (K6A1 and K6A2) were designed for targeting ^16^KLVFFA^21^ and three (G6A1-G6A3) were for ^37^GGVVIA^42^ ([Table 1](#T1){ref-type="table"}). Furthermore, unlike their targeting segments, the five designed peptides do not form amyloid fibrils by themselves ([Supplementary Figure S3](#SM1){ref-type="supplementary-material"}). {#F2} Constraining the Structures of Designed Peptides With a Chemical Scaffold {#s3-2} ------------------------------------------------------------------------- We next sought to enhance the potency of the peptide inhibitors. In our design, the peptide inhibitors were expected to adopt an extended β-strand conformation to maximize the interaction with the template ([Figure 1C](#F1){ref-type="fig"}). However, in solution, the peptides are mainly unstructured ([Supplementary Table S1](#SM1){ref-type="supplementary-material"}). Thus, upon binding to the template, the peptides need to undergo conformational change to form extended β strands, which causes an entropy decrease and thus weakens the binding affinity of the peptides to the template. To overcome the entropy lost during the conformational change, we adopted a macrocyclic β-sheet mimic scaffold to fix the peptide binders into β strands ([Figure 3A](#F3){ref-type="fig"}). The Nowick group has developed a series of macrocycles in different sizes as robust scaffolds for displaying peptides of interest in β-conformation (Liu et al., [@B41]; Cheng et al., [@B10]; Salveson et al., [@B50]; Kreutzer et al., [@B32]). According to the length of our designed peptides, we chose a 42-membered macrocyclic β-sheet mimic and grafted the designed sequence into the open strand of the macrocyclic scaffold with appropriate amino acids in the blocking strand for proper solubility and stability ([Figure 3B](#F3){ref-type="fig"}). The β-strand conformation of the grafted sequence was validated by measuring the α-H shifts and δOrn anisotropy using ^1^H NMR experiments ([Supplementary Figures S4, S5](#SM1){ref-type="supplementary-material"}) in solution. Furthermore, we confirmed that the macrocycles carrying the designed peptides do not form amyloid aggregation in solution, while those carrying native amyloid-forming sequences may form amyloid fibrils with an out-of-register packing (Lu et al., [@B42]; [Supplementary Figure S3](#SM1){ref-type="supplementary-material"}). {#F3} Next, we tested the inhibitory effects of the macrocyclic peptides on Aβ~42~ amyloid aggregation. The result showed that, in comparison with the free peptides, the macrocyclic peptides remarkably enhanced the inhibition on Aβ~42~ aggregation ([Figures 2B](#F2){ref-type="fig"}, [4A,B](#F4){ref-type="fig"}, and [Supplementary Figures S6--S10](#SM1){ref-type="supplementary-material"}). For instance, the macrocycle carrying K6A1 (mcK6A1) is about 10 times more potent than free K6A1 in prolonging the lag time of Aβ aggregation. The macrocyclic peptides inhibited the amyloid aggregation of Aβ~42~ in a dose-dependent manner. McK6A1, mcG6A1 and mcG6A2 showed remarkably strong inhibition with a 7--10-fold increase of the lag time at sub-stoichiometric concentrations of 0.2 molar equivalence to Aβ~42~ monomer ([Figure 4A](#F4){ref-type="fig"}). {#F4} Moreover, we found that the designed macrocyclic peptides can inhibit the formation of Aβ~42~ oligomers, the toxic intermediates of Aβ aggregation, monitored by the native gel ([Figure 4C](#F4){ref-type="fig"}). This result demonstrated that targeting ^16^KLVFFA^21^ and ^37^GGVVIA^42^ can prevent both oligomer and fibril formation, indicating the potential important role of these two segments in the early stage of Aβ~42~ aggregation. To further assess whether the designed peptides can reduce Aβ cytotoxicity, we performed the MTT-based cell viability assay. The result showed that the designed macrocyclic peptides can significantly reduce the cytotoxicity of Aβ~42~ to PC-12 cells even with a molar ratio of inhibitor to Aβ~42~ as low as 0.2:1 ([Figure 4D](#F4){ref-type="fig"}). Also, the designed macrocyclic peptides showed little toxicity to the PC-12 cells ([Figure 4D](#F4){ref-type="fig"}). In addition, the designed inhibitors of Aβ~42~ showed no inhibition of the amyloid aggregation of other amyloid proteins (e.g., α-synuclein and the K19 variant of Tau), indicating that the designed peptides are highly sequence-specific ([Supplementary Figure S11](#SM1){ref-type="supplementary-material"}). Designed Peptides Selectively Inhibit the Aggregation of Aβ~42~ but Not Aβ~40~ {#s3-3} ------------------------------------------------------------------------------ Selective inhibition of Aβ~42~ aggregation over that of Aβ~40~ is challenging because Aβ~42~ is only two residues longer than Aβ~40~ at the C- terminus ([Figure 5A](#F5){ref-type="fig"}). Since segment ^37^GGVVIA^42^ exists only in Aβ~42~, the designed peptides that target this segment may selectively inhibit the aggregation of Aβ~42~ but not that of Aβ~40~. As shown in the designed models, mcG6A1 that is designed to target ^37^GGVVIA^42^ forms extensive side-chain interactions with ^37^GGVVIA^42^ ([Figure 5B](#F5){ref-type="fig"}). The aromatic residues Tyr and Phe of mcG6A1 interact with Ile41 of ^37^GGVVIA^42^ *via* van der Waals forces. The absence of Ile41 and Ala42 in Aβ~40~ diminishes the binding of mcG6A1 to Aβ~40~. Indeed, the experimental data showed that mcG6A1 and mcG6A2 that strongly inhibit the amyloid aggregation of Aβ~42~, cannot effectively inhibit the aggregation of Aβ~40~, as measured by ThT assay ([Figure 5C](#F5){ref-type="fig"}, [Supplementary Figures S12, S13](#SM1){ref-type="supplementary-material"}). Note that a weak inhibitory effect of mcG6A1 and mcG6A2 to Aβ~40~ remains, which might come from non-specific backbone interactions between the inhibitors and Aβ~40~ ([Figure 5B](#F5){ref-type="fig"}). In contrast, mcK6A1 that was designed to target the ^16^KLVFFA^21^ segment, a segment important for the amyloid aggregation of both Aβ~42~ and Aβ~40~, showed a dose-dependent inhibition of both Aβ~42~ and Aβ~40~ aggregation ([Figures 4A](#F4){ref-type="fig"}, [5C,D](#F5){ref-type="fig"}, and [Supplementary Figure S14](#SM1){ref-type="supplementary-material"}). However, the inhibitory efficiency of mcK6A1 on Aβ~40~ is weaker than that on Aβ~42~, indicating that ^16^KLVFFA^21^ may play a more important role in Aβ~42~ aggregation than that of Aβ~40~. This implication is in agreement with the hypothesis that Aβ~42~ and Aβ~40~ may employ different amyloid nucleation and aggregation process (Sánchez et al., [@B51]; Meisl et al., [@B43]). {#F5} Discussion {#s4} ========== Development of peptide-based drugs is gaining greater attentions. In general, peptide-protein interactions have a high density of hydrogen bonds and highly complementary packing *via* hot-spot binding residues, leading to high binding affinity and exquisite selectivity with fewer off-target side effects (Kaspar and Reichert, [@B29]). Many attempts have been made to rationally design peptide inhibitors of amyloid protein aggregation, including modified internal segments of parent amyloid proteins, non-natural amino-acid inhibitors, proline substitutions, and other methods (Abedini et al., [@B1]; Sievers et al., [@B55]). Recently, RosettaDesign shows effectiveness for designing novel proteins and peptides with predicted structures having atomic accuracy (Bhardwaj et al., [@B6]; Huang et al., [@B25]). This technical advance has enabled the peptide inhibitor design of Tau aggregation (Abedini et al., [@B1]; Seidler et al., [@B53]). In this study, we designed peptides that can efficiently inhibit Aβ~42~ aggregation. Notably, the designed peptides show selectivity for the intended amyloid target, in contrast to small molecule inhibitors (e.g., EGCG and methylene blue) that broadly interfere amyloid aggregation of many proteins (Necula et al., [@B46]; Jiang et al., [@B27]; Palhano et al., [@B47]). Furthermore, the designed peptides can differentiate Aβ~42~ from Aβ~40~, demonstrating the accuracy and potency of structure-based rational design. Short peptides composed of natural amino acids normally form unstructured ensembles in solution. If a defined conformation is required for target binding, conformational changes may occur upon binding, at a large entropic cost. This counteracts enthalpy gain from the favorable interaction of the designed peptide and its target, and consequently reduces the binding affinity of the peptide with its target. Therefore, constraining the designed peptide in the desired conformation ("pre-organization") can minimize the entropic cost and increase the binding affinity. Chemical scaffolds provide a powerful toolbox for constraining peptides in defined secondary or tertiary structures in solution (Mowery et al., [@B44]; Azzarito et al., [@B5]; Cheng et al., [@B10]; Johnson and Gellman, [@B28]). In this work, we use a macrocyclic β-sheet mimic scaffold to constrain the designed peptides into β strands. Our results show significant enhancement of inhibition gained by the conformational constraint, which highlights the importance of conformation-constraint and the advantage of a chemical scaffold in the development of peptide binders. In addition, biopharmaceutical properties, such as degradation resistance and membrane permeability, may be achieved by modifying the chemical scaffold, rather than changing the inhibitor sequences. Macrocyclic β-sheet mimics have been shown to be a useful model system to study the structural basis of amyloid-like oligomers and fibrils (Liu et al., [@B41]; Cheng et al., [@B10]; Zheng et al., [@B61]; Salveson et al., [@B50]). A variety of key amyloidogenic segments from different amyloid proteins (e.g., Aβ, α-synuclein and prion) were constructed into the macrocycles (Zheng et al., [@B60]; Cheng et al., [@B9]). However, the self-assembling and potential toxic properties of macrocyclic molecules that contain native amyloid-forming sequences hinder application of macrocycles in the development of amyloid inhibitors (Liu et al., [@B41]; Salveson et al., [@B50]). In this study, by using RosettaDesign approach, we developed novel sequences and incorporated them into macrocycles. These designed macrocyclic peptides resist self-assembly and exhibit little cytotoxicity. In additional to Aβ, the structures of many other pathogenic amyloid fibrils have been determined recently (Tuttle et al., [@B58]; Fitzpatrick et al., [@B17]; Murray et al., [@B45]). Thus, the strategy of combining RosettaDesign and chemical scaffolds may be useful for peptide inhibitor design of different amyloid proteins for a variety of amyloid-related diseases. Data Availability {#s5} ================= All datasets generated for this study are included in the manuscript and/or the supplementary files. Author Contributions {#s6} ==================== All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication. Conflict of Interest Statement {#s7} ============================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. **Funding.** This work was sponsored by Shanghai Pujiang Program (18PJ1404300); the National Natural Science Foundation (NSF) of China (31872716, 91853113); National Institutes of Health (NIH; 5R01 GM097562 and R01 AG029430), the 1000 Talents Program, China; and Howard Hughes Medical Institute (HHMI), USA. ^1^<https://www.rosettacommons.org> Supplementary Material {#s8} ====================== The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fnmol.2019.00054/full#supplementary-material> ###### Click here for additional data file. [^1]: Edited by: Jiajie Diao, University of Cincinnati, United States [^2]: Reviewed by: Kailu Yang, Stanford University, United States; Ying Lai, Stanford University, United States; Yanmei Li, Tsinghua University, China [^3]: ^†^These authors have contributed equally to this work

heart wrote:Ah, I think no one have except maybe Tricycle. There was some conflict connected with this interview, can't remember what. /magnus You can see the conflict from reading Lama Tharchin's letter, and knowing the editorial bias of Tricycle in general, which is fairly obvious if you've ever looked at a few! There was actually a mini-scandal over the way the editor, Helen Tworkov, had manipulated Norbu Rinpoche's responses in the published copy of the interview to reflect badly on him and on Vajrayana in general. Tricycle lost quite a few subscribers, including myself, over that little lapse of judgement and I believe the magazine printed a carefully worded not-quite-apology afterward. I'm not sure I'd characterize it as a mini-scandal. It was a major event, IMHO. Helen Tworkov was accused directly of manipulating the interview though heavy editing. This resulted in the publication of the second version of the interview later. However people took their positions and indeed some readership was lost. Samuel Bercholz publicly resigned from association with Tricycle as did several other people. I wonder if the non-Asian Buddhist pioneers of the 19th century and the early to mid-20th century had similar problems? I am not a realized person, but I am neither and eternalist nor a nihilist. What does it mean to be a realized person? We can say at a minimum attaining the Path of Seeing and that is the canonical answer in Tibetan Buddhism. In Zen Buddhism the answer can be slightly different - a person who has seen the nature of their mind directly (kensho) *could* be considered minimally realized (but probably not until they work on themselves more - it's more like kensho means that you will eventually attain realization). But in a spiritually barren society practically anyone actively practicing non-harming could be considered to be realized. Then beyond bucking the trend to harm people in the West, if one practices morality and generosity one is really going against the trend and can be seen as quite strange by the general society. Just actively practicing the six perfections and intellectually understanding the theoretical non-duality between sentient beings almost makes you a saint from the start in this world. Yup I wouldn't peg you as either. . . but this isn't really about you... I mean there's not too many of you around. I guess I object to the persistent stereptyping of Americans by Tibetans. That's fine, but I don't think that's what was happening in this interview. I mean look at the spectrum from Stephen Batchelor to Dennis Merzel or Roach... and so many others that fall to extremes based on the underlying pervasive influence of the nihilist or eternalist conditioning of their cultural context. I think he was generalizing to make a point, based on real examples, and warn us of a dangerous trend. You don't have to make it all about you! Anyway, I have a feeling the entire interview would read differently, as Lama Tharchin expressed, and you are reacting to the manipulated-by-Tworkov fragments.. Contentment is the ultimate wealth;Detachment is the final happiness. ~Sri Saraha That's fine, but I don't think that's what was happening in this interview. I mean look at the spectrum from Stephen Batchelor to Dennis Merzel or Roach... and so many others that fall to extremes based on the underlying pervasive influence of the nihilist or eternalist conditioning of their cultural context. I think he was generalizing to make a point, based on real examples, and warn us of a dangerous trend. You don't have to make it all about you! Anyway, I have a feeling the entire interview would read differently, as Lama Tharchin expressed, and you are reacting to the manipulated-by-Tworkov fragments.. That's fine, but I don't think that's what was happening in this interview. I mean look at the spectrum from Stephen Batchelor to Dennis Merzel or Roach... and so many others that fall to extremes based on the underlying pervasive influence of the nihilist or eternalist conditioning of their cultural context. I think he was generalizing to make a point, based on real examples, and warn us of a dangerous trend. You don't have to make it all about you! Anyway, I have a feeling the entire interview would read differently, as Lama Tharchin expressed, and you are reacting to the manipulated-by-Tworkov fragments.. I guess I just don't accept TNR's analysis of our situation. There's a lot in there, what do you not accept? All of it? Or just the part about Western Dharma teachers? I personally can easily accept it all, as it accords with my experience of teachers and students both. Additionally, the "meat" of this interview- since out of the three or four Tricycle mags I ever bought this happened to be one-- manifested to me -popped off the shelf- right at significant times of doubt based on cultural-conditioning early on my path. It always became an antidote to arrogant tendencies I was subtly falling into that would have derailed me from progress. I actually owe a great deal to this very interview, and to Dungse Thinley Norbu himself whom I later had the great good fortune to fall into the blessing-field of a number of times. I guess you had/have a different experience, but maybe it will help you to know how helpful it has been for me. Contentment is the ultimate wealth;Detachment is the final happiness. ~Sri Saraha Namdrol wrote:I guess I object to the persistent stereptyping of Americans by Tibetans. As long as the opportunity is freely available for Americans to become teachers, monks, translators, yogis or whatever then I think prejudice against American Buddhists is a good thing and should continue. Keeps us on our toes and will force us to realize our interest is a fad and leave (or whine about the need to "modernize" Buddhism in some autobiography) or take Buddhism seriously, throw ourselves in to it, and actually progress. Like Tilopa whacking Naro with his shoe, Naropa could have just left you know. Equanimity is the ground. Love is the moisture. Compassion is the seed. Bodhicitta is the result. "All memories and thoughts are the union of emptiness and knowing, the Mind.Without attachment, self-liberating, like a snake in a knot.Through the qualities of meditating in that way,Mental obscurations are purified and the dharmakaya is attained." Another problem is that almost all Western teachers of Buddhism are either nihilists or eternalists, and not actual Buddhist lineage holders. This may or may not be true depending on the tradition and locality. I've heard before that some Tibetan lamas have expressed dismay about the spiritual faculties of students in the west. This is probably related to the prevailing reality-world views which are inherently materialistic and foster adharmic views, doubt and scepticism rather than right views, conviction and intellectual prowess. My experience in Asia would definitely affirm what is being said here. With the exception of Japan, Buddhism in places like Taiwan, Nepal and India is like night and day compared to what you have in the west. At the most basic level people have faith in the Triple Gem and express concern about their future rebirths, but in the west a lot of self-identifying Buddhists don't really accept even the essentials of Buddhadharma like rebirth and karma, much less having genuine conviction that liberation is possible. If you don't think samsara actually happens or that our actions direct our future rebirths, then liberation in the Buddhist context might as well be a fictional fantasy. What makes matters worse is you have publishers publishing "Buddhist teachers" who teach false dharma and only reinforce wrong views. "Buddhism in places like Taiwan, Nepal and India is like night and day compared to what you have in the west". Namdrol wrote:I guess I object to the persistent stereptyping of Americans by Tibetans. As long as the opportunity is freely available for Americans to become teachers, monks, translators, yogis or whatever then I think prejudice against American Buddhists is a good thing and should continue. Keeps us on our toes and will force us to realize our interest is a fad and leave (or whine about the need to "modernize" Buddhism in some autobiography) or take Buddhism seriously, throw ourselves in to it, and actually progress. Like Tilopa whacking Naro with his shoe, Naropa could have just left you know. That's the same as saying prejudice against blacks is justified because it means they have to work twice as hard to get as far as their white counterparts, thus fostering some kind of misconceived diligence. Namdrol wrote:I guess I object to the persistent stereptyping of Americans by Tibetans. As long as the opportunity is freely available for Americans to become teachers, monks, translators, yogis or whatever then I think prejudice against American Buddhists is a good thing and should continue. Keeps us on our toes and will force us to realize our interest is a fad and leave (or whine about the need to "modernize" Buddhism in some autobiography) or take Buddhism seriously, throw ourselves in to it, and actually progress. Like Tilopa whacking Naro with his shoe, Naropa could have just left you know. That's the same as saying prejudice against blacks is justified because it means they have to work twice as hard to get as far as their white counterparts, thus fostering some kind of misconceived diligence. No. 1. Blacks don't have chances when prejudiced against.2. Buddhism is a choice, Blackness is not.3. There a lot of fad quasi Buddhists, higher expectations would help them go one way or another. There is no parallel here. Equanimity is the ground. Love is the moisture. Compassion is the seed. Bodhicitta is the result. "All memories and thoughts are the union of emptiness and knowing, the Mind.Without attachment, self-liberating, like a snake in a knot.Through the qualities of meditating in that way,Mental obscurations are purified and the dharmakaya is attained." Not really. A lot of people who take up Buddhism do it out of karmic connection to it and would feel incomplete without it. 3. There a lot of fad quasi Buddhists, higher expectations would help them go one way or another. There is no parallel here. Sure there is. You're condoning discrimination against a particular nationality, saying it is positive and rewarding for Tibetans to have prejudice against American Buddhists. That's like saying it is good for one ethnic group to have ill sentiments against another because it apparently fosters good qualities in the latter. Namdrol wrote:I guess I object to the persistent stereptyping of Americans by Tibetans. As long as the opportunity is freely available for Americans to become teachers, monks, translators, yogis or whatever then I think prejudice against American Buddhists is a good thing and should continue. Keeps us on our toes and will force us to realize our interest is a fad and leave (or whine about the need to "modernize" Buddhism in some autobiography) or take Buddhism seriously, throw ourselves in to it, and actually progress. Like Tilopa whacking Naro with his shoe, Naropa could have just left you know. That's the same as saying prejudice against blacks is justified because it means they have to work twice as hard to get as far as their white counterparts, thus fostering some kind of misconceived diligence. Huseng, either we are moving WAY here, or I am confused--- if you are agreeing with Namdrol that TNR is betraying a stereotyping of Americans, which I don't believe he is-- then this doesn't make sense given your prior post which seems completely in tune with TNR's sentiments: Huseng wrote:My experience in Asia would definitely affirm what is being said here. With the exception of Japan, Buddhism in places like Taiwan, Nepal and India is like night and day compared to what you have in the west. At the most basic level people have faith in the Triple Gem and express concern about their future rebirths, but in the west a lot of self-identifying Buddhists don't really accept even the essentials of Buddhadharma like rebirth and karma, much less having genuine conviction that liberation is possible. If you don't think samsara actually happens or that our actions direct our future rebirths, then liberation in the Buddhist context might as well be a fictional fantasy. What makes matters worse is you have publishers publishing "Buddhist teachers" who teach false dharma and only reinforce wrong views. Ironically your mini-debate with Konchog1 is the opposite of what TNR expresses in his interview: that there is an underlying racism in Americans' views of Asian teachers, which is why there is such a drive to create an "American Buddhism", risking throwing the baby out with the bathwater in order to make it conform to American views, with American teachers leading it, etc. Contentment is the ultimate wealth;Detachment is the final happiness. ~Sri Saraha Not really. A lot of people who take up Buddhism do it out of karmic connection to it and would feel incomplete without it. 3. There a lot of fad quasi Buddhists, higher expectations would help them go one way or another. There is no parallel here. Sure there is. You're condoning discrimination against a particular nationality, saying it is positive and rewarding for Tibetans to have prejudice against American Buddhists. That's like saying it is good for one ethnic group to have ill sentiments against another because it apparently fosters good qualities in the latter. Those with a karmic connection would have no problem then. No. It's bad for Tibetans to be prejudiced (same as for anyone else) but it's positive and rewarding for us. I think the key point is that you've misrepresented my argument as "Tibetans shouldn't let us in temples" whereas I was saying it would good for Western Buddhists IF Tibetans were to assume all western Buddhists were a bunch of hippies and so forth so that the real things are inspired to break from the mold and the people that match the assumption are sidelined into "Modern Buddhism" or "Skeptical Buddhism" or whatever they want to call their group. So "There's some Westerners, I bet they aren't the real thing" instead of "There's some Westerners, get the hoses and dogs" Equanimity is the ground. Love is the moisture. Compassion is the seed. Bodhicitta is the result. "All memories and thoughts are the union of emptiness and knowing, the Mind.Without attachment, self-liberating, like a snake in a knot.Through the qualities of meditating in that way,Mental obscurations are purified and the dharmakaya is attained." Adamantine wrote:Ironically your mini-debate with Konchog1 is the opposite of what TNR expresses in his interview: that there is an underlying racism in Americans' views of Asian teachers, which is why there is such a drive to create an "American Buddhism", risking throwing the baby out with the bathwater in order to make it conform to American views, with American teachers leading it, etc. I think what you see in the west is like night and day compared to what you observe in Nepal, India and Taiwan. That doesn't mean I think all western Buddhists are incompetent, but just that we have a lot of problems with basic Buddhism 101 that elsewhere is not an issue. Prejudice and stereotyping of any group is inappropriate. Namdrol mentioned Tibetan stereotyping of Americans. In Japan I got the sense that I was seen as a token foreigner studying Buddhism, but few of my colleagues and instructors took me seriously. That might have something to do with my age, but in Japanese Buddhism the idea of westerners doing Buddhism is still kind of an uncertain novelty. As a western Buddhist in Asia, you gotta work twice as hard as a local to get the locals' respect. I don't know about this apparent underlying racism in Americans' views of Asian teachers. It might exist, but is it really so widespread? I doubt it. The drive to create an "American Buddhism" is probably more linked with trying to cultivate more appealing and close cultural contexts in which Buddhism can be practised, instead of having to go to Asia to find qualified teachers and/or learning a second language just to get access to advanced dharma teachings and practices. Some are clearly trying to make a Buddhism sanitized of disagreeable religious elements like rebirth and karma. This is most prevalent in Zen, at least in my reckoning. Konchog1 wrote:Those with a karmic connection would have no problem then. No. It's bad for Tibetans to be prejudiced (same as for anyone else) but it's positive and rewarding for us. It isn't rewarding. People will get turned off from Tibetan Buddhism if the locals are treating them like unwanted guests. Have you ever been to Asia? I think the key point is that you've misrepresented my argument as "Tibetans shouldn't let us in temples" whereas I was saying it would good for Western Buddhists IF Tibetans were to assume all western Buddhists were a bunch of hippies and so forth so that the real things are inspired to break from the mold and the people that match the assumption are sidelined into "Modern Buddhism" or "Skeptical Buddhism" or whatever they want to call their group. This makes no sense. Western Buddhists are diverse bunch and there is no single mold. Some are neatly dressed professionals, married with children, and clearly not hippies. Others like me are big and haggard looking, but holding academic credentials. There are "hippy" types, especially here in India around Dharamsala, but they're kind of the minority. So "There's some Westerners, I bet they aren't the real thing" instead of "There's some Westerners, get the hoses and dogs" You're still advocating an underlying mistrust and prejudice against countless Buddhists who were born in the western world. This is neither healthy nor going to facilitate practice. It is the same as saying discrimination against immigrants is good because it'll make them work harder. I can't really agree with this thesis, as I have spent a great deal of time with Tibetans and Tibetan Buddhist Lamas and have not noticed this so-called stereotyping. I also don't agree that this is what is happening in the article the OP is about. I have only been shown great kindness by my Tibetan Lamas, -- altogether kindness beyond compare. The author of the above text spent the last half of his life living in American and teaching Americans, when hundreds of thousands in Nepal, India, Tibet and Bhutan were longing for his return. This is clearly only a great sign of confidence in us, and nothing else, and if his words are interpreted without keeping this in mind then it is a very shortsighted and unfortunate view. I think it's also a terrible time to be cultivating such views, while Rinpoche has just taken parinirvana and rests in tukdam. We should all instead be cultivating great devotion, merging our minds with his wisdom-mind, and not dissecting his words with critical minds. Contentment is the ultimate wealth;Detachment is the final happiness. ~Sri Saraha Huseng wrote:It isn't rewarding. People will get turned off from Tibetan Buddhism if the locals are treating them like unwanted guests. Have you ever been to Asia? I have stayed with Tibetans in India and Nepal more than a few times, in gompas, in scholastic institutions and in homes, and I have only ever been treated with great hospitality and great kindness. You keep throwing out red-herrings and you have no idea what you're talking about. Are you just arguing for the sake of it? Contentment is the ultimate wealth;Detachment is the final happiness. ~Sri Saraha Adamantine wrote:I think it's also a terrible time to be cultivating such views, while Rinpoche has just taken parinirvana and rests in tukdam. We should all instead be cultivating great devotion, merging our minds with his wisdom-mind, and not dissecting his words with critical minds. yes ! Sönam By understanding everything you perceive from the perspective of the view, you are freed from the constraints of philosophical beliefs.By understanding that any and all mental activity is meditation, you are freed from arbitrary divisions between formal sessions and postmeditation activity.- Longchen Rabjam - Huseng wrote:It isn't rewarding. People will get turned off from Tibetan Buddhism if the locals are treating them like unwanted guests. Have you ever been to Asia? I have stayed with Tibetans in India and Nepal more than a few times, in gompas, in scholastic institutions and in homes, and I have only ever been treated with great hospitality and great kindness. You keep throwing out red-herrings and you have no idea what you're talking about. Are you just arguing for the sake of it?

János Juszkó János Juszkó (9 June 1939 – 2 May 2018) was a Hungarian cyclist. Juszko was born in Budapest, his profession was a Toolmaker. He competed at the 1964 Summer Olympics in the individual road race and the 100 km team time trial and finished in 24th and 12th place, respectively. He took part in eight Peace Races and won one stage in 1966. In 1964 and 1965 he was chosen Hungarian road cyclist of the year. He retired in 1973 and later worked as a cycling coach and a teacher of physical education. References Category:1939 births Category:2018 deaths Category:Cyclists at the 1964 Summer Olympics Category:Olympic cyclists of Hungary Category:Hungarian male cyclists Category:Sportspeople from Szeged Category:Place of death missing

An Indoor Race Track For Top Gear Live 2011 Top Gear Live NEC Track Group Lotus Motorsport, who are responsible for the original Top Gear test track, will develop an indoor track for Top Gear Live at NEC Birmingham between 11th and 13th November and ExCel London between 24th and 27th November 2011. Sabine Schmitz and Tiff Needell will join five-time Le Mans winner, Derek Bell, and a list of other celebrity guests, drivers and presenters on the track at the two events. The Stig will complete power laps on the all new track, as will Clarkson, Hammond and May. Celebrities will be pitting their skills against each other in Top Gear Live's Star in a Reasonably Priced Car. The tracks, designed for all driving disciplines, will see head to head challenges, power testing and time trials throughout the events. The tracks have been named 'Docklands GP' (ExCeL track) and 'B20 Raceway' (NEC track) and will feature named corners, with a Facebook competition for Top Gear Live visitors to name a corner. Gavan Kershaw, Engineering Manager at Group Lotus Motorsport said: "We're enjoying the challenge of working with the Top Gear Live team to design two tracks that are both exciting and credible for this event. "We believe the end result will ensure an awesome experience for both the drivers and spectators with plenty of noise and burning rubber!" There will also be supercar parades with cars such as the McLaren MP4-12C, Lamborghini Aventador and Ferrari 599 GTO as well as group B rally cars and a celebration of F1 past and present, all live on the track.

Q: jQuery detecting non-existent element I have a function that checks to see if an img tag is inside of a figure element with a class of "colorbox", and if it is, to add some additional styling to some elements. However, the function still runs even if there are no images in the colorbox figure and I don't know why. My jQuery looks like this jQuery(document).ready(function($){ if ($(".colorbox").has("img")) { ~code here~ } } And here is the colorbox figure, clearly without an img element... <figure class="colorbox"> <ficaption> <h2></h2> <p></p> <p></p> </figcaption> </figure> So why would jQuery be picking up an element that doesn't exist? A: I'd prefer find function var $img = $(".colorbox").find("img"); if ($img.length) { //exisst } A: i would do it this way: jQuery(document).ready(function($){ $('.colorbox img').each(function(){ var imageElement = $(this); // do whatever you want with this element ! }); // OR this way $('.colorbox').each(function(){ var box = $(this); if( box.find('img').length ){ // this means the parent colorBox has at least 1 img-Element } }); } and now to your problem: $(".colorbox").has("images"); $(".colorbox") returns a list of elements if any then you ask if the list .has("img") ? this means if one element in the list has an img element inside, then you get a true as a result of that if-statement, this is why your code doesn't work as expected

using System; using System.ComponentModel; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Media.Animation; using ScreenToGif.Util; using Button = System.Windows.Controls.Button; using Control = System.Windows.Controls.Control; namespace ScreenToGif.Controls { public class StatusBand : Control { #region Variables private Grid _warningGrid; private Button _supressButton; #endregion #region Dependency Properties/Events public static readonly DependencyProperty IdProperty = DependencyProperty.Register(nameof(Id), typeof(int), typeof(StatusBand), new FrameworkPropertyMetadata(0)); public static readonly DependencyProperty TypeProperty = DependencyProperty.Register(nameof(Type), typeof(StatusType), typeof(StatusBand), new FrameworkPropertyMetadata(StatusType.None)); public static readonly DependencyProperty TextProperty = DependencyProperty.Register(nameof(Text), typeof(string), typeof(StatusBand)); public static readonly DependencyProperty IsLinkProperty = DependencyProperty.Register(nameof(IsLink), typeof(bool), typeof(StatusBand), new FrameworkPropertyMetadata(false)); public static readonly DependencyProperty StartingProperty = DependencyProperty.Register(nameof(Starting), typeof(bool), typeof(StatusBand), new PropertyMetadata(default(bool))); public static readonly RoutedEvent DismissedEvent = EventManager.RegisterRoutedEvent(nameof(Dismissed), RoutingStrategy.Bubble, typeof(RoutedEventHandler), typeof(StatusBand)); #endregion #region Properties [Bindable(true), Category("Common")] public int Id { get => (int)GetValue(IdProperty); set => SetValue(IdProperty, value); } [Bindable(true), Category("Common")] public StatusType Type { get => (StatusType)GetValue(TypeProperty); set => SetValue(TypeProperty, value); } [Bindable(true), Category("Common")] public string Text { get => (string)GetValue(TextProperty); set => SetValue(TextProperty, value); } [Bindable(true), Category("Common")] public bool IsLink { get => (bool)GetValue(IsLinkProperty); set => SetValue(IsLinkProperty, value); } /// <summary> /// True if started to display the message. /// </summary> [Bindable(true), Category("Common")] public bool Starting { get => (bool)GetValue(StartingProperty); set => SetValue(StartingProperty, value); } /// <summary> /// Event raised when the StatusBand gets dismissed/supressed. /// </summary> public event RoutedEventHandler Dismissed { add => AddHandler(DismissedEvent, value); remove => RemoveHandler(DismissedEvent, value); } public Action Action { get; set; } #endregion static StatusBand() { DefaultStyleKeyProperty.OverrideMetadata(typeof(StatusBand), new FrameworkPropertyMetadata(typeof(StatusBand))); } public override void OnApplyTemplate() { _warningGrid = GetTemplateChild("WarningGrid") as Grid; var link = GetTemplateChild("MainHyperlink") as Hyperlink; _supressButton = GetTemplateChild("SuppressButton") as ExtendedButton; if (_supressButton != null) _supressButton.Click += SupressButton_Click; if (Action != null && link != null) link.Click += (sender, args) => Action.Invoke(); base.OnApplyTemplate(); } #region Methods public void Show(StatusType type, string text, Action action = null) { Action = action; //Collapsed-by-default elements do not apply templates. //http://stackoverflow.com/a/2115873/1735672 //So it's necessary to do this here. ApplyTemplate(); Starting = true; Type = type; Text = text; IsLink = action != null; if (_warningGrid?.FindResource("ShowWarningStoryboard") is Storyboard show) BeginStoryboard(show); } public void Update(string text, Action action = null) { Show(StatusType.Update, text, action); } public void Info(string text, Action action = null) { Show(StatusType.Info, text, action); } public void Warning(string text, Action action = null) { Show(StatusType.Warning, text, action); } public void Error(string text, Action action = null) { Show(StatusType.Error, text, action); } public void Hide() { Starting = false; if (_warningGrid?.Visibility == Visibility.Collapsed) return; if (_warningGrid?.FindResource("HideWarningStoryboard") is Storyboard hide) BeginStoryboard(hide); RaiseDismissedEvent(); } public void RaiseDismissedEvent() { if (DismissedEvent == null || !IsLoaded) return; var newEventArgs = new RoutedEventArgs(DismissedEvent); RaiseEvent(newEventArgs); } public static string KindToString(StatusType kind) { return "Vector." + (kind == StatusType.None ? "Tag" : kind == StatusType.Info ? "Info" : kind == StatusType.Update ? "Synchronize" : kind == StatusType.Warning ? "Warning" : "Cancel.Round"); } #endregion private void SupressButton_Click(object sender, RoutedEventArgs e) { Hide(); } } }

Q: Disable key when program is running Duplicate question to How disable key while specific program is running?, which was never answered. (Which option is worse, that I repost the same question, or that I thread necro the old post?) Anyway, is there a way to disable specific keys when specific programs are running? Or alternatively, disable Dash when a specific program is running? A: Simple Solution Create two shortcuts, one for disabling the Super key, and one for restoring it at will. Go to System Settings -> Keyboard -> Shortcuts -> Custom , and click + button. Name the new shortcut "Disable Dash". The command is gsettings set org.compiz.unityshell:/org/compiz/profiles/unity/plugins/unityshell/ show-launcher 'Disabled' To create shortcut for re-enabling the script, repeat the above steps, but the command should be gsettings set org.compiz.unityshell:/org/compiz/profiles/unity/plugins/unityshell/ show-launcher '<Super>' A Scripting Solution The script bellow will disable the Super key when program that the user has specified has focus. Note that the user still is able to click the dash icon with the mouse to invoke the Dash. The program name must be single-quoted and exactly the same as appears in Unity Launcher. Multiple windows can be specified in the same format separated by space For instance, to disable Super key every time firefox window has focus, the script must be called as disable_super_key.sh 'Firefox Web Browser' To disable both firefox and gnome-terminal do disable_super_key.sh 'Firefox Web Browser' 'Terminal' How to get the script Users can either copy the source here or alternatively obtain it from github following the instructions bellow: sudo apt-get install git cd /opt ; sudo git clone https://github.com/SergKolo/sergrep.git sudo chmod -R +x sergrep The script will be located in /opt/sergrep/disable_super_key.sh To make the script start automatically on every login, refer to How do I start applications automatically on login? . Provide /opt/sergrep/disable_super_key.sh(full path) as the command Script Source #!/usr/bin/env bash # ########################################################### # Author: Serg Kolo , contact: [email protected] # Date: April 12 , 2016 # Purpose: Disable super key that brings up Unity Dash # per specific application # # Written for: https://askubuntu.com/q/754884/295286 # Tested on: Ubuntu 14.04 LTS ########################################################### # Copyright: Serg Kolo , 2016 # # Permission to use, copy, modify, and distribute this software is hereby granted # without fee, provided that the copyright notice above and this permission statement # appear in all copies. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL # THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING # FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER # DEALINGS IN THE SOFTWARE. ARGV0="$0" ARGC=$# enable_dash_key() { gsettings set org.compiz.unityshell:/org/compiz/profiles/unity/plugins/unityshell/ show-launcher '<Super>' } disable_dash_key() { gsettings set org.compiz.unityshell:/org/compiz/profiles/unity/plugins/unityshell/ show-launcher 'Disabled' } get_active_app() { qdbus org.ayatana.bamf \ /org/ayatana/bamf/matcher \ org.ayatana.bamf.matcher.ActiveApplication } get_active_app_name() { qdbus org.ayatana.bamf \ $(get_active_app) \ org.ayatana.bamf.view.Name } check_active_app() { active_name=$(get_active_app_name) local is_found for win in "${windows_list[@]}" do if [ "$active_name" = "$win" ] ; then is_found=true break else is_found=false fi done if $is_found ; then disable_dash_key else enable_dash_key fi } print_usage() { cat << EOF Copyright Serg Kolo , 2016 Usage: disable_super_key.sh 'App Name 1' [ 'App Name 2' 'App Name 3' ... ] The script disables the Super key for the specified set of applications under Ubuntu's Unity environment. The list of windows must be space separated, each app name single quoted and exactly as it appears on the launcher (or as it appears in the .desktop file of that app), so spelling and spacing matter. Note that the script only disables the Super key as shortcut for Dash. The user still will be able to invoke Dash by manually clicking on the Ubuntu icon in the launcher EOF } main() { if [ $ARGC -eq 0 ]; then print_usage exit fi local windows_list windows_list=( "$@" ) dbus-monitor --profile "type='signal',member='FocusedWindowChanged'" |\ while read line do case "$line" in *FocusedWindowChanged*) check_active_app ;; esac done } main "$@"

Tag: Sugar free We live in a culture of hot & fried – fast food. I want to bring us back to low and slow – soul food. The meals where the love that went into the preparation can be tasted. To nurture the food we plan on serving others and take joy in the anticipation of that… I have been making this dessert for years. Its one of our family favorites. Previously, I had been using canned coconut cream – which although delicious and an outmatched dairy substitute – brings along with it gums, fillers and BPA. Not a fan of any of those! I figured “its dessert, dont sweat the small… This blog post is no revolutionary recipe that will change the world and take it by storm. Today I am more interested in presenting you with an idea. Namely: upgrading. The practice of raising something to a higher standard. Thats the method I want to see implemented in your kitchen! Its such a useful tool…. This vegan bread is super simple and quick! It was born one afternoon when I just had to bite into something chewy and lather it in oil. My egg lady has had a short – and I am wayyyy too farm girl to go to the store for eggs. Its amazing what you can accomplish… My, my, my, it is a delight making pretty food. But lets be honest, it can look beautiful and taste awful – and that is absolutely the most cruel trickery of all. Thankfully – that is not the case here. I actually got the comment from my husband that “its beautiful, and tastes even better… Nostalgia. There are those who enjoy chocolate – and there are those who are wrong. I always chose chocolate. Whenever it was my birthday and my sweet, sweet mother asked me, “steffanie, what kind of cake would you like?” I requested chocolate cake with chocolate frosting. I have apparently not grown up enough to grow… These bars. Man – they saved me when I peaked into the fridge to see what dessert I could serve my boys one afternoon, and realized there wasn’t one! What I didn’t realize was the entire sheet of Raw, Vegan, Black bean brownies I had made two days before was gone…. One thing is for… Cake. Its whats for breakfast. Once a week we have an event at our house called “baking day.” This is the day Mom, (me) gets over zealous and enthusiastically prepares and creates as many dishes possible -before my brains explode- and throw them all in the oven all at the same time…. Coconut butter. Could I ever say enough about this stuff? Coconut is an incredible fiber source, packed full of essential minerals such as: calcium, magnesium and potassium. It offers amino acids and electrolytes, as well as plenty of the anti aging, saturated fats -the perfect brain food! It aids in digestion and absorption of nutrients….

Nirupam Sen (cricketer) Nirupam Sen (born 28 February 1990) is an Indian cricketer who plays for Tripura. He made his Twenty20 debut on 2 January 2016 in the 2015–16 Syed Mushtaq Ali Trophy. He made his first-class debut for Tripura in the 2018–19 Ranji Trophy on 30 December 2018. References External links Category:1990 births Category:Living people Category:Indian cricketers Category:Tripura cricketers Category:Cricketers from Tripura

Thomas leads No. 18 Oklahoma past No. 22 Baylor 73-63 CLIFF BRUNT Jan. 04, 2015 He felt much better about his Big 12 debut. The senior scored 24 points to help No. 18 Oklahoma beat No. 22 Baylor 73-63 on Saturday. Thomas, a 6-foot-8 power forward who transferred from the University of Houston before the season, made 11 of 17 shots and grabbed eight rebounds. He averaged 10.8 points in non-conference play, which he considered subpar after being named second-team Conference USA last season and first team the year before. "I didn't really feel like I played to my potential, so I just talked to myself and I talked to coaches and everything, and they told me that when conference starts out, it's a new season," he said. "I have a new beginning, so I just came out with a fresh mindset and didn't try think about anything that happened in the preseason or anything like that." Buddy Hield had 20 points and 10 rebounds and Isaiah Cousins added 19 points for the Sooners (10-3, 1-0 Big 12), who won their third straight in the conference opener for both teams. Hield, the team's top scorer this season, said Thomas makes his job easier. "I would say TaShawn is one of our better players, if not the best player on the team," Hield said. "He's so versatile. He can dribble, face up and catch it down low. He should just keep on doing what he's doing." Baylor forward Taurean Prince said the plan for Baylor's 1-3-1 defense was to take out Oklahoma's perimeter game, which made things easier for Thomas. "Well, it's really give and take," Prince said. "You've got to give something in order to be good against them. We were giving up twos. We wasn't going to let them beat us with threes. That was the game plan. Freshman Johnathan Motley scored a season-high 24 points and Prince added 17 for Baylor (11-2, 0-1), which had won six straight. Baylor, which had held opponents to 55 points per game, allowed its highest point total of the season. Oklahoma made 21 of 25 free throws, while Baylor made just 12 of 18. Baylor led 23-16 in the first half, but Oklahoma rallied to lead 37-33 at halftime behind 12 points from Thomas and 11 from Cousins. Prince and Motley each scored 12 points in the first half for Baylor. Baylor made just one of its first seven shots after the break, and Oklahoma took a 46-37 lead on a 3-pointer by Cousins. The Sooners extended their lead to nine on a 3-pointer by Hield, and he drained another three with just over 6 minutes to play to push Oklahoma's lead to 58-46. The Bears shot 46 percent in the first half, but just 29 percent after the break. "You've got to give a lot of the credit to OU's defense," Baylor coach Scott Drew said. "Those guys really got after it. We missed a lot of layups, but there's a reason you miss a lot of layups — the pressure they put on, the contests they have." TIP-INS Baylor: Prince, the Big 12 leader in 3-point percentage heading into the game, made 4 of 8 ... Kenny Chery had five assists at halftime but one in the second half. ... Rico Gathers, who entered the game leading the Big 12 in rebounding, had 12, including six offensive. Oklahoma: Sooners now lead the series with Baylor 42-11. ... Ryan Spangler, who entered the game as the Big 12 leader in field goal percentage, missed all three of his shots before fouling out, but he played solid defense and grabbed seven rebounds. ... Oklahoma committed just two turnovers in the first half. ... Oklahoma's bench scored just two points. CRITICAL MOMENT The Sooners fell behind 23-18 early, and appeared to lack energy before Hield hit back-to-back 3-pointers, pushing the ball after defensive rebounds and shooting before Baylor could set its defense, to give the Sooners a 24-23 lead. QUOTE OF THE DAY Baylor coach Drew, on how the Sooners shut his team down in the second half: "Put a lid on the rim," he said to laughter. "They just didn't give us any easy looks."

Tag Archives: covenants I taught Chapter 15 from the George Albert Smith manual during our HP Group lesson time yesterday. The lesson was titled “Advancing the Work of the Lord.” As I prepared for the lesson, it reminded me a lot of the way President Hinckley used to speak (we are in good hands; this is the work […]

i don't always show you affection but when I do, it's because I want something 1,048 shares

Categories Sponsored Links By Debbie Schlussel Tonight, Yom HaShoah–Holocaust Memorial Day–begins and lasts until nightfall Monday Night. My maternal grandparents were Holocaust survivors, and on both my mother’s and father’s sides our family was mostly wiped out by the Nazis. I’ll have more to say, tomorrow, about how the Holocaust has been misused and misappropriated by the left–with the liberal Jewish Community “leadership” complicit. Two Symbols, Same Deal It is important to memorialize the 6 million Jews who were specifically targeted and murdered by the Nazis for the crime of having Jewish blood (and also the 5 million others who were murdered by them as well). But it is also important to note the message of the Holocaust which is largely forgotten, especially by liberal do-gooder Jews, the unelected, unrepresentative, self-anointed who purport to lead my community: that those filled with hate today also want to eliminate the Jews–and they are Muslims. Today’s liberals–most shamefully, Jewish liberals–have built an entire industry on the Holocaust. Yet, while they remember dead Jews, they think it’s A-OK to hang out with today’s Nazis and justify their wholesale slaughter of Jews in Israel, today. 21 Responses Poignant cartoon. Thanks. I am very familiar with the liberal Jews to which you refer. Mostly, it would seem they are aging baby boomers, children of the 60’s and 70s. I detect, however, a growing recognition among Jews on college campuses that Muslims are indeed a threat. In places like UC Irvine, Wayne State, Columbia, and several schools in Canada (Concordia), when the Muslim Student Association reaches a critical mass of power on campus, Jewish students become the targets of mini-Jihad. I am hopeful today’s young Jews will wake up in time to save themselves, their children, and Israel from the damage done by their parents. OTOH, if Jews migrate to the Republican Party, as I suspect they will over time, then the Democrats will have no restraining influence whatsoever (ie, Jimmy Carter acolytes in charge). This would certainly be very bad for Israel and for Jews around the world. It might not, therefore, be such a bad thing to have Jews present in Democratic party, even if they share the same benches with left-wing anti-semites and Muslims. Comments? Here’s my comment. It is more than the Jews who are facing the loss of their freedoms. It is time to call a spade a spade. Jackson and Sharpton are bigots. Let’s fire them by speaking out every time their twisted words appear on tv. The Islamic religion is a sham. No real religion foments killing non-believers in its holy words. Let’s speak out every time the government coddles Islamic thugs. In fact, any thugs. A creeping, holocaust in disguise has been weakening the foundations of our country in the guise of political correctness. In the name of free speech, speak out. We need to get mad as hell and stop taking it from these self righteous phonies. There is no need for violence. But there is a need to defend your beliefs. If we don’t help good triumph over evil, we are the dummies and we will have earned our fate. Debbie Schlussel is in the lead. Take her facts and wrap them around the heads of anyone and everyone who is stealing your right to be free, free from political correctness. We don’t need a holocaust on our rights. Joe McCarthy is back. This time he is not a Senator, he is the Media. sonomaca: Good points. However, We need not worry about Jews remaining in the Democratic party for the purpose of restraint. If every Jew left the Democratic party tomorrow, the Democratic party would cease to exist. The same goes for blacks. There simply aren’t enough white, gentile liberals in the party to sustain it’s relevance. spiffo: good point. I would love to ask Waxman or Feingold why the are so infatuated with Islamofacists. Do they hate themselves and their fellow Jews so much that genocide seems like a good solution? And what of the Hollywood elite. Spielberg can make Shindler’s List and then go silent on today’s threatened genocide. Geffen is in love with Obama who, apparently, is a Muslim or Muslim sympathizer (see all his shady Arab “business” partners in Chicago), and I doubt whether Obama would shed too many tears if Israel vanished in a cloud of dust. Dennis Praeger and David Mamet talk about the self-hating Jew or the Jew who sees himself as a leftist above all. The same type exists in Israel, where the secular lefty urban elite refer to the religious or Orthodox as “the Jews”, as if they themselves were something else. I think the point that Debbie is trying to make is that there are far too many liberal Jews who deny and ignore what is going on in our own communities as well as in our colleges and universities. The tragedy here is the misinformed and misguided leadership continually pander to Muslims that would destroy us all at the first opportunity. These are today’s Nazi’s and they must be responded to as such. Many in our government would do well to realize this too. If not, history will repeat itself I think you all have missed the point. The Jews have been convenient victims for 5000 years. Since 1948 they have been fighting for their very existence in Israel, yet again. Although last year, it looked like they no longer know how to do that. The victim of political correctness in the U.S. is everyone. You may ask, “Why don’t the liberal Jews know better? Do better.” This 21st century stealth holocaust will take away the freedom of 300 million. So why don’t liberal Americans know better? Losing your freedom is not losing your life. It is worse. So why don’t liberal Americans know better? Does it really matter? Those of us not “liberal Americans” what are WE doing about it? If we know it is happening then the responsibility is ours regardless of what “liberals” do or don’t do. Good for you AlturaCt. Finally, somebody gets it. Please don’t ask for whom the bell tolls. It tolls for you. Now, what are you wimps going to do about it? After all, it is only your freedom, your future. And if you have children, theirs, too. I have been extremely depressed the past two days so forgive me if I hijack this comment thread for my own personal needs. I live in Israel and usually I feel pretty strong in my battle with the Islamofascists. Today at 10am, the siren sounded to commemorate Holocaust victims. It is very powerful because cars will stop on the street and everyone gets out and stands by their car. I was at home at the time, and in the apt. above us there are Arabs doing construction. When the siren sounded, they turned up their radio playing Arabic music and also turned on their drills. I was so angry! How dare they! Next week is Yom HaZikaron and we will have another siren, this time to commemorate those lost in terrorist attacks and fallen in battle. My husband says he plans to go up there and tell them ahead of time that he had better not hear a sound coming from the apt. for those two minutes, or else. We’ll see how that goes. I keep up on the news and have been following the PC crap about Sharpton and Jackson, Imus, the Duke LaCrosse players, etc. Usually I’m able to draw strength from Debbie’s blog, and LGF, among others, because it is easy to get depressed over the PC destruction of our society. But yesterday, I ran across two names mentioned in a comment section and the poster asked “Do you recognize these names? If not, why not?” I couldn’t resist following up on the mystery, so I googled Channon Christian and Christopher Newsome. OMG, I will not post the details here out of respect for anyone who is having a bad day, but suffice it to say, this crime is, in my opinion, far worse than anything Charles Manson ever did (and I read Helter Skelter, so I mean what I say). The media has all but ignored it entirely, because the perpetrators are black thugs and the victims are a young white couple. It doesn’t fit the liberal definition of a race hate crime. As if this wasn’t a big enough downer, I started clicking away at links and came to a black website where black people were saying unimaginably horrible things about the white victims. Why? I clicked away from there, and followed a link to a “rally for Channon and Christopher.” That sounds positive, right? I thought “this is just what I need.” Go there to that website, only to figure out after reading a few comments that it is a White Supremacist website and I was again shocked and horrified to read some of the stuff that was being said there about black people in general (oh, and it should come as no surprise that the folks there blame the Jews for all black crime, though they hate blacks, hispanics, and Asians too, it’s really the Jews that are behind it all, you see). Anyway folks, I’m really deep in a rut and cannot get out. I thought I was no stranger to hatred and bigotry but my readings of the last two days have really opened my eyes to a depth and breadth of hate in this country that I guess I didn’t really know existed. People accuse US of being racists because we simply ask not to be killed. I would have nothing against Muslims if not for the fact that they are trying to destroy me. I’m not engaging in baseless hatred by pointing out Islam’s genocidal tenets. For years, I swallowed the old line that there are good Muslims and bad Muslims, but now I’m convinced that good Muslims are good only because they refuse to follow the teachings of Islam. Those who follow the teachings . . . well, you know where that leads. Islam is the fastest growing religion in American prisons because black inmates find it gives them a structure and justification for their hatred of white people and Jews. So now we have a new partnership between angry blacks and Muslims? Thanks for listening, and any suggestions on how to climb out of my dark hole of cynicism would be welcomed. Debbie, I apologize for going off on a tangent — I meant to say first that I am sorry about your family and the horrible loss of life there. I know they would be so proud of you for all the work you do to raise awareness about issues that are so important to any civilized society that wishes to remain one. About the self-hating Jews . . . well, they wouldn’t be so proud of that. I wonder, though, if such suicidal Jews have always been among us. Perhaps it is not a new phenomenon at all. As Kohelet says, “there is nothing new under the sun.” Sigh. I’m often fond of Wiley’s “Non Sequitur” comic strip, but the one you’ve posted, Debbie, hits the proverbial nail on the head in more ways than one: while it’s absolutely accurate for the Nineteen-thirties and forties, it’s just as “right-on” for the Two Thousand, ‘naughts (and beyond) — just substitute the Islamofascists for the Nazis (redundant, I know), and everything else remains the same, as the old saying goes. Sickening, but true. The same kind of panderers to these evil scum, as well, which is even more sickening. Indeed, I see lots and lots of Chamberlains out there, and precious few Churchills (more’s the pity). The worst kind of ignorance is the willful varitey, and there’s a fatal epidemic going on right now. Islamofacists are busily plotting our deaths, yet TV is all about Anna Nicole, Brittany, and American idol. I’m fighting it through letters to the editor. Saturday I had the following letter published in the Calgary Herald in response to an op-ed piece by Barry Rubin on dropping the holocaust in British schools. At least now a few more people are aware of the word “dhimmi” and what it means. Now it’s YOUR turn. Come on people, write those letters. Barry Rubinís excellent article about dropping the holocaust from the curriculum should serve as a wake-up call as to where a society can be led if it allows itself to be pulled along by the nose-ring of political correctness. It certainly exposes as empty all the platitudes about learning from history so as to not repeat past mistakes. Itís prophetic (assuming Iím still allowed to use that word when not referring to Mohamed) that Rubin refers to voluntary surrender, because Islam is Arabic for ìsubmissionî or ìsurrenderî (not ìpeaceî, as we are so frequently told). Thereís another Arabic word we should add to our vocabularies: dhimmi. That refers to a person who has accepted the role of second-class citizen within a Muslim state. Every time we censor or censure ourselves so as not to offend the perpetually offended, we take one more baby-step towards self-imposed dhimmitude. I THINK ONE of the best ways to remember the HolocaustÖwould be to renew one’s diligence against ANY contemporary anti-SemitismÖbecause ìTwo Symbols, Same Dealî is the truest observation of all. And this timeÖitís not just them (the Jews)Öbut us! ìTwo Symbols, Same Dealî would make a great, and timely poster or T-shirt etc. for the enlightened masses! Iím thinking: http://www.cafepress.com/ LOST on everyone making pro-Jewish comments here is the teachings of the Torah—Adonai’s ‘chosen’ continuously defied His will EVERY time He told them to final solutionize their enemies!!! THAT one always confounded me…but the other day i saw a programme on History Channel International (i think) which talked about the Jews’ “choseness”…and it wasn’t because they were favoured by God, but because they were supposed to be a LAMP UNTO THE WORLD. There aren’t enough good muslims to matter. There’s the 10% that will tell you to your face they’re going to eliminate all infidels, and there’s another 80% that are content to bide their time and smile in your face. I hope your husband beats those stinking moose-lims down to the ground when they do that, and I hope the other jews or whites won’t call the cops and will assist him. This has to begin happening, we must stop being allergic to ‘racism’. The reason you can’t find info on crimes against whites without going to anti-jew sources, is because the ‘racists’ are the only ones screaming about it. Tell them to get over the jews, tell them jews have power because they’re smart, they are white people, too. Time to choose sides. Don’t even get me started about the Mexican invasion. (You’ll see on May 5 what ‘diversity’ looks like.) I remember the first time I was exposed to the holocaust. It was 1989 in my 8th grade English class. My teacher wrote some names on the board, Steven Spielberg, Gene Simmons, Billy Crystal, etc. and asked what all these people had in common. No one knew the answer and she explained they were all Jewish and under the Nazi regime, all would have been targeted for death. She followed up our lesson by reading “Night” by Elie Wiesel. After that I started reading about the Holocaust and World War II pretty much non-stop until I went to war myself in Iraq. Now I can’t read books about war anymore. While I was stationed in Germany, I went to Dachau, Normandy and passed numerous monuments to WWII and Synagogues that no longer exsist. All those memories stick with me and I will be sure that my children learn about the Holocaust and the great sacrifices made during WWII. I will not let them be ignorant little Britney Spears wannabes oblivious to the world around them. I will take them on family trips to Auschwitz, Dachau and Normandy. I will not let history die with the Greatest Generation.

Salvage surgery after local recurrence in patients with head and neck carcinoma treated with chemoradiotherapy or bioradiotherapy. To analyze the oncologic outcomes and surgical complications after salvage surgery for recurrence following chemoradiotherapy or bioradiotherapy for advanced head and neck squamous cell carcinoma. From 2007 to 2011, 187 patients were treated with chemoradiotherapy (n=154) or bioradiotherapy (n=33). Patients treated with bioradiotherapy were older and showed a tendency to poorer general condition. During the follow-up, 43 patients treated with chemoradiotherapy (27.9%) and 13 patients treated with bioradiotherapy (39.3%) had a local recurrence of the tumor. We analyzed the patient candidates to salvage surgery, and the associated complications and outcome of these surgeries. Sixteen patients treated with chemoradiotherapy (37.2%) and eight treated with bioradiotherapy (61.5%) had salvage surgery. Multivariate analysis showed that the variable most strongly related to salvage surgery after local recurrence of the tumor was the type of initial treatment. The frequency of postoperative complications was higher in patients who received chemoradiotherapy (62.5% versus 12.5%, P=0.03). Five-year adjusted-survival after salvage surgery was 26.0% for patients receiving chemoradiotherapy and 70.0% for patients undergoing bioradiotherapy (P=0.156). Patients who presented recurrence after bioradiotherapy were more likely candidates to salvage surgery than those who had chemoradiotherapy. Patients undergoing salvage surgery had fewer postoperative complications and better adjusted survival after bioradiotherapy than after chemoradiotherapy.

Engr. Emerson L. Benitez, LRTA Officer-in-Charge said the Department of Transportation and Communications (DOTC) approved the request from the National Historical Commission to give the public free rides in order to provide them convenience and mobility to participate in activities organized by various government agencies in the metropolis. Benitez said commuters can take the free rides between 7:00am - 9:00am and from 5:00pm - 7:00pm at LRT-1 (Baclaran-Roosevelt) and LRT-2 (Santolan-Recto) lines. Last year, around 121,000 passengers availed of the free rides with most of them children who had the chance to visit and enjoy the historic site of Rizal Park monument located near the UN station. In line with DOTC's mandate to provide the public with safe and secure travel, the LRTA will continue to observe "No inspection, No entry policy" in all of its stations.

The field of the invention relates to ignition systems for internal combustion engines. Conventional ignition systems of the Kettering type include a secondary coil having an output terminal, or tower, coupled to the center tower of a distributor. As the distributor rotor rotates in response to camshaft rotation, the secondary coil is coupled across each spark plug. The primary coil is charged by electronic switching which is timed such that a collapse in primary current is coupled to the secondary coil a desired number of crank angle degrees before a cylinder top dead-center position. As the secondary coil discharges, ignition energy is coupled to the appropriate spark plug. A problem with this type of system is that a failure in either of the coils, or associated charging circuitry, will totally disable the engine. Another problem is that the amount and duration of ignition energy remains fixed even though it would be desirable to increase ignition energy during starting and high engine speed or load operation. Distributorless ignition systems are also known which have a plurality of secondary coils, each coupled across the center electrode of a pair of spark plugs. Each of the spark plug pairs is fired on both the compression stroke and exhaust stroke of the corresponding cylinders. For example, U.S. Pat. No. 4,462,380 issued to Asik discloses a distributorless ignition system having two primary coils, each magnetically coupled to a corresponding secondary coil. The outer terminals of each secondary coil are coupled to the center electrodes of a pair of spark plugs. In addition, a supplemental ignition module is disclosed for increasing the ignition energy supplied by the secondary coils. More specifically, each secondary coil has split center taps coupled to the supplemental ignition module. The supplementary ignition module includes a full wave bridge rectifier which charges an output capacitor. As the capacitor is discharged, additional energy is added to the secondary coils. Although this system addresses the Problem of increasing ignition energy, it does so by continuously supplying increased ignition energy. A disadvantage is, therefore, that the continuous increase in ignition energy adds stress to both the ignition system and spark plugs thereby decreasing their lifespan. An additional disadvantage is that a failure in any of the coils will disable a portion of the ignition energy supplied to the engine, possibly shutting down the entire engine. Another disadvantage is the complexity of the supplemental ignition module.

“Behold, I will break the bow of Elam, the chief of their might” (Jeremiah 49:35) The existing nuclear facility in Bushehr province, Iran 35 Thus saith the Lord of hosts; Behold, I will break the bow of Elam, the chief of their might. 36 And upon Elam will I bring the four winds from the four quarters of heaven, and will scatter them toward all those winds; and there shall be no nation whither the outcasts of Elam shall not come. 37 For I will cause Elam to be dismayed before their enemies, and before them that seek their life: and I will bring evil upon them, even my fierce anger, saith the Lord; and I will send the sword after them, till I have consumed them: From the scripture we can derive the Lord is angry with Iran which results in some disaster in Iran. 38 And I will set my throne in Elam, and will destroy from thence the king and the princes, saith the Lord. 39 But it shall come to pass in the latter days, that I will bring again the captivity of Elam, saith the Lord. The most likely fulfillment of this prophecy will occur when the nuclear reactor is destroyed, either by the Israelis or by an earthquake, releasing radiation that will force the evacuation of the whole area. Take note that the region where Bushehr is located in Elam is active earthquake country, and it sits on a tectonic plate. The Bushehr Nuclear Power Plant is physically separated from greater Iran (Persia) by the Zagros Mountain range. The rapid elevation change due to the Zagros Mountain range would likely protect most of Iran from the meltdown allowing them to attack as one of the nations of Magog another day. Interestingly, Ezekiel was familiar with Elam, according to Ezekiel 32:24–25, but he did not include Elam in the lineup of invaders in Ezekiel 38, perhaps because it is destroyed by then. Nuclear Showdown in Iran: Revealing the Ancient Prophecy of Elam (Book) by Bill Salus There is another prophecy concerning Iran that possibly precedes the Gog and Magog scenario outlined by Ezekiel. In Jeremiah 49:34-39, we are told thatwill come under the judgement of God for conspiring to launch an attack against Israel in the. Modern day Iran is comprised of ancient(about one-tenth) and Persia. This prophecy concerning Iran has not yet been fulfilled but seems to align with Iran’s current nuclear aspirations!Today, this could infer an attack upon Iran's growing nuclear program. One of Iran’s most strategic and vulnerable nuclear targets is the Bushehr nuclear reactor, located in the heart of(see map on right).When your bow is broken, you cannot load the arrows from out of your quiver, or in a modern sense, the missiles out of your silo. This might imply that the IRGC (Iranian Revolutionary Guard Corps) will be unable to launch scores of its missiles (arrows in modern warfare are missiles) at its enemies.This could be the result of Iranian’s attempting to flee from an isolated nuclear disaster. Should the Bushehr nuclear reactor be struck, this becomes a very real possibility because the facility is loaded with Russian supplied fuel rods. John Bolton, former US Ambassador to the UN, said in 2010,Several other studies conducted of the safety of the Bushehr nuclear site have concluded that an accident at the facility could result in such a disaster.Iranians who accept Christ in advance of His second coming will be returned from global exile into the restored fortunes of their historic homeland in Elam. Interestingly, for the last few years Iran has been experiencing one of the largest revivals on earth. From approximately 500 believers in 1979 [the year of the Iranian Revolution], to several million today,Christianity is burgeoning so rapidly that the rogue Islamic regime has instituted harsh policies to curb its growth.References:

/^?(a)$?/, F /^?(b)$?/, F /^?(o)$?/, T --- /^?(a)$?/, F /^?(b)$?/, F /^?(o)$?/, T --- /^?(o)$?/, T /^?(b)$?/, F /^?(a)$?/, F --- /^?(o)$?/, T /^?(b)$?/, F /^?(a)$?/, F --- /^?(a)$?/, F /^?(o)$?/, T /^?(b)$?/, F

Q: How can I share variables among different load-balanced WebSphere instances? I have web application deployed on WebSphere Community edition (WAS CE) server on four different machines for load balancing purposes. I want to store some constant variables/objects among the four servers. If I change the variable in web application on one server, the same copy should be available for the web apps on the other three servers. Since these variables/objects are not related to the user session, sticky-session will not help here. Is JNDI the best solution? kindly share your knowledge on any other better solutions/techniques. OS: Linux Application Server: WebSphere Community edition (WAS CE). A: If these values don't change during runtime, then placing those variables in the ServletContext scope would make most sense. If these values do change during runtime, then they will have to reside in a storage medium that is accessible by all servers in your cluster. I'm not sure that JNDI would work for you though (I can't recall anything from the JEE spec mandating synchronization of JNDI trees across containers); distributed cache frameworks such as EHCache would make more sense.

Referral expectations of radiology. In summary, the data suggest that the traditional role of the radiologist as an expert consultant who provides an accurate written report is still the dominant perception. This study emphasizes the importance of development of communication skills and communication standards, with particular emphasis on written data as the single most important factor in keeping a strong clinician referral base.

The goal of "Reactions to learning a 'not elevated' amyloid PET result in a preclinical Alzheimer's disease trial" was to study how learning one is not eligible for a trial based on an Alzheimer's disease (AD) biomarker result affects willingness to be in subsequent trials, as well as how it affects other behaviors \[[@CR1]\]. Answering this question fills a critical gap in the literature, as preclinical AD trials are increasingly common but the ideal criteria for participant inclusion remains an area of active research. Thus, a person ineligible for one trial may be eligible for another. Taswell and colleagues correctly observe that our study did not include a comparison group, which would have necessarily been individuals who demonstrated elevated amyloid and therefore were eligible for randomization in the preclinical AD trial \[[@CR2]\]. The primary question under study---whether a subject who screen-fails for one AD trial is willing to participate in subsequent trials---was not applicable to this population. Their exclusion is not a bias. It was not necessary. Looking more broadly, the gist of Taswell and colleagues' commentary is a sensible summary of social science research. Multiple methods, and indeed multiple studies, are needed to arrive at a common understanding of the way the world is and how it can be changed. Only then can high confidence be achieved. In the nascent space of preclinical AD trials, much remains to be learned and a breadth of research designs and methods will be essential to advancing the field. There are no acknowledgements. Funding {#FPar1} ======= There was no funding for this letter. Availability of data and materials {#FPar2} ================================== No data were involved in this letter. Each author contributed to the writing of this letter. All authors read and approved the final manuscript. Ethics approval was not necessary for this letter. We provide consent for publication. The authors declare that they have no competing interests. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xkey 25-Key Portable Musical Keyboard The CME Xkey is the answer to mobile music creation. It is unique in today’s market Xkey – your first choice of musical keyboard In the tablet PC era, will you still prefer a desktop computer? In the mobile music era, will you still need a traditional MIDI keyboard? In the portable musical instrument era, will you compromise with poor performance features? Xkey is currently the world’s only truly portable music companion that belongs to you. While at home in the studio or living room, it doesn’t force you to play in one spot. Nor should the slim appearance fool you – professional performance is not compromised. You can see its elegance, touch its refinement and play with delicacy. It can hide in your backpack and is with you to communicate your musical inspiration.Xtra Mobility: Ultra 3.6 mm slim edge, elegant aluminum frame, light and portable designXtra Professional: 25 Standard-size keys, Professional velocity sensitivity, Polyphonic after touch, High Resolution Pitch BendXtra Compatibility: USB MIDI compliant with iPad, Android, tablet / phone, Microsoft Surface Pro, Mac and PCXtra Usability: Perfect for mobile music creation, studio recording, and live performance

--- abstract: 'We show that in $\mathbb{R}^d$ there are purely unrectifiable sets of Hausdorff (and even box counting) dimension $d-1$ which are not tube null, settling a question of Carbery, Soria and Vargas, and improving a number of results by the same authors and by Carbery. Our method extends also to “convex tube null sets”, establishing a contrast with a theorem of Alberti, Csörnyei and Preiss on Lipschitz-null sets. The sets we construct are random, and the proofs depend on intersection properties of certain random fractal measures with curves.' address: - | Department of Mathematics and Statistics\ Torcuato Di Tella University\ Av. Figueroa Alcorta 7350 (1428)\ Buenos Aires, Argentina - | Department of Mathematical Sciences\ P.O. Box 3000\ FI-90014 University of Oulu\ Finland author: - Pablo Shmerkin - Ville Suomala bibliography: - 'tubenull.bib' title: Sets which are not tube null and intersection properties of random measures --- [^1] Introduction and main results {#sec:introduction} ============================= Non-tube null sets and localisation of the Fourier transform ------------------------------------------------------------ By a *tube* $T$ of width $w=w(T)>0$ we mean the $w$-neighborhood of some line in $\mathbb{R}^d$. We recall that a set $A\subset\mathbb{R}^d$ is called *tube null* if for any $\delta>0$ it can be covered by countably many tubes $\{T_j\}$ with $\sum_j w(T_j)^{d-1}\le \delta$. The class of tube null sets arises, perhaps surprisingly, in the localisation problem for the Fourier transform in dimension $d\ge 2$. Indeed, Carbery, Soria and Vargas [@CSV07 Theorem 4] have shown (generalizing a result of Carbery and Soria in [@CarberySoria97]) that if $E$ is a tube null subset of the unit ball of ${\mathbb{R}}^d$ (denoted $\mathbf{B}_d$), where $d\ge 2$, then there exists $f\in L^2(\mathbb{R}^d)$ which is identically zero on $\mathbf{B}_d$, and such that the localisations $$S_R f(x) = \int_{|\xi|<R} \widehat{f}(\xi) \exp(2\pi i \xi\cdot x) d\xi$$ fail to converge as $R\to\infty$ for all $x\in E$. It is an open problem whether, conversely, every set of divergence for $S_R$ is tube-null. Motivated by this connection, in [@CSV07 p.155] (see also [@Carbery09]) the authors pose the problem of finding the infimum of the Hausdorff dimensions of sets in $\mathbb{R}^d$, which are *not* tube null, and show that this infimum lies between $d-1$ and $d-1/2$. We are able to settle this question: \[thm:non-tube-null\] There exists a purely unrectifiable set $A\subset \mathbb{R}^d$ which has Hausdorff and box counting dimension $d-1$ and is not tube null. We remark that the non-tube null sets of fractional dimension constructed in [@CSV07] are unions of spheres, and therefore fail to be purely unrectifiable. We obtain a finer result in terms of gauge functions. Recall that a function $h:(0,\infty)\to (0,\infty)$ is called a gauge function if it is non-decreasing, continuous and $\lim_{t\downarrow 0} h(t)=0$ (sometimes continuity is not assumed). Given a gauge function $h$, the $h$-dimensional Hausdorff measure $\mathcal{H}^h$ is defined as $$\mathcal{H}^h(E) = \lim_{\delta\to 0} \inf\left\{ \sum_{i=1}^\infty h({\text{diam}}(E_i)) : E\subset\bigcup_i E_i, {\text{diam}}(E_i)<\delta \right\}.$$ This is always a measure on the Borel $\sigma$-algebra. When $h(t)=t^\beta$, we recover the usual $\beta$-dimensional Hausdorff measure $\mathcal{H}^\beta$. See e.g. [@Falconer03 Section 2.5] for further details. \[thm:gauge-main-result\] Let $h:(0,\infty)\to(0,\infty)$ be a gauge function such that $h(2t) \le 2^d h(t)$, and $$\label{eq:growth-h} \int_0^1 t^{-1}\sqrt{t^{1-d}|\log(t)| h(t)}\,dt<+\infty.$$ Then there exists a compact set $A\subset\mathbb{R}^d$ with the following properties: 1. For each $n$, $A$ can be covered by $C/h(2^{-n})$ balls of radius $2^{-n}$, where $C>0$ depends only on $d$. 2. $0<\mathcal{H}^h(A)<\infty$. 3. \[ntn\] If $B\subset A$ is a Borel set with $\mathcal{H}^h(B)>0$, then $B$ is not tube null. In particular, $A$ is not tube null. One obtains Theorem \[thm:non-tube-null\] by taking e.g. $h(t)=t^{d-1}|\log t\log|\log t||^{-3}$; see Section \[sec:proofs\]. The condition $h(2t)\le 2^d h(t)$ is very mild for a subset of $\mathbb{R}^d$. The key assumption is ; it says that $A$ is “larger than $d-1$ dimensional by at least a logarithmic factor”. Theorem \[thm:gauge-main-result\] fails if $\liminf_{t\downarrow 0} h(t) t^{1-d} > 0$, see [@CSV07 Proposition 7]. It remains an open problem to determine the exact family of gauge functions for which non tube null sets exist. Tubes around more general curve families ---------------------------------------- When $d=2$, we are also able to treat tubes around more general curves. Given a family of curves $\mathcal{F}$ in ${\mathbb{R}}^2$, we call the $w$-neighborhood of $F\in\mathcal{F}$ an *$\mathcal{F}$-tube* of width $w=w(T)$. We say that a set $A\subset\mathbb{R}^2$ is *$\mathcal{F}$-tube null* if, for every $\delta>0$, there is a countable covering $\{ T_j\}$ of $A$ by $\mathcal{F}$-tubes, with $\sum_j w(T_j)<\delta$. Given $k\in\mathbb{N}$, let $\mathcal{P}_{k}$ be the family of (real) algebraic curves of degree at most $k$. Observe that $\mathcal{P}_1$-tube null is just tube null. By imposing a slightly stronger integrability condition for $h$, we obtain the following generalisation of Theorem \[thm:non-tube-null\] for $\mathcal{P}_k$. \[thm:polynomial\] For $d=2$ and $k\in{\mathbb{N}}$, Theorem 1.2 continues to hold if in , “tube null” is replaced by “$\mathcal{P}_k$-tube null”. and if is replaced by $$\label{eq:growth-h-polynomial} \int_0^1 t^{-1}|\log(t)|\sqrt{t^{1-d} h(t)}\,dt<+\infty.$$ The family of algebraic curves of a bounded degree is “essentially finite dimensional”, see Lemma \[lem:almost-finite-box-dim\]. These results pose the question of how large a family of curves $\mathcal{F}$ may be so that there exist sets of less than full Hausdorff dimension which are non $\mathcal{F}$-tube null. The family $\mathcal{P}=\cup_{k\in{\mathbb{N}}}\mathcal{P}_{k}$ does not have this property for trivial reasons: it is Hausdorff dense in the compact subsets of the unit square. If we instead consider the family $\mathcal{Q}\subset\mathcal{P}$ of algebraic curves which are graphs of functions of either $x$ or $y$ with derivative at most $1$, then the situation is much more subtle. Indeed, Alberti, Csörnyei, and Preiss (See [@ACP05 Theorem 2]) proved that for the family $\mathcal{L}$ of $1$-Lipschitz graphs in the coordinate directions, any Lebesgue-null set is $\mathcal{L}$-tube null. By approximation, the same can be deduced to hold for $\mathcal{Q}$. One is then led to ask what the situation is for infinite dimensional families of curves which nonetheless carry more structure than just being Lipschitz. One of the most natural such families is the following: let $\mathcal{C}$ be the family of curves which are graphs of a convex function $f:[0,1]\to {\mathbb{R}}$. It is not hard to see $\mathcal{C}$ is not doubling in the Hausdorff metric (see Section \[sec:proofs2\]). Nevertheless, in contrast with the result of Alberti, Csörnyei and Preiss, there are sets of dimension less than $2$ which are not $\mathcal{C}$-tube null. \[thm:convex\] For every $5/3<\beta<2$, there exists a set $A\subset{\mathbb{R}}^2$ with $0<\mathcal{H}^\beta(A)<\infty$ which is not $\mathcal{C}$-tube null. It seems very likely that the method can be pushed to show that $5/3$ can be replaced by $3/2$ in the above theorem. We do not know what is the best possible value, and conjecture that $5/3$ cannot be replaced by $1$, i.e. there is $\delta>0$ such that every set of Hausdorff dimension $1+\delta$ [*is*]{} $\mathcal{C}$-tube null. Further results --------------- As a corollary of the proofs, we can extend [@Carbery09 Theorem 1] to one of the endpoints and a wider class of tubes. \[thm:bounded-density-projections\] For any $\beta>d-1$, there exists a set $A\subset\mathbb{R}^d$ with positive and finite $\beta$-dimensional Hausdorff measure $\mathcal{H}^\beta$, such that $$\sup_{T} \frac{\mathcal{H}^\beta(A\cap T)}{w(T)^{d-1}} <+\infty,$$ where the supremum is over all (linear) tubes. In dimension $d=2$, the result also holds when the supremum is taken over all $\mathcal{P}_k$-tubes (for fixed $k$). In [@Carbery09 Theorem 1] this is proved, for standard tubes, with any exponent $\gamma<\min(\beta,d-1)$ in the denominator, and the question of finding all possible pairs $(\beta,\gamma)$ is posed. Examples satisfying this estimate at the other endpoint, corresponding to $\beta=\gamma<d-1$, were constructed by Orponen [@Orponen13] (again, only in the case of standard tubes around lines). Our final result concerns the dimension of intersections of fractals and lines (or, more generally, algebraic curves). It is a general result of Marstrand (in the plane) and Mattila (in arbitrary dimension) that a Borel set $E\subset\mathbb{R}^d$ of Hausdorff dimension $\beta>1$ intersects “typical” lines in Hausdorff dimension at most $\beta-1$ (here “typical” refers to an appropriate natural measure space, see [@Mattila95 Theorem 10.10]). It is of interest to sharpen this result for specific classes of sets. For example, Furstenberg [@Furstenberg70] conjectured that for certain fractals of dynamical origin, there are no exceptional lines, and Manning and Simon [@ManningSimon12] proved that typical lines with rational slopes intersect the Sierpiński carpet in dimension strictly less than $\beta-1$, where $\beta$ is the dimension of the carpet. It follows from our methods that there exist sets for which there are no exceptional lines in the Marstrand-Mattila’s Theorem, in a strong uniform quantitative way. \[thm:fibres\] Let $h$ be a gauge function satisfying the assumptions of Theorem \[thm:gauge-main-result\]. Then there exists a compact set $A\subset\mathbb{R}^d$ of positive and finite $h$-dimensional measure with the following property: there exists $C>0$ such that for any line $\gamma\subset\mathbb{R}^d$ and any $r>0$, the fibre $A\cap \gamma$ can be covered by $C r/h(r)$ intervals of length $r$. If $d=2$, the same holds for all $\gamma\in\mathcal{P}_k$, provided $h$ satisfies the slightly stronger assumption of Theorem \[thm:polynomial\]. The proofs of all our main results rely on a random iterative construction described in the next section. Thus this paper can be seen as an application of the probabilistic method, based on the insight that it is often easier to exhibit objects with certain properties by showing that almost every object in a random family satisfies them. Although here we study the geometry of random measures as a tool towards our results, many recent articles have studied projections of random fractals for their own sake (see [@RamsSimon11; @PeresRams11; @RamsSimon14] and references therein). In particular, the results in [@RamsSimon11; @PeresRams11] on projections of fractal percolation led us to believe that random tree-like fractals were likely not tube null, and provided several of the ideas needed to prove it. Acknowledgements {#acknowledgements .unnumbered} ---------------- We learned some of the ideas we use from [@PeresRams11], and we thank Y. Peres and M. Rams for sharing their insights with us. We are also grateful to M. Csörnyei for telling us about the problems related to non tube null sets. Notation and construction {#sec:notation-and-construction} ========================= We use $O(\cdot)$ notation: $X=O(Y)$ means $X\le C Y$ for some constant $0<C<+\infty$, $X=\Omega(Y)$ means $Y=O(X)$, and $X=\Theta(Y)$ means $X=O(Y)$ and $Y=O(X)$. When the implicit constants depend on some other constant, this will be denoted by subscripts; so for example $Y=O_k(X)$ means that $Y\le C(k)X$ for some positive function $C$ of $k$. Throughout the paper, we let $|A|$ denote the Lebesgue measure of a set $A\subset{\mathbb{R}}^d$. We also let $D$ denote the Hausdorff metric in the space of compact subsets of the unit cube $[0,1]^d$. We prove all our results for sets obtained as the limit of an iterative random construction related to (although different from) fractal percolation. A somewhat related random construction was used by Peres and Solomyak [@PeresSolomyak05] to obtain sets $A$ such that $\mathcal{H}^h(A)>0$, yet almost all orthogonal projections of $A$ have zero Lebesgue measure. Such sets are necessarily tube-null, and it is thus not surprising that the results of [@PeresSolomyak05] apply to completely different gauge functions than the ones considered in the present work. We now describe our random construction: Let $\mathcal{D}_n$ denote the collection of closed dyadic sub-cubes of $[0,1]^d$ of side length $2^{-n}$. Let $\{a_n\}$ be a sequence satisfying $$a_n\in \{1,2^d\}\quad\text{ and }\quad P_n:=\prod_{i=1}^n a_i =\Theta\left(1/h(2^{-n})\right).$$ Such sequence exists because $h(t)\le h(2t)\le 2^{d}h(t)$. Starting with the unit cube $A_0=[0,1]^d$, we inductively construct random sets $A_n$ as follows. If $a_n=2^d$, set $A_{n+1}=A_n$. Otherwise, if $a_n=1$, choose, for each $D\in\mathcal{D}_n$ such that $D\subset A_n$, one of the $2^d$ dyadic sub-cubes of $D$ (which are in $\mathcal{D}_{n+1}$), with all choices being uniform and independent of each other and the previous steps. Let $A_{n+1}$ be the union of the chosen sub-squares. Then $\{ A_n\}$ is a decreasing sequence of nonempty compact sets, and we set $A=\bigcap_{n=1}^\infty A_n$. See Figure \[fig:construction\] for an example. ![The first three steps in the construction of $A$ in the plane, with $a_1=4, a_2=a_3=1$[]{data-label="fig:construction"}](construction.eps){width="90.00000%"} Proof of key result {#sec:proof-key-lemma} =================== Let $\mu_n$ be the normalized restrictions of Lebesgue measure to $A_n$, i.e. $$\label{mun-def} \mu_n(B)=2^{dn} P_{n}^{-1}|B\cap A_n|$$ for all $B\subset{\mathbb{R}}^d$. These measures converge to a measure $\mu$ supported on $A$. By verifying it first for dyadic cubes, it is standard to check that $\mu(E)=\Theta_d(\mathcal{H}^h(E))$ for any Borel set $E\subset A$. In particular, $0<\mathcal{H}^h(A)<\infty$, and for any Borel set $E\subset A$, $\mathcal{H}^h(E)>0$ if and only if $\mu(E)>0$. We now start the core of the proof of Theorem \[thm:gauge-main-result\]: showing that almost surely, no positive measure subset of $A$ is tube null. Let $\mathcal{A}$ denote the family of all lines which intersect the unit cube. Given $\ell\in\mathcal{A}$ and $n\in\mathbb{N}$, we define the random variable $$\label{eq:an} Y_n^\ell= 2^{dn} P_n^{-1} \mathcal{H}^1(A_n\cap \ell) = \frac{\mathcal{H}^1(A_n\cap \ell)}{|A_n|},$$ where $\mathcal{H}^1$ denotes $1$-dimensional Hausdorff measure (length). Our proof will involve estimating the $Y_n^\ell$, and indeed showing that they are uniformly bounded. This is the content of our key result: \[thm:main-technical-result\] Almost surely, $\sup_{n\in\mathbb{N},\ell\in\mathcal{A}} Y_n^\ell <\infty$. Theorem \[thm:main-technical-result\] will follow from the next two lemmas. The first is a large deviation argument that we adapt from [@PeresRams11]. Since we want $Y_{n}^\ell$ to be a martingale, we only consider non-dyadic lines, e.g. lines $\ell\in\mathcal{A}$ not contained in any dyadic hyperplane, $\{(x_1,\ldots, x_d)\in{\mathbb{R}}^d\mid x_j=k 2^{-n}\}$, $k\in\mathbb{Z}$, $n\in{\mathbb{N}}$. We denote the family of non-dyadic lines by $\mathcal{A}'$. Observe that $\sup_{n\in\mathbb{N},\ell\in\mathcal{A}} Y_n^\ell= O_d\left(\sup_{n\in\mathbb{N},\ell\in\mathcal{A}'} Y_n^\ell\right)$. \[lem:large-deviation\] For any $\ell\in\mathcal{A}'$, $n\in \mathbb{N}$, and $\kappa>0$ for which $$\label{assu:kappa} \kappa^2 2^{(1-d)n}P_n=\Omega(1)\,,$$ we have $$\mathbb{P}\left(\left|Y_{n+1}^\ell-Y_n^\ell \right|> \kappa\sqrt{Y_n^\ell}\right) \le O(1) \exp(-\Omega(1)\kappa^2 2^{(1-d)n}P_n).$$ We fix $n$ and condition on $A_n$. If $a_n=2^d$ then $Y_{n+1}^\ell=Y_n^\ell$, so we assume $a_n=1$, whence $P_{n+1}=P_n$. Write $D$ for the collection of cubes in $\mathcal{D}_n$ forming $A_n$ that intersect $\ell$ in a set of positive length. Let $\nu_j= 2^{n}\mathcal{H}^1|_{\ell\cap A_j}$, $j\in\{n,n+1\}$. For each $Q\in D$, we let $$X_Q = 2^{d-1}\nu_{n+1}(Q)-\nu_n(Q).$$ The random variables $\{ X_Q:Q\in D\}$ are independent, have zero mean, and are bounded in modulus by $O(1)$. For each $j$, we decompose $D$ into the families $$D_j = \{ Q\in D: \sqrt{d}\cdot 2^{-j}\le \nu_n(Q)< \sqrt{d} \cdot 2^{1-j} \}.$$ Then $D_j$ is empty for all $j< 0$. Moreover, as $Y_n^\ell = 2^{(d-1)n} P_n^{-1}\sum_{Q\in D}\nu_n(Q)$, we have $$Y_{n}^\ell\ge \Omega(1)(\#D_j) 2^{(d-1)n-j}P_n^{-1}\,\,,$$ for all $j$. By Hoeffding’s inequality, for any $\lambda>0$ we have the estimate $${\mathbb{P}}\left(\left|\sum_{Q\in D_j} X_Q\right|>\lambda 2^{(1-d)n} P_n \sqrt{Y_n^\ell} \right) \le O(1)\exp(-\Omega(\lambda^2)2^{j+(1-d)n}P_n)\,,$$ recall $|X_Q|=O(2^{-j})$. Since $Y_{n+1}^\ell-Y_n^\ell=2^{(d-1)n} P_n^{-1}\sum_{Q\in D} X_Q$, we conclude that $$\begin{aligned} {\mathbb{P}}\left(\left|Y_{n+1}^\ell-Y_n^\ell\right|>\kappa\sqrt{Y_n^\ell} \right) &\le \sum_{j=1}^\infty {\mathbb{P}}\left(\left|\sum_{Q\in D_j} X_Q\right|>\Omega(j^{-2}) 2^{(1-d)n} P_n \kappa \sqrt{Y_n^\ell}\right) \\ &\le O(1)\exp(-\Omega(1) 2^{(1-d)n} P_n \kappa^2),\end{aligned}$$ where we use to obtain the last estimate. The second lemma shows that a finite set of lines of exponential size controls all lines, up to an ultimately negligible error. \[lem:many-lines-to-all-lines\] For each $n$, there is a (deterministic) family of lines $\mathcal{A}_n\subset\mathcal{A}'$ such that $\#\mathcal{A}_n \le O(1)^n$, and $$\sup_{\ell\in \mathcal{A}'}Y^{\ell}_n\le\sup_{\ell\in \mathcal{A}_n}Y^{\ell}_n + O(2^{-n}),$$ for any realization of $A$. We construct a family of lines ${\mathcal{A}}_n$ with $O(1)^n$ elements such that given any line $\ell\in{\mathcal{A}}'$, there is $\ell'\in{\mathcal{A}}_n$ such that $$\label{gg'} \mathcal{H}^1(\ell \cap Q)\le \mathcal{H}^1(\ell' \cap Q)+O(8^{-n})\quad\text{ for any } Q\in\mathcal{D}_n.$$ We first assume that $d=2$. Recall that $D$ is the Hausdorff distance between closed subsets of the unit cube. By elementary geometry, there is ${\mathcal{A}}^0_{n}\subset{\mathcal{A}}'$ with $O(1)^n$ elements which is $64^{-n}$ dense in the $D$ metric. For each horizontal dyadic line $$\ell_k=\{(x,y)\in{\mathbb{R}}^2\mid y=k 2^{-n}\},\quad k=0,1,\ldots,2^n,$$ let ${\mathcal{A}}_{\ell_k}$ denote the collection of lines forming an angle $\pm 8^{-n}$ with $\ell_k$ and crossing $\ell_k$ at any of the points $(m 8^{-n}, k 2^{-n})$, $m=0,1,\ldots,8^{n}$. Let ${\mathcal{A}}^1_{n}$ be the union of all the ${\mathcal{A}}_{\ell_k}$, $k=0,\ldots,2^n$. Observe that ${\mathcal{A}}^1_{n}$ has only $O(1)^n$ elements. Finally, let ${\mathcal{A}}^2_{n}$ be a similar family of lines constructed around the vertical dyadic lines $\{(x,y)\in{\mathbb{R}}^2\mid x=k 2^{-n}\}$ and define ${\mathcal{A}}_n={\mathcal{A}}^0_{n}\cup{\mathcal{A}}^1_{n}\cup{\mathcal{A}}^2_{n}$. Now let $\ell\in{\mathcal{A}}'$. If the angle between $\ell$ and the coordinate directions is larger than $8^{-n}$ or if $\ell$ is completely contained in a single row or column in $\mathcal{D}_n$, then by elementary geometry, holds for any $\ell'\in{\mathcal{A}}^0_n$ which is $64^{-n}$ close to $\ell$ in the $D$ metric. Otherwise, we can find a line $\ell'$ from ${\mathcal{A}}^1_{n}$ or ${\mathcal{A}}^2_{n}$ such that is fulfilled. When $d>2$, we also let ${\mathcal{A}}^0_{n}$ be a $64^{-n}$-dense family in ${\mathcal{A}}'$ with $O(1)^n$ elements. As in the $d=2$ case, for any $\ell\in{\mathcal{A}}'$ which forms an angle at least $8^{-n}$ with all the coordinate hyperplanes, there is $\ell'\in{\mathcal{A}}^1_{n}$ so that is satisfied. To deal with the lines forming a small angle with at least one hyperplane $$H=\{(x_1,\ldots,x_d)\in{\mathbb{R}}^d\mid x_j=k 2^{-n}\}\,,$$ which they intersect, we need to construct families ${\mathcal{A}}^1_{n},\ldots, {\mathcal{A}}^d_{n}$. This is done in a similar way to the $d=2$ case, by considering a dense enough subset $Y_H\subset H$ with $O(1)^n$ elements and choosing, for each $z\in Y_H$, suitable lines that cross $H$ at $z$ and are almost parallel to $H$. We omit the details. We can now finish the proof of the lemma. Since each line $\ell$ hits at most $O(2^n)$ squares in $\mathcal{D}_n$, we conclude from that $\mathcal{H}^1(\ell\cap A_n)\le\mathcal{H}^1(\ell'\cap A_n)+O(4^{-n})$ and combined with the definition of $Y_n^\ell$, this implies that $Y_n^\ell\le Y_n^{\ell'}+2^{dn} P_n^{-1}O(4^{-n})=Y_n^{\ell'}+O(2^{-n})$. Recall that $P_n=\Omega(2^{(d-1)n})$. It follows that ${\mathcal{A}}_n$ is the desired family. Let $M_n = \sup_{\ell\in{\mathcal{A}}'} Y_n^\ell$. It follows from that$$\sum_{n=1}^\infty\sqrt{n 2^{(d-1)n} h(2^{-n})}<\infty.$$ The Borel-Cantelli lemma shows that it is enough to find $C<\infty$ such that $$\label{eq:borel-cantelli} \sum_{n=1}^\infty {\mathbb{P}}\left(M_{n+1}-M_n>C \sqrt{n 2^{(d-1)n} h(2^{-n}) M_n}+ O(2^{-n})\right) <\infty.$$ Therefore fix $n$ and condition on $A_n$. Pick $\ell\in{\mathcal{A}}$. Recalling that $P_n^{-1}=\Theta(h(2^{-n})$, it follows from Lemma \[lem:large-deviation\] that $${\mathbb{P}}\left(Y_{n+1}^\ell - Y_n^\ell > C \sqrt{n 2^{(d-1)n} h(2^{-n}) Y_n^\ell}\right) \le O(1) \exp(-C^2\,\Omega(n)).$$ Observe that $n 2^{(d-1)n} h(2^{-n}) 2^{(1-d)n} P_n=\Omega(n)=\Omega(1)$ so that holds and we may apply Lemma \[lem:large-deviation\]. Let ${\mathcal{A}}_{n+1}$ be the family given by Lemma \[lem:many-lines-to-all-lines\]. For $C$ sufficiently large, it holds that $$\begin{aligned} \label{eq:poly-times-exp} {\mathbb{P}}\left(\max_{\ell\in {\mathcal{A}}_{n+1}} Y_{n+1}^\ell - M_n \ge C \sqrt{n 2^{(d-1)n} h(2^{-n}) M_n} \right) &\le O(1)^n \exp(-C^2\Omega(n))\\ &=O(\exp(-\Omega(n))).\notag\end{aligned}$$ In light of Lemma \[lem:many-lines-to-all-lines\], we see that holds, completing the proof. Proofs of Theorems \[thm:non-tube-null\] and \[thm:gauge-main-result\] {#sec:proofs} ======================================================================= The first two assertions in Theorem \[thm:gauge-main-result\] are clear; we only need to show that if $B\subset A$ has positive $\mu$-measure, then $B$ is not tube null. By Theorem \[thm:main-technical-result\], almost surely there is $C>0$ such that $Y_n^\ell\le C$ for all $n$ and $\ell$. This implies that for each $n$, all orthogonal projections of $\mu_n$ onto hyperplanes have a density (w.r.t $(d-1)$-dimensional Lebesgue measure) uniformly bounded by $C$. The same therefore holds for $\mu$. Now this implies that if $\{ T_j\}$ is a countable collection of tubes covering $B$, then $$0<\mu(B) \le \sum_j \mu(T_j) \le \sum_j C\,w(T_j)^{d-1},$$ showing that $B$ is not tube null. Take $h(t)=t^{d-1}|\log t\log|\log t||^{-3}$. Because $\lim_{t\downarrow 0}\log h(t)/\log t=d-1$, $A$ has Hausdorff and box dimension equal to $d-1$ and is a.s. not tube null by Theorem \[thm:gauge-main-result\]. It remains to show that $A$ is purely unrectifiable. For simplicity, we assume that $d=2$. Denote by $\mathcal{N}$ the collection of all $n\in{\mathbb{N}}$ for which $a_n=a_{n+1}=1$. Observe that $a_n$ in can be selected so that $\mathcal{N}$ is infinite. Suppose on the contrary, that there is a continuously differentiable curve $\Gamma$ such that $\Gamma\cap A$ has positive length. By the Lebesgue density theorem, $\mathcal{H}^1$-almost all $x\in A\cap\Gamma$ satisfy $$\begin{aligned} \label{eq:densitypoint} \lim_{n\rightarrow\infty}\frac{\mathcal{H}^1\left(3 Q_n\cap \Gamma\cap A\right)}{\mathcal{H}^1\left(3 Q_n\cap \Gamma\right)}=1,\quad\ \limsup_{n\rightarrow\infty}\frac{\mathcal{H}^1\left(3 Q_n\cap \Gamma\right)}{2^{-n}}= O(1),\end{aligned}$$ where $Q_n\in\mathcal{D}_n$ is a square that contains $x$ and $3Q_n$ is the union of $Q_n$ and its neighbors in $\mathcal{D}_n$. Fix $x\in A\cap\Gamma$ satisfying and let $n\in\mathcal{N}$. Since each of the neighboring squares of $D_n$ contain only at most one square from $\mathcal{D}_{n+2}$, $\Gamma\cap 3Q_n$ has to cross at least one column or row $S$ of squares in $\mathcal{D}_{n+2}$ such that $3Q_n\cap A\cap S=\emptyset$. This implies that $\mathcal{H}^1(3Q_n\cap\Gamma\setminus A)\ge\Omega(2^{-n})$. For large $n$ this yields a contradiction with . The case $d>2$ follows with the same argument, assuming that $a_n=a_{n+1}=\ldots=a_{n+O_d(1)}=1$ for infinitely many $n$. Proof of Theorems \[thm:polynomial\], \[thm:bounded-density-projections\] and \[thm:fibres\] ============================================================================================ The proof of Theorem \[thm:polynomial\] follows the same pattern of the proof of Theorem \[thm:gauge-main-result\]; the main difference lies in establishing the analog of Lemma \[lem:many-lines-to-all-lines\], which requires a more involved argument. From now on, we assume that $d=2$. Fix $k\in\mathbb{N}$. As in the linear case, for any curve $\gamma$ and $n\in\mathbb{N}$, we define the random variable $$\label{Yn-def} Y_n^\gamma= 4^n P_n^{-1} \mathcal{H}^1(A_n\cap \gamma).$$ Lemma \[lem:large-deviation\] continues to hold for $\gamma\in\mathcal{P}_k$ with the same proof, unless $\gamma$ is a dyadic line of the form $\{x=k 2^{-n}\}$ or $\{y=k 2^{-n}\}$, $k,n\in{\mathbb{N}}$. Indeed, in Lemma \[lem:large-deviation\], the only time we used the fact that we were dealing with lines was in the estimate $\mathcal{H}^1(\ell\cap Q)=O({\text{diam}}(Q))$ for all squares $Q$, and it is clear that $\mathcal{H}^1(\gamma\cap Q)=O_k({\text{diam}}(Q))$ if $\gamma\in\mathcal{P}_k$. Before discussing the needed analog of Lemma \[lem:many-lines-to-all-lines\], we make a reduction that will be useful also later. By Bezout’s Theorem, each $\gamma\in\mathcal{P}_k$ can be split into $O_k(1)$ curves, each of which is, after a rotation by $\pi/2$ and/or a reflection, the graph of a convex, increasing function $f\colon[a,b]\rightarrow[0,1]$ with derivative bounded by $1$. The core of the proof is again to show that $$C:=\sup_{\gamma\in\mathcal{P}_{k},\,n\in\mathbb{N}} Y_n^\gamma < +\infty.$$ It is enough to show this for the family $\mathcal{Q}_k$, which consists of those subsets of the algebraic curves in $\mathcal{P}_k$, which are graphs of convex increasing functions with right derivative bounded from above by $1$. The following simple Lemma is essential in the proof of Lemma \[lem:many-algebraic-to-all-algebraic\]. It should be well known, but we have not been able to find a reference so a proof is included for completeness. \[lem:convex\] Let $f_1, f_2$ be convex increasing functions defined on $[0,1]$ with right derivative bounded above by $1$, and let $\gamma_i$, $i=1,2$, be their graphs. Then $$|\mathcal{H}^1(\gamma_1)-\mathcal{H}^1(\gamma_2)|=O(|f_1-f_2|_\infty)\,,$$ where $|h|_\infty=\sup_{x\in[0,1]}|h(x)|$. By approximation, we can assume that $f_1, f_2$ are twice continuously differentiable. Then $$\begin{aligned} \label{fg} \mathcal{H}^1(\gamma_1)-\mathcal{H}^1(\gamma_2)&=\int_{t=0}^1\sqrt{1+f_1'(t)^2}-\sqrt{1+f_2'(t)^2}\,dt\nonumber\\ &=\int_{t=0}^1 a(t)\left(f_1'(t)-f_2'(t)\right)\,dt\,,\end{aligned}$$ where $$a(t)=\left(f_1'(t)+f_2'(t)\right)\left(\sqrt{1+f_1'(t)^2}+\sqrt{1+f_2'(t)^2}\right)^{-1}\,.$$ Then $$a'(t) = b_1(t) f''_1(t) + b_2(t) f''_2(t),$$ where $b_1,b_2$ are continuous functions on $[0,1]$ bounded by $O(1)$. Integrating by parts, we deduce from that $$\begin{aligned} |\mathcal{H}^1(\gamma_1)-\mathcal{H}^1(\gamma_2)| &\le O(|f_1-f_2|_\infty) + \int_{t=0}^1 |a'(t)| |f_1(t)-f_2(t)| dt\\ &\le O(|f_1-f_2|_\infty)(1+ |a'|_1),\end{aligned}$$ where $|\cdot|_1$ denotes the $L^1$ norm on $[0,1]$. But $$|a'|_1 \le |b_1|_\infty |f_1''|_1 + |b_2|_\infty |f_2''|_1 = O(1),$$ using that $|f''_i|_1 = f_i'(1)-f_i'(0)\le 1$ for $i=1,2$, thanks to our assumptions. We shall next provide a simple geometric argument implying a bound on the number of $\delta$-balls needed to cover $\mathcal{Q}_k$. Recall that $D$ is the Hausdorff distance on the unit cube. \[lem:almost-finite-box-dim\] For all $0<\delta<1$, $\mathcal{Q}_k$ can be covered by $\exp(O_k(|\log\delta|^2))$ balls of radius $\delta$ in the $D$-metric. We prove that given $\gamma\in\mathcal{Q}_k$ and $0<r<1$, we may cover the ball $B(\gamma,r)$ by $O_k(r^{-O_k(1)})$ balls of radius $r/2$. The claim then follows by applying this recursively for all $r=2^{-n}$, $n\in{\mathbb{N}}$. If $\gamma,\widetilde{\gamma}\in\mathcal{Q}_k$, let $f$ (resp. $\widetilde{f}$) denote the function whose graph $\gamma$ (resp. $\widetilde{\gamma}$) is. Fix $\gamma\in\mathcal{Q}_k$ and for $\widetilde{\gamma}\in B(\gamma,r)$, denote by $[a_{\widetilde{\gamma}},c_{\widetilde{\gamma}}]$ the interval on which $\widetilde{f}$ is defined. For notational convenience, we assume that $\tfrac{5}{r}\in{\mathbb{N}}$. For $-8\le i\le 8$, let $f_i=f+\tfrac{ir}{5}$. We extend the functions $f_i$ to $[a_\gamma-r,c_\gamma+r]$ by setting $f_i(t)=f_i(a_\gamma)$ for $a_\gamma-r\le t<a_\gamma$ and $f_i(t)=f_i(c_\gamma)$ for $c_\gamma< t\le c_\gamma+r$. To each $\widetilde{\gamma}\in B(\gamma,r)$ we attach a sequence $$p=p(\widetilde{\gamma})=(p_{0},p_1,\ldots,p_{5/r})\in\{-\infty,-8,-7,\ldots,7,+\infty\}^{5/r}$$ such that. $$p_j= \begin{cases} -\infty\text{ if }a_{\widetilde{\gamma}}>\frac{jr}{5}\,\\ i\text{ if }f_i\left(\frac{jr}{5}\right)\le\widetilde{f}\left(\frac{jr}{5}\right)<f_{i+1}\left(\frac{jr}{5}\right)\,\\ +\infty\text{ if }c_{\widetilde{\gamma}}<\frac{jr}{5}\,. \end{cases}$$ By Bezout’s theorem, for any $i$ and $\widetilde{\gamma}\in B(\gamma,r)$, $\widetilde{\gamma}$ intersects the graph of $f_i$ at most $O_k(1)$ times (or otherwise $\widetilde{f}= f_i$). This means that for each $\widetilde{\gamma}\in B(\gamma,r)$, there are at most $O_k(1)$ values $p_j$ such that $p_{j+1}\neq p_j$. Thus, the number of all possible sequences $p(\widetilde{\gamma})$ for $\widetilde{\gamma}\in B(\gamma,r)$ is at most $O( r^{-O(1)})$. In addition, if $p(\widetilde{\gamma})=p(\hat{\gamma})$, it follows from the construction that $\hat{\gamma}\in B(\widetilde{\gamma},r/2)$, recall that the derivative of each $\widetilde{f}\in\mathcal{Q}_k$ is between $0$ and $1$. Combining these observations implies that $B(\gamma,r)$ may be covered by $O(r^{-O(1)})$ balls of radius $r/2$. It seems likely that the bound $\exp(O_k(|\log\delta|^2))$ in Lemma \[lem:almost-finite-box-dim\] could be improved to $\delta^{-O_k(1)}$ (this is equivalent to $\mathcal{Q}_k$ having finite box-dimension in the $D$-metric). If this is the case, then in Theorem \[thm:polynomial\] can be replaced by . However, we have not been able to prove this nor could we track such a result in the literature. Recall that there is only a mild difference between the conditions and , and also that it is not known if is sharp for Theorem \[thm:gauge-main-result\]. As earlier in the case of lines, we ignore the elements of $\mathcal{Q}_k$ that contain a nontrivial line segment of some dyadic line $\{y=k 2^{-n}\}$, $k,n\in{\mathbb{N}}$. We denote the corresponding family by $\mathcal{Q}'_k$. Note that trivially, Lemma \[lem:almost-finite-box-dim\] applies also for $\mathcal{Q}'_k$. \[lem:many-algebraic-to-all-algebraic\] For each $n$, there is a family of curves $\mathcal{Q}_{n,k}\subset \mathcal{Q}'_k$ such that $\#\mathcal{Q}_{n,k}\le\exp(O_k(n^2))$, and $$\sup_{\gamma\in \mathcal{Q}'_k}Y^{\gamma}_n\le\sup_{\gamma\in \mathcal{Q}_{n,k}}Y^{\gamma}_n + O_k((4/5)^n),$$ for any realization of $A$. To begin with, take $\delta=25^{-n}$ and let $\Gamma'\subset\mathcal{Q}'_k$ be the $\delta$-dense family of size $\exp(O(n^2))$ given by Lemma \[lem:almost-finite-box-dim\]. We will next modify $\Gamma'$ by adding a finite number of translates of each $\gamma\in\Gamma'$: Let $\gamma\in\Gamma'$, and let $\gamma$ be the graph of $f\colon[a,c]\rightarrow[0,1]$. Let $(a,b)$ be the interval on which $f'(x^+)<5^{-n}$. If there is $k\in{\mathbb{N}}$ such that $|f(a)-k 2^{-n}|\le 5^{-n}$, we choose numbers $-O(5^{-n})<y_i<O(5^{-n})$ for each $a\le i 5^{-n}\le b$, $i\in{\mathbb{N}}$, such that the function $f_i(x)=f(x)+y_i$ crosses the dyadic line $y=k 2^{-n}$ at $x_i=i 5^{-n}$. Let $\mathcal{E}_\gamma$ consist of $\gamma$ and all the graphs of $f_i$. We define $$\Gamma=\bigcup_{\gamma\in\Gamma'}\mathcal{E}_\gamma\,.$$ Since each $\mathcal{E}_\gamma$ contains at most $O(5^n)$ elements, it follows that the cardinality of $\Gamma$ is $\exp(O(n^2))$. Moreover, using Lemma \[lem:convex\] it can be checked that, for any $\gamma\in\mathcal{Q}_k$, there is $\widetilde{\gamma}\in\Gamma$ such that $$\mathcal{H}^1(\gamma\cap Q)\le \mathcal{H}^1(\widetilde{\gamma}\cap Q) + O_k(5^{-n})\quad\text{for all }Q\in\mathcal{D}_n.$$ We leave the verification of the several simple cases to the reader, or see Lemma \[lem:many-convex-to-all-convex\] for a similar but more complicated argument. As in the proof of Lemma \[lem:many-lines-to-all-lines\], the claim now follows by adding over all chosen $Q$, using the trivial bound $P_n=\Omega(2^n)$, and recalling the definition of $Y_n^\gamma$ (see ). Once we have analogs of Lemmas \[lem:large-deviation\] and \[lem:many-lines-to-all-lines\], the proof of Theorem \[thm:main-technical-result\] works verbatim to yield that almost surely $$C:=\sup_{\gamma\in\mathcal{Q}_{k},\,n\in\mathbb{N}} Y_n^\gamma < +\infty.$$ (Replacing Lemma \[lem:many-lines-to-all-lines\] by Lemma \[lem:many-algebraic-to-all-algebraic\] and by , the upper bound in reads $\exp\left(O(n^2)-C^2\Omega(n^2)\right)$.) To conclude the proof, fix some $\gamma\in\mathcal{Q}_k$; suppose $\gamma$ is the graph of $f:[a,b]\to \mathbb{R}$. Then for any $\delta>0$, $$\gamma(\delta) \subset B((a,f(a)),\delta) \cup B((b,f(b)),\delta) \cup \{ (x,y): |y-f(x)|<2\delta \}\,.$$ Comparing the definitions of $\mu_n$ and $Y_\gamma^{n}$ (see and ), it then follows from Fubini’s theorem that $\mu_n(\gamma(\delta)) \le O(C\delta)$, and hence the same bound holds for $\mu$ and all $\gamma\in\mathcal{P}_k$. The proof then finishes as in the case of lines. Take $h(t)=t^\beta$ with $\beta>d-1$. Then the random measure $\mu$ satisfies $\mu(T)=\Theta(\mathcal{H}^\beta(T\cap A))$ for any Borel set $T$. In the proof of Theorem \[thm:gauge-main-result\] we observed that (as an easy consequence of Theorem \[thm:main-technical-result\]) $\sup_T \mu(T)/w(T)^{d-1}<\infty$ where the supremum is over all tubes in ${\mathbb{R}}^d$. Likewise, in the proof of Theorem \[thm:polynomial\], the same was proved for tubes around algebraic curves in ${\mathbb{R}}^2$. The theorem follows. We consider first the case of lines in $\mathbb{R}^d$. By Theorem \[thm:main-technical-result\] and Fubini, there exists $C>0$ and a realization of the random set $A$ such that $\mu_n(\gamma(\delta)) \le C\delta$ for all $\delta>0,n\in\mathbb{N}$ and all lines $\gamma$. In particular, this holds for $\delta:=\sqrt{d}\cdot 2^{-n}$. Since any chosen cube in $A_n$ which intersects $\gamma$ is then contained in $\gamma(\delta)$, it follows from the definition of $\mu_n$ that $\gamma$ can intersect at most $O(2^{-n}/h(2^{-n}))$ such cubes. From here the theorem follows easily. The situation for algebraic curves is identical, using the proof of Theorem \[thm:polynomial\] instead. Proof of Theorem \[thm:convex\] \[sec:proofs2\] =============================================== Initial reductions ------------------ The proof of Theorem \[thm:convex\] follows once again a similar pattern. However, bounding the number of $D$-balls of radius $\delta$ needed to cover $\mathcal{C}$ is more delicate (and the bound is much larger than for the case of $\mathcal{P}_k$). We start with some notation and reductions. Abusing notation slightly, we will sometimes identify functions $f:[0,1]\to[0,1]$ with their graphs. We denote by $\mathcal{C}^+$ the subset of $\mathcal{C}$ consisting of non-decreasing functions with right derivative bounded above by $1$. We note that since every curve in $\mathcal{C}$ is the union of at most four curves which are obtained from a curve in $\mathcal{C}^+$ by a possible $\pi/2$ rotation and/or a reflection, it is enough to prove Theorem \[thm:convex\] for $\mathcal{C}^+$ instead of $\mathcal{C}$. (To be more precise, an arbitrary $f\in\mathcal{C}$ is the union of such four curves defined on some interval $[a,b]$ rather than $[0,1]$; by continuing them linearly to the left of $a$ and the right of $b$, there is no harm in assuming they are defined on all of $[0,1]$.) Bounding the size of $\mathcal{C}^+$ ------------------------------------ \[prop:dim-convex-functions\] For every $0<\delta<1$, $\mathcal{C}^+$ contains a $\delta$-dense subset (in the Hausdorff metric $D$) with $\exp(O(\delta^{-1/2}|\log\delta|))$ elements. The idea of the proof of Proposition \[prop:dim-convex-functions\] is to associate to each $f\in\mathcal{C}^+$ a finite collection of numbers, in such a way that knowing each of these numbers with an error up to $\delta$ allows to construct a piecewise affine approximation which is within distance $O(\delta)$ of $f$. The problem is then reduced to a counting problem in a much more straightforward space. Of course, this can be done with any continuous function; the trick is to exploit the convexity and monotonicity of $f$ to show that, in essence, $\exp(O(\delta^{-1/2}|\log\delta|))$ numbers suffice to reconstruct $f$ up to error $O(\delta)$. From now on, we assume that $\delta^{-1/2}$ is an integer $N$ (for simplicity of notation). Let us first define the parameter space. Let $X=\{0,\frac{1}{N^{2}},\ldots,\frac{N^{2}-1}{N^{2}},1\}$ and let $\Lambda$ be the family of all increasing functions $f\colon Y\rightarrow X$, where $Y\subset X$ has at most $2N+1$ elements. It is straightforward to check that $\#\Lambda \le N^{O(N)}$. We reduce the proof of Proposition \[prop:dim-convex-functions\] to the following: \[prop:P\] There is a mapping $P\colon\mathcal{C}^+\rightarrow\Lambda$ such that if $f,\widetilde{f}\in\mathcal{C}^+$ and $P(f)=P(\widetilde{f})$, then $D(f,\widetilde{f})=O(N^{-2})$. This indeed implies Proposition \[prop:dim-convex-functions\]: the needed $O(\delta)$-dense collection in $\mathcal{C}^+$ is obtained by choosing one element from $P^{-1}(\lambda)$ for each $\lambda\in P(\mathcal{C}^+)$. To define the projection $P$, we fix $f\in\mathcal{C}^+$. We first construct $Y=Y_f$ inductively as follows: Let $x_0=0$. If $x_k<1$ is defined, let $$x_{k+1}=\min\left\{1,x_k+\frac1N,\inf\{x\in X\,:\,x_k<x\,, f'(x^+)\ge f'(x_k^+)+\tfrac1N\}\right\}\,.$$ We stop the construction when $x_k=1$, and set $Y=\{x_0,x_1,x_2,\ldots, x_k\}$. \[lem:Y\] For each $f\in\mathcal{C}^+$, the set $Y_f$ satisfies $$\begin{gathered} \label{Nbound}\#Y\le 2N+1,\\ \label{1N} \frac{1}{N^2}<x_{i}-x_{i-1}\le\frac{1}{N}\text{ for each }0<x_i\in Y.\end{gathered}$$ In addition, for each $0<x_{i}\in Y$, we have $$\begin{gathered} \label{ab}|f'(t)-\frac{f(\widetilde{x}_i)-f(x_{i-1})}{\widetilde{x}_{i}-x_{i-1}}|=O(1/N)\text{ for }x_{i-1}\le t\le \widetilde{x}_i\,,\end{gathered}$$ where $\widetilde{x}_i=x_i-N^{-2}$. The first claim follows directly from the construction of $Y$ since $0\le f'(t^+)\le 1$ is non-decreasing by convexity. The claim is also clear. The last claim follows from and the fact $f'(x^+_{i-1})\le f'(t^+)\le f'(\widetilde{x}_{i}^+)\le f'(x^+_{i-1})+N^{-1}$ for all $x_{i-1}<t<\widetilde{x}_i$. We may now complete the definition of $p=P(f)$. For each $x\in Y$, we let $p(x)=\frac{k-1}{N^{2}}$, where $k\in{\mathbb{N}}$ and $\frac{k-1}{N^{2}}\le f(x)<\frac{k}{N^{2}}$. Given $f\in\mathcal{C}^+$, we extend $p=P(f)$ to $[0,1]$ by interpolating it linearly between the points of $Y_f$. For notational convenience, we denote the extension also by $p$. See Figure \[fig:convex-approximation\] for an illustration. ![The graphs of $f$ and $p=P(f)$ for $f(x)=x^3/3$, $N=5$. In this case, $Y_f=\{0,\frac{5}{25},\frac{10}{25},\frac{15}{25},\frac{19}{25},\frac{23}{25},1\}$.[]{data-label="fig:convex-approximation"}](convexapprox.eps){width="90.00000%"} The claims of the following lemma are simple consequences of the definitions. For $f\in\mathcal{C}^+$, $p=P(f)$, and $Y=Y_f$ it holds $$\begin{gathered} \label{hdef} |p(x)-f(x)|=O(N^{-2})\text{ for all }x\in Y\,,\\ \label{h'} p'(t)=O(1)\text{ for all }0< t< 1\,,t\notin Y\,.\end{gathered}$$ We claim that for each $f\in\mathcal{C}^+$, the (extended) projection $p=P(f)$ satisfies $$\label{eq:finalclaim} |p-f|_\infty=O(N^{-2})\,.$$ This implies the claim since if $f,\widetilde{f}\in\mathcal{C}^+$ and $p=P(f)=P(\widetilde{f})$, then $$D(f,\widetilde{f})=O(|f-\widetilde{f}|_\infty)=O\left(|f-p|_\infty+|\widetilde{f}-p|_\infty\right)=O(N^{-2})\,.$$ In short, the estimate holds because $Y=Y_f$ has been constructed so that the variance of $f'$ on each interval $[x_{i-1},x_i-O(N^{-2})]$ is at most $O(N^{-1})$ and $p|_{[x_{i-1},x_i]}$ is an affine map with $|p(x_k)-f(x_k)|=O(N^{-2})$ for $k=i-1,i$. For the reader’s convenience, we provide a detailed proof. Let $0\le t\le 1$ and choose $i$ such that $x_{i-1}\le t\le x_{i}$. Set $\widetilde{x}_i=x_i-N^{-2}$. If $t>\widetilde{x}_{i}$, then $|t-x_i|<N^{-2}$ and it follows using , , and $0\le f'(x^+)\le 1$, that $$\begin{aligned} |p(t)-f(t)|&\le|p(t)-p(x_{i})|+|p(x_{i})-f(x_{i})|+|f(x_{i})-f(t)|\\ &\le 3\times O(N^{-2})=O(N^{-2}).\end{aligned}$$ It remains to consider the case $x_{i-1}\le t\le \widetilde{x}_i$. Write $$\label{ht} \begin{split} p(t)&=p(x_{i-1})+(t-x_{i-1})\frac{p(x_{i})-p(x_{i-1})}{x_{i}-x_{i-1}}\\ &=f(x_{i-1})+\bigl(p(x_{i-1})-f(x_{i-1})\bigr)+\\ &+(t-x_{i-1})\frac{f(\widetilde{x}_i)-f(x_{i-1})+\bigl(p(x_i)-f(\widetilde{x}_{i})+f(x_{i-1})-p(x_{i-1})\bigr)}{\widetilde{x}_i-x_{i-1}+N^{-2}}\,. \end{split}$$ Using , the definition of $p$, $x_{i-1}\le t\le x_i$ and $0\le f'(x^+)\le 1$, we estimate $$\begin{aligned} |p(x_{i-1})-f(x_{i-1})| &= O(N^{-2})\,,\\ |p(x_{i})-f(\widetilde{x}_i)| &= O(N^{-2})\,,\\ \left|\frac{t-x_{i-1}}{x_{i}-x_{i-1}}\right| &\le 1\,.\end{aligned}$$ We deduce from that $$\label{eq:eps1} \left|p(t) - f(x_{i-1}) - (t-x_{i-1})\frac{f(\widetilde{x}_i)-f(x_{i-1})}{\widetilde{x}_i-x_{i-1}+N^{-2}} \right| = O(N^{-2}).$$ Also, using $x_i-x_{i-1}\ge 2 N^{-2}$, $x_i\le t\le x_{i+1}$ and $0\le f'(x^+)\le 1$, we have $$\begin{aligned} \left|\frac{1}{\widetilde{x}_i-x_{i-1}}-\frac{1}{x_{i}-x_{i-1}}\right| &=O(N^{-2}|x_{i}-x_{i-1}|^{-2})\,,\label{eq:eps2}\\ \left|(t-x_{i-1})(f(\widetilde{x}_i)-f(x_{i-1}))\right| &= O(|x_i-x_{i-1}|^2)\,.\label{eq:eps3}\end{aligned}$$ Combining the estimates –, we conclude that $$\left|p(t)-f(x_{i-1})-(t-x_{i-1})\frac{f(\widetilde{x}_{i})-f(x_{i-1})}{\widetilde{x}_i-x_{i-1}}\right|=O(N^{-2})\,.$$ Since, on the other hand and yield that $$\left|f(t)-f(x_{i-1})-(t-x_{i-1})\frac{f(\widetilde{x}_{i})-f(x_{i-1})}{\widetilde{x}_i-x_{i-1}}\right|=O(N^{-2})\,,$$ we have shown that holds. It follows from the previous proposition that if $N(\delta)$ is the minimum number of balls of radius $\delta$ needed to cover $\mathcal{C}^+$ in the Hausdorff metric, then $\log N(\delta) = O(\delta^{-1/2}|\log\delta|)$. This is close to being sharp: $\log N(\delta) =\Omega(\delta^{-1/2})$. Indeed, suppose again $N=\delta^{-1/2}$ is an integer. Set $$\Delta = \{ (a_1,\ldots, a_N)\, :\, a_i\in\{0,\tfrac1N,\ldots,1\},\, 0\le a_1\le \cdots \le a_N\le N \}.$$ Then $\log\#\Delta=\Omega(N)$. Given $a=(a_1,\ldots,a_N)\in\Delta$, let $L_a$ be the piecewise affine function satisfying $L_a(0)=0$ and $L_a'(t)=a_i/N$ for $(i-1)/N<t<i/N$. It is clear that $L_a\in\mathcal{C}^+$, and if $a\neq b\in\Delta$, then $D(L_a,L_b)= \Omega(1/N^2)$. In particular, $(\mathcal{C}^+,D)$ has infinite box dimension, and is very far from being a doubling metric space (recall that a metric space is doubling if each ball can be covered by a uniformly bounded number of balls of half the radius). Completion of the proof of Theorem \[thm:convex\] ------------------------------------------------- The proof of Theorem \[thm:convex\] now follows the usual pattern, with minor variations. We still use the construction from Section \[sec:notation-and-construction\], but we now assume that $h(t)=t^\beta$ for some $\beta\in (5/3,2)$. As before, we ignore the elements of $\mathcal{C}^+$ whose graphs contain nontrivial dyadic line segments, but for simplicity of notation, we still denote the new slightly smaller collection by $\mathcal{C}^+$. Lemma \[lem:large-deviation\] holds for curves $\gamma\in\mathcal{C}^+$, as there is a uniform upper bound for the ratio $\mathcal{H}^1(\gamma\cap Q)/{\text{diam}}(Q)$ (namely $2$) for all dyadic squares $Q$. The needed analog of Lemmas \[lem:many-lines-to-all-lines\] and \[lem:many-algebraic-to-all-algebraic\] is now the following. \[lem:many-convex-to-all-convex\] Let $1<\eta<4$. For each $n$, there is a family of curves $\mathcal{C}_{n}\subset\mathcal{C}^+$, such that $\log\#\mathcal{C}_{n} = O(n 2^{\eta n/2})$ and, for any realization of $A$, $$\sup_{\gamma\in \mathcal{C}^+}Y^{\gamma}_n\le\sup_{\gamma\in \mathcal{C}_{n}}Y^{\gamma}_n + O(2^{(3-\beta-\eta) n}).$$ Let $\delta=2^{-\eta n}$. We apply Proposition \[prop:dim-convex-functions\] to obtain a $\delta$-dense family $\mathcal{C}'_n\subset\mathcal{C}^+$ such that $\log\#\mathcal{C}'_n= O(n 2^{\eta n/2})$. We will modify $\mathcal{C}'_n$ in the same fashion as in the argument of Lemma \[lem:many-algebraic-to-all-algebraic\]. If $f\in\mathcal{C}'_n$, let $(0,b]$ be the interval on which $f'(x^+)<2^{-n-1}$. If there is $k\in{\mathbb{N}}$ such that $|f(t)-k 2^{-n}|<2^{-\eta n+1}$ for some $0\le t\le b$, we choose for each $0\le i 2^{-n\eta}\le b$, $i\in{\mathbb{N}}\cup\{0\}$, numbers $y_i$ such that the function $f_i(x)=f(x)+y_i$ crosses the horizontal line $y=k 2^{-n}$ at $x_i=i 2^{-n\eta}$. Let $\mathcal{E}_f$ be the collection of all $f_i$ and set $$\mathcal{C}_n=\mathcal{C}'_n\cup\bigcup_{f\in\mathcal{C}'_n}\mathcal{E}_f\,.$$ Since each $\mathcal{E}_f$ has at most $O(2^{n\eta})$ elements, it follows that $\log\#\mathcal{C}_n= O(n 2^{\eta n/2})$. Let $\gamma\in\mathcal{C}^+$. We claim that there is $\widetilde{\gamma}\in\mathcal{C}_n$ such that $$\label{Qsum} \sum_{Q\in\mathcal{D}_n}\mathcal{H}^1(\gamma\cap Q)\le\mathcal{H}^1(\widetilde{\gamma}\cap Q)+O(2^{n(1-\eta)})\,.$$ This implies the claim since then $$\begin{aligned} Y_n^\gamma&=4^n P_n^{-1}\mathcal{H}^1(\gamma\cap A_n)\le 4^n P_n^{-1}\left(\mathcal{H}^1(\widetilde{\gamma}\cap A_n)+ O(2^{n(1-\eta)}\right)\\ &=Y_n^{\widetilde{\gamma}}+P_n^{-1}O(2^{n(3-\eta)})=Y_n^{\widetilde{\gamma}}+O(2^{n(3-\beta-\eta)})\,,\end{aligned}$$ recall that $P_n=\Theta(2^{n\beta})$. To prove , fix $f\in\mathcal{C}^+$ and let $\gamma$ be the graph of $f$. We first choose $f^*\in\mathcal{C}'_n$ which is $\delta$-close to $f$. If $\mathcal{E}_{f^*}=\emptyset$, we let $\widetilde{f}=f^*$. Otherwise, there is $k\in{\mathbb{N}}$ and $0<t<b$ such that $|f^*(t)-k 2^{-n}|<2^{-\eta n+1}$, where $b=\sup\{x\,:\,f^*(x^+)<2^{-n-1}\}$. Denote $$a=\sup\{x\,:\,f(x)\le k 2^{-n}\}\,,$$ with the convention $a=0$ if $f(0)>k 2^{-n}$. It follows from the construction of $\mathcal{E}_{f^*}$ that we may choose $f^*_i\in\mathcal{E}_{f^*}$ and $0\le x_i=i 2^{-n\eta}\le b$ with $f^*_i(x_i)=k 2^{-n}$ such that $$\label{cases} |x_i-a|\le\begin{cases} O(2^{-n\eta})\text{ if }a\le b\\ O(2^{n(1-\eta)})\text{ if }a>b\,. \end{cases}$$ Let $\widetilde{f}=f^*_i$. We first assume that $a>b$. Let $\gamma^1$, $\widetilde{\gamma}^1, \gamma^2$, and $\widetilde{\gamma}^2$ be the graphs of $f_{[0,x_i]}$, $\widetilde{f}_{[0,x_i]}$, $f_{[a,1]}$, and $\widetilde{f}_{[a,1]}$, respectively. It then follows that $$\label{gest2} \mathcal{H}^1(Q\cap\gamma^1)\le \mathcal{H}^1(Q\cap\widetilde{\gamma}^1)+O(2^{-\eta n})\text{ for all }Q\in\mathcal{D}_n.$$ Recall that by Lemma \[lem:convex\], it is enough to bound the Hausdorff distance of $\gamma^i\cap Q$ and $\widetilde{\gamma}^i\cap Q$ in order to estimate the difference $\mathcal{H}^1(\gamma^i\cap Q)-\mathcal{H}^1(\widetilde{\gamma}^i\cap Q)$. Let $I\subset[a,1]$ be the set where the distance of $\widetilde{\gamma}$ is at least $2^{-n\eta}$ to all dyadic lines $y= j 2^{-n}$. Then $$\label{gest3} \mathcal{H}^1(\gamma_{2}|_I\cap Q)\le\mathcal{H}^1(\widetilde{\gamma}_2\cap Q)+O(2^{-n\eta})\text{ for all }Q\in\mathcal{D}_n.$$ Since the derivative of $\widetilde{f}$ is at least $2^{-n-1}$ on $[a,1]$ it follows that $|[a,1]\setminus I|=O(2^{n(1-\eta)})$. Combining with , and , and taking into account that each $\gamma$ intersects at most $O(2^n)$ squares in $\mathcal{D}_n$ yields in the case $a>b$. If $a\le b$, we can repeat the above argument with $[0,x_i]$ and $[a,1]$ replaced by $[0,b]$ and $[b,1]$. We follow the proof of Theorem \[thm:main-technical-result\]. Let $$\begin{aligned} M_n &= \sup_{\gamma\in\mathcal{C}^+} Y_n^\gamma.\end{aligned}$$ Pick any $\eta\in (3-\beta,2(\beta-1))$; note the interval in question is nonempty thanks to our assumption that $\beta>5/3$. It will be enough to show that $$\label{eq:borel-cantelli-2} \sum_{n=1}^\infty {\mathbb{P}}\left(M_{n+1}-M_n>n^{-2}\sqrt{M_n}+ 2^{(3-\beta-\eta)n}\right) <\infty.$$ Indeed, thanks to Borel-Cantelli this implies that $\sup_{n\in\mathbb{N},\gamma\in\mathcal{C}^+} Y_n^\gamma<\infty$ almost surely, and from here the proof can be finished exactly as in the proof of Theorem \[thm:polynomial\]. From now on, fix $n$ and condition on $A_n$. Pick $\gamma\in\mathcal{C}^+$. Recall that under our assumptions, $P_n=\Theta(2^{n\beta})$. Lemma \[lem:large-deviation\] (applied to curves in $\mathcal{C}^+$) yields that $${\mathbb{P}}\left(Y_{n+1}^\gamma - Y_n^\gamma > n^{-2}\sqrt{Y_n^\gamma}\right) \le O(1) \exp(-\Omega(n^{-4}2^{(\beta-1)n})).$$ Let $\mathcal{C}_n$ be the family given by Lemma \[lem:many-convex-to-all-convex\], with this $\eta$. Then $$\begin{aligned} {\mathbb{P}}\left(\max_{\gamma\in \mathcal{C}_n} Y_{n+1}^\gamma - M_n \ge \frac{\sqrt{M_n}}{n^2} \right) &\le O(1) \exp(O(n 2^{\eta n/2})-\Omega(n^{-4}2^{(\beta-1)n}))\\ &=O(1)\exp(-\Omega(2^{n\eta'}))\end{aligned}$$ for any $0<\eta'<\beta-1$ (here we use that $\eta<2(\beta-1)$). This implies and finishes the proof. Generalizations =============== We finish the paper by sketching some generalizations of the results in Section \[sec:introduction\]. In $\mathbb{R}^d$, $d>2$, Theorem \[thm:non-tube-null\] can be generalized by considering tubes around planes rather than lines. For $k\in\{1,\ldots,d-1\}$, denote the Grassmannian of $k$-planes in $\mathbb{R}^d$ by $G(d,k)$. A [*$G(d,k)$-tube*]{} $T$ of width $w=w(T)$ is, as usual, a $w$-neighbourhood of a plane $V\in G(d,k)$. We say that $A\subset\mathbb{R}^d$ is $G(d,k)$-tube null if for every $\delta>0$ one can find countably many $G(d,k)$-tubes $T_i$ covering $A$ with $\sum_i w(T_i)^{d-k}<\delta$. The proof of Theorem \[thm:gauge-main-result\] extends to this setting to give: \[thm:plane-tube-null\] Let $h:(0,\infty)\to (0,\infty)$ be continuous and non-decreasing such that $h(2t)\le 2^d h(t)$, and $$\int_0^1 t^{-1}\sqrt{t^{k-d}|\log(t)| h(t)}\,dt<+\infty.$$ Then almost surely the set $A$ constructed in Section \[sec:notation-and-construction\] has no $G(d,k)$-tube null subsets of positive $\mathcal{H}^h$-measure. In particular, there exist non $G(d,k)$-tube null sets of Hausdorff and box counting dimension $d-k$. The latter claim is obtained by taking e.g. $$h(t)=t^{d-k}|\log t\log|\log t||^{-3}.$$ Again, it is easy to see that the dimension threshold $d-k$ is sharp: any set $E\subset\mathbb{R}^d$ of dimension strictly less than $d-k$ is necessarily $G(d,k)$-tube null, since any particular orthogonal projection onto a $(d-k)$-dimensional subspace has zero $(d-k)$-dimensional Lebesgue measure. As our main goal was to prove the existence of sets of small dimension that are not tube-null, we focused on a simple model that achieved this purpose. But it is possible to prove that many other sets arising from random models are not tube null (provided they are of sufficiently large dimension). This is true for a large class of repeated subdivision fractals; the key feature that must be present in the construction is that, conditioning on the $n$-th level, each surviving point has the same probability of surviving to the next level (and the partition elements should be regular enough that the combinatorial Lemma \[lem:many-lines-to-all-lines\] can be carried through; but this is a mild condition). Thus, for example, classical fractal percolation limit sets with constant probabilities (see e.g. [@RamsSimon11]) are almost surely not-tube null when they have dimension strictly larger than $1$. The main difference between the families $\mathcal{C}$ and $\mathcal{P}_k$ is their size: We have seen that the number of $\delta$-balls needed to cover $\mathcal{C}$ is $\exp(\Omega(\delta^{-1/2}))$ whereas for $\mathcal{P}_k$ only $\exp(O(|\log\delta|^2))$ such balls are needed. Theorem \[thm:polynomial\] can be generalized to many other curve families satisfying such bounds. For instance, if $\mathcal{F}$ is a collection of curves in ${\mathbb{R}}^2$ such that for $0<\delta<1$ it can be covered by $\exp(O(|\log \delta|^{O(1)}))$ balls of radius $\delta$ (in the $D$ metric), and if each $\mathcal{F}$ is contained in a union of $O(1)$ curves in $\mathcal{C}$, then the proofs of Theorem \[thm:polynomial\] and Lemma \[lem:many-convex-to-all-convex\] can be combined to show the existence of non $\mathcal{F}$-tube null sets of dimension $1$. Regarding higher dimensions, it seems likely that our methods can be used to prove results for algebraic curves and surfaces in ${\mathbb{R}}^d$ in the spirit of Theorem \[thm:plane-tube-null\]. We finish this discussion with a generalization in a different direction. Our proof of Theorem \[eq:growth-h\] reveals that all orthogonal projections of the random measure $\mu$ onto lines are absolutely continuous, with a density bounded by some uniform random constant. It is natural to ask if the projections may enjoy any additional regularity. Away from the coordinate projections, one may use the method of Y. Peres and M. Rams in [@PeresRams11] to prove that projections have a Hölder continuous density (Peres and Rams prove this fact for projections of the natural measure on fractal percolation). However, the dyadic nature of the construction makes a discontinuity in the coordinate projections unavoidable. In a forthcoming work [@ShmerkinSuomala2012], we address this issue by studying intersection properties of a different class of random measures, generated by removing a “random soup” consisting of countably many shapes generated by a Poisson point process, see e.g. [@NacuWerner11] for the description of this model. In particular, we show the existence of measures of dimension $1$ in $\mathbb{R}^2$, all of whose orthogonal projections onto lines are absolutely continuous, with a continuous density. [^1]: P.S. acknowledges support from a Leverhulme Early Career Fellowship. V.S was partly supported by the Academy of Finland project \#126976.

Down syndrome genetics: unravelling a multifactorial disorder. Down syndrome is a common disorder affecting many tissues both during development and later on in adult life; the principle feature of all cases is a specific form of mental retardation, which is combined with a range of variable traits. Down syndrome is an aneuploidy syndrome that is caused by trisomy for human chromosome 21. While the phenotype is most likely due to a subtle increase in gene dosage of only a small minority of the estimated 500-800 genes that are present on this chromosome, the molecular genetics of Down syndrome remains speculative. However, recent advances on a number of fronts, including chromosome studies, gene identification and mouse modelling, are giving us the tools to dissect this multifactorial gene dosage disorder.

Nebraska Supreme Court Online Library www.nebraska.gov/apps-courts-epub/ 07/17/2020 08:07 AM CDT - 108 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 Allen D. Acklie, appellant, v. Greater Omaha Packing Co., Inc., a Nebraska corporation, appellee. ___ N.W.2d ___ Filed June 12, 2020. No. S-18-1128. 1. Contracts: Appeal and Error. The construction of a contract is a mat- ter of law, in connection with which an appellate court has an obligation to reach an independent, correct conclusion irrespective of the determi- nations made by the court below. 2. Jury Instructions: Appeal and Error. Whether jury instructions are correct is a question of law, which an appellate court resolves indepen- dently of the lower court’s decision. 3. Contracts. In interpreting a contract, a court must first determine, as a matter of law, whether the contract is ambiguous. 4. ____. A contract written in clear and unambiguous language is not sub- ject to interpretation or construction and must be enforced according to its terms. 5. ____. A contract is ambiguous when a word, phrase, or provision in the contract has, or is susceptible of, at least two reasonable but conflicting interpretations or meanings. 6. ____. The determination of whether a contract is ambiguous is to be made on an objective basis, not by the subjective contentions of the par- ties suggesting opposing meanings of the disputed language. 7. ____. A contract must receive a reasonable construction and must be construed as a whole, and if possible, effect must be given to every part of the contract. 8. Contracts: Proof. A party seeking to enforce a contract has the burden of establishing the existence of a valid, legally enforceable contract. 9. Contracts. To create a contract, there must be both an offer and an acceptance; there must also be a meeting of the minds or a binding mutual understanding between the parties to the contract.  - 109 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 10. ____. It is a fundamental rule that in order to be binding, an agreement must be definite and certain as to the terms and requirements. It must identify the subject matter and spell out the essential commitments and agreements with respect thereto. 11. ____. Generally, mutuality of obligation is an essential element of every enforceable contract and consists in the obligation on each party to do, or permit something to be done, in consideration of the act or promise of the other. Mutuality is absent when only one of the contracting parties is bound to perform, and the rights of the parties exist at the option of one only. 12. ____. An agreement which depends upon the wish, will, or pleasure of one of the parties is illusory and does not constitute an enforce- able promise. Appeal from the District Court for Douglas County: Leigh Ann Retelsdorf, Judge. Affirmed. Ari D. Riekes and Steven J. Riekes, of Marks, Clare & Richards, L.L.C., for appellant. Michael F. Coyle, Robert W. Futhey, and Brian J. Fahey, of Fraser Stryker, P.C., L.L.O., for appellee. Heavican, C.J., Miller‑Lerman, Cassel, Stacy, Funke, Papik, and Freudenberg, JJ. Funke, J. Allen D. Acklie brought this breach of contract action against Greater Omaha Packing Co., Inc. (Greater Omaha). The matter was tried, and the jury returned a verdict in favor of Greater Omaha. Acklie appeals, arguing that errors by the district court necessitate a new trial. Because we determine that Acklie’s action is based on an unenforceable contract, we affirm the judgment. BACKGROUND Acklie began working for Greater Omaha as a corporate controller in 1986. Acklie was part of Greater Omaha’s senior management team and was responsible for supervising the cor- poration’s financial accounts and managing office staff.  - 110 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 In 1989, the parties purported to enter into a deferred com- pensation agreement (the agreement). The agreement provides that in addition to a monthly salary, the company shall pay Acklie deferred compensation. The agreement further pro- vides that Greater Omaha would establish a general ledger account and that the account would be funded at the discre- tion of Greater Omaha’s board of directors. The agreement does not contemplate Acklie’s contributing any amount of his salary to the deferred compensation account. Greater Omaha entered into similar deferred compensation agreements with other members of the senior management team. In 1994, Greater Omaha terminated Acklie’s employment, and in 2006, Acklie turned 60 years old. In 2011, Acklie demanded payment from Greater Omaha under the terms of the agreement. He contended that his right to deferred com- pensation vested upon his attaining age 60 and that payment became due on the first day of the first month following his attaining age 61. The agreement’s vesting provision, paragraph 6, provides: The Employee’s Deferred Compensation Account shall be one hundred percent (100%) vested upon and after the earlier of his completing ten (10) consecutive years of service commencing the date first above written or his attaining age Sixty (60), so long as he does not violate [the agreement’s covenant not to compete provision], or if he terminates as a result of death. Greater Omaha refused payment. As a result, in May 2012, Acklie filed this action against Greater Omaha in the dis- trict court for Douglas County, asserting claims of breach of contract and violation of the Nebraska Wage Payment and Collection Act, see Neb. Rev. Stat. § 48-1228 et seq. (Reissue 2010, Cum. Supp. 2018 & Supp. 2019). Acklie alleged that Greater Omaha breached the agreement by failing to pay him the amounts due to him. Acklie alleged that at the time of his firing in June 1994, the value of his interest in the account was $18,574.92.  - 111 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 Greater Omaha moved to dismiss the complaint, argu- ing that Acklie’s rights under the agreement had not vested, because his employment with the company ended prior to his turning age 60. The court overruled the motion to dismiss, finding that the language of paragraph 6 is unambiguous and does not require that Acklie be employed with Greater Omaha at the time he turned 60 in order to become fully vested. The court stated that paragraph 6 has no “language limiting the receipt of the deferred compensation to employees who were still employed when they turned the specified age, nor was there a provision specifying that an employee is not entitled to any pension not accrued prior to termination.” Greater Omaha filed an answer. Acklie then moved for summary judgment. The court granted Acklie’s motion for summary judgment with respect to Greater Omaha’s liability for breach of contract and viola- tion of the Nebraska Wage Payment and Collection Act. The court found that “the language vesting [Acklie’s] deferred compensation is unambiguous,” that a valid and enforceable contract exists between the parties, and that as a matter of law, Acklie was entitled to an amount equal to the fair mar- ket value of “the assets placed in the [account] as deferred compensation to [Acklie].” The court found that based on Acklie’s claim, pursuant to § 48-1231, he is entitled to costs and attorney fees not less than 25 percent of the damages to be determined at trial. The court found genuine issues of material fact regarding the amount of Acklie’s damages. Acklie claimed that under the agreement, he is entitled to the fair market value of the assets in his deferred compensation account as of October 1, 2007, the first day of the first month following his turn- ing age 61. Evidence adduced at the hearing showed that Greater Omaha established a single investment account for deferred compensation for all eligible employees and used the account to pay multiple employees pursuant to several  - 112 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 separate deferred compensation agreements. The court noted that an account record in evidence, dated December 31, 1993, lists contributions made in 1989 and 1990 for six employees, including Acklie, as well as their salaries and percent of distri- bution. The account record indicated that the total value of the account was $97,170.16 and that Acklie’s share of distribution was $18,574.92. In a letter dated December 31, 2015, Greater Omaha stated that, as of September 2007, the fair market value of the total assets in the account was $98,130.63. Because the 2007 valuation did not itemize the asset distribution for each employee, there was no evidence of the value of Acklie’s general ledger account and there was a triable issue of fact regarding damages. Prior to the trial on Acklie’s damages, the court conducted a bench trial on Greater Omaha’s counterclaim for reforma- tion based on mutual mistakes made in the agreement. Greater Omaha asked that the court reform the agreement’s covenant not to compete provision, which prohibits working in the meatpacking business “within any of the restricted areas,” to add a schedule specifying that the provision includes Omaha and Douglas County, Nebraska. In addition, Greater Omaha asked that the court reform the vesting provision to make clear that an employee vests upon attaining age 60 only if the employee is still working at the company. The court found that Greater Omaha failed to prove that there was a mutual mistake and dismissed its counterclaim. At the trial on Acklie’s damages, prior to the opening of evidence, the court and parties’ counsel discussed the scope of trial. They recognized that in disposing of Greater Omaha’s motion to dismiss and Acklie’s motion for summary judg- ment, the court determined that under the unambiguous mean- ing of paragraph 6, Acklie’s right had vested. Consequently, Greater Omaha could not present evidence that Acklie had not vested. However, the court considered how another provi- sion of the agreement, paragraph 11, affected the evidence.  - 113 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 Paragraph 11, referred to by Greater Omaha as the “discretion- ary provision,” 1 provides: Company’s powers and liabilities. The Company shall have full power and authority to interpret, and administer [the] [a]greement. The Company’s interpretations and construction of any provision or action taken under [the] [a]greement, including any valuation of the Deferred Compensation Account, or the amount of recipient of the payment due under it, shall be binding and conclusive on all persons for all purposes. No member of the Board shall be liable to any person for any action taken or omit- ted in connection with the interpretation and administra- tion of [the] [a]greement unless attributable to the mem- ber’s willful misconduct or lack of good faith. The court found paragraph 11 to be ambiguous when con- strued with other provisions within the agreement, such as paragraph 4, which provides for the creation of a deferred compensation account into which Greater Omaha may dis- tribute funds, and paragraph 7, which establishes the terms of the benefits to be paid as deferred compensation. In ruling on Acklie’s motion for summary judgment, the court found that pursuant to paragraph 7, Greater Omaha must pay Acklie the fair market value of the assets in his deferred compensation account as of the first day of the first month following his attaining age 61. The court determined that because paragraph 11 conflicts with the terms of paragraphs 4 and 7, the meaning of paragraph 11 is ambiguous and is therefore a question of fact for the jury. Greater Omaha argued that it should be permitted to present evidence that paragraph 11 gave it the discretion to eliminate deferred compensation for employees who left the company prior to attaining age 60 or retiring, so long as the company did not act in bad faith. The court agreed, stating that Greater 1 Brief for appellee at 1.  - 114 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 Omaha could suggest that Acklie is “entitled to zero, but you can’t suggest he’s not entitled.” Acklie’s counsel stated that the court’s ruling conflicted with its prior determination that Acklie had vested. Acklie’s counsel argued that if paragraph 11 were interpreted to contradict payment terms of the agree- ment, then the agreement would be unenforceable, but claimed the agreement is enforceable due to the duty of good faith and fair dealing. The court stated that the issue of vesting would not be relitigated. Trial evidence showed that Greater Omaha contributed $50,083.23 to the account in 1989 and $26,000 in 1991. Greater Omaha maintained the investments in the account, but made no other contributions. Thereafter, Greater Omaha switched to a 401K compensation plan. The parties stipu- lated that on September 19, 2007, the account balance was $98,130.67, and that as of July 2018, the account balance was $195,274.32. Based on his calculation of the account’s rate of growth between those two dates, Acklie testified that at the time of trial, the value of his share was $119,336.86. Greater Omaha’s president testified that on September 1, 1989, he held an office meeting with several employees, including Acklie, and presented them with identical deferred compensation agreements to sign and return. Greater Omaha’s president testified that Acklie’s account was reduced to zero because he left the company prior to vesting and that in addi- tion to Acklie, the company had eliminated deferred compen- sation for two other employees who left the company prior to vesting. Greater Omaha’s president stated that under the agree- ment, this was a matter of the company’s discretion. At the jury instruction conference, Acklie lodged an objec- tion to the court’s statement of the case and damages jury instructions, but the court found no merit to Acklie’s proposed instructions. The court instructed the jury that as a matter of law, Acklie’s deferred compensation rights under the agree- ment had vested. The court instructed the jury that “[v]esting  - 115 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 creates a contractual right that may be upheld by law. A vested right is fixed, settled, absolute, and not contingent upon any- thing.” The court instructed the jury that Acklie carried the burden to prove (1) that Greater Omaha breached the agree- ment by failing to pay Acklie the amount due under the agree- ment, (2) that the breach of contract was a proximate cause of some damage to Acklie, and (3) the nature and extent of that damage. The court instructed the jury that “[i]f you find in favor of Acklie on his claim for breach of contract, then you must determine the amount of Acklie’s damages. Acklie is entitled to recover the amount of money in the deferred com- pensation account to which he was entitled . . . .” The jury returned a verdict in favor of Greater Omaha. The district court entered judgment on the verdict, and later overruled Acklie’s motion for new trial. Acklie appealed. We moved the appeal to our docket pursuant to our statutory authority to regulate the caseloads of the appellate courts of this state. 2 ASSIGNMENTS OF ERROR Acklie assigns that the district court erred in (1) finding ambiguity in the agreement, (2) refusing proposed jury instruc- tions, and (3) giving confusing, conflicting jury instructions. STANDARD OF REVIEW [1,2] The construction of a contract is a matter of law, in connection with which an appellate court has an obligation to reach an independent, correct conclusion irrespective of the determinations made by the court below. 3 Whether jury instructions are correct is a question of law, which an appellate court resolves independently of the lower court’s decision. 4 2 See Neb. Rev. Stat. § 24-1106 (Cum. Supp. 2018). 3 Johnson Lakes Dev. v. Central Neb. Pub. Power, 254 Neb. 418, 576 N.W.2d 806 (1998). 4 State v. Swindle, 300 Neb. 734, 915 N.W.2d 795 (2018).  - 116 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 ANALYSIS Acklie argues that the district court erred in determin- ing that paragraph 11 is ambiguous when construed with other provisions of the agreement. Acklie contends that para- graph 11 is not ambiguous and that by finding ambiguity where it did not exist, the court’s determination confused the jurors as to whether they were to decide whether Greater Omaha breached the agreement or were to exclusively con- sider the damages owed to Acklie. Acklie further argues that the court should have not permitted Greater Omaha to pre­ sent evidence supporting its theory that it denied payment to Acklie, because the company had denied payment to two pre- vious employees under the same contract. In response, Greater Omaha argues that the agreement grants it sole decision- making authority over whether to contribute to the deferred compensation account, as well as the amount of any payment due, and that the district court properly admitted extrinsic evidence to permit the jury to determine the meaning of paragraph 11. [3-7] The issues raised in Acklie’s appeal concern general contract principles. In interpreting a contract, a court must first determine, as a matter of law, whether the contract is ambiguous. 5 A contract written in clear and unambiguous lan- guage is not subject to interpretation or construction and must be enforced according to its terms. 6 A contract is ambigu- ous when a word, phrase, or provision in the contract has, or is susceptible of, at least two reasonable but conflicting interpretations or meanings. 7 The determination of whether a contract is ambiguous is to be made on an objective basis, not by the subjective contentions of the parties suggesting 5 City of Sidney v. Municipal Energy Agency of Neb., 301 Neb. 147, 917 N.W.2d 826 (2018). 6 Id. 7 Id.  - 117 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 opposing meanings of the disputed language. 8 A contract must receive a reasonable construction and must be construed as a whole, and if possible, effect must be given to every part of the contract. 9 We do not interpret the terms provided within paragraph 11 to be ambiguous. When viewed objectively, paragraph 11 is not susceptible of two reasonable but conflicting meanings. The provision unmistakably grants Greater Omaha the sole authority to interpret and administer the agreement. Likewise, the provision clearly grants Greater Omaha binding author- ity to determine the valuation of the account and the amount of any payment due under the agreement. We therefore con- clude that paragraph 11 is unambiguous and must be under- stood according to its clear terms, without regard to extrin- sic evidence. However, we determine that the plain and ordinary mean- ing of paragraph 11, as well as paragraph 4, raises an issue which goes to the heart of Acklie’s appeal: whether the agree- ment is an enforceable contract under which Acklie could recover. Acklie’s lawsuit is premised on the claim that Greater Omaha breached the agreement by failing to pay him the amount due to him. If, pursuant to our obligation to reach an independent, correct conclusion irrespective of the determina- tions made by the court below, we determine the agreement is unenforceable, then Acklie would be entitled to no relief and there would be no merit to the assignments of error Acklie has raised. Therefore, the principal issue before us is whether the agreement is enforceable. Deferred compensation is presently earned but is to be paid to an employee in the future if he or she possesses the qualifi- cations required by the plan and complies with the conditions 8 Johnson Lakes Dev., supra note 3. 9 Jacobs Engr. Group v. ConAgra Foods, 301 Neb. 38, 917 N.W.2d 435 (2018).  - 118 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 prescribed by it. 10 The conditions of the agreement in this case include the terms of paragraph 11, provided above, which permits Greater Omaha to take “binding and conclusive” “action[,]” “including any valuation of the [account], or the amount of . . . payment due under [the agreement].” In addi- tion, paragraph 4 states that a general ledger account shall be established for the purpose of reflecting deferred com- pensation and that Greater Omaha will annually determine “an amount” to credit to the account. Critically, paragraph 4 uses clear language qualifying Greater Omaha’s obligation to fund the account by stating, “The amount of the contribu- tion and the decision as to whether to make one at all, shall be solely the decision of [Greater Omaha].” Pursuant to a plain and ordinary meaning of these terms, the decision of whether Acklie ever qualifies for payment under the deferred compensation plan is a matter left to Greater Omaha’s sole discretion. The agreement clearly grants Greater Omaha the binding and conclusive authority to decide whether or not to pay Acklie. [8-10] A party seeking to enforce a contract has the bur- den of establishing the existence of a valid, legally enforce- able contract. 11 To create a contract, there must be both an offer and an acceptance; there must also be a meeting of the minds or a binding mutual understanding between the parties to the contract. 12 It is a fundamental rule that in order to be binding, an agreement must be definite and certain as to the terms and requirements. 13 It must identify the subject matter and spell out the essential commitments and agreements with respect thereto. 14 10 Sindelar v. Canada Transport, Inc., 246 Neb. 559, 520 N.W.2d 203 (1994). 11 Houghton v. Big Red Keno, 254 Neb. 81, 574 N.W.2d 494 (1998). 12 Id. 13 Davco Realty Co. v. Picnic Foods, Inc., 198 Neb. 193, 252 N.W.2d 142 (1977). 14 Id.  - 119 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 [11] Generally, mutuality of obligation is an essential ele- ment of every enforceable contract and consists in the obliga- tion on each party to do, or permit something to be done, in consideration of the act or promise of the other. 15 Mutuality is absent when only one of the contracting parties is bound to perform, and the rights of the parties exist at the option of one only. 16 One of the most common types of promise that is too indefinite for legal enforcement is the promise where the promisor retains an unlimited right to decide later the nature or extent of his or her performance. 17 In that situation, the promisor’s unlimited choice in effect destroys the promise and makes it illusory. 18 An illusory promise is one that is so indefinite that it cannot be enforced, or by its terms makes performance optional or entirely discretionary on the part of the promisor. 19 [12] An agreement which depends upon the wish, will, or pleasure of one of the parties is illusory and does not consti- tute an enforceable promise. 20 Without a mutuality of obli- gation, the agreement lacks consideration and, accordingly, 15 Johnson Lakes Dev., supra note 3; De Los Santos v. Great Western Sugar Co., 217 Neb. 282, 348 N.W.2d 842 (1984). 16 Id. Accord Hecker v. Ravenna Bank, 237 Neb. 810, 468 N.W.2d 88 (1991). See, 17 C.J.S. Contracts § 135 (2011); 17A Am. Jur. 2d Contracts § 22 (2016). 17 Floss v. Ryan’s Family Steak Houses, Inc., 211 F.3d 306 (6th Cir. 2000); Davis v. General Foods Corporation, 21 F. Supp. 445 (S.D.N.Y. 1937). 18 Floss, supra note 17, citing 1 Samuel Williston, A Treatise on the Law of Contracts § 43 (3d ed. 1957); Davis, supra note 17. See Midland Steel Sales Co. v. Waterloo Gasoline Engine Co., 9 F.2d 250 (8th Cir. 1925). 19 Fagerstrom v. Amazon.com, Inc., 141 F. Supp. 3d 1051 (S.D. Cal. 2015), affirmed sub nom. Wiseley v. Amazon.com, Inc., 709 F. Appx. 862 (9th Cir. 2017). 20 Johnson Lakes Dev., supra note 3; Pantano v. McGowan, 247 Neb. 894, 530 N.W.2d 912 (1995), disapproved on other grounds, Weyh v. Gottsch, 303 Neb. 280, 929 N.W.2d 40 (2019); Chadd v. Midwest Franchise Corp., 226 Neb. 502, 412 N.W.2d 453 (1987).  - 120 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 does not constitute an enforceable agreement. 21 As relevant here, an agreement to pay such wages as the employer desires is invalid. 22 In De Los Santos v. Great Western Sugar Co., 23 this court considered a breach of contract action brought by a contrac- tor which agreed to transport “‘such tonnage of beets as may be loaded by’” a sugar company. Because the sugar company hired other truckers in addition to the contractor, the com- pany terminated the contractor’s services after 2 months. The contractor sought to enforce the parties’ agreement, and the district court granted summary judgment in favor of the sugar company. On appeal, we stated the sugar company made no promises other than to pay for the transportation of beets which were in fact loaded by the company. We found that in the absence of a contractual provision specifying quantity, the company was not obligated to use the contractor’s services, and the company’s decision to cease using those services is not actionable. 24 In interpreting the contract at issue, we found that “the right of the defendant to control the amount of beets loaded onto the plaintiff’s trucks was in effect a right to terminate the contract at any time, and this rendered the contract as to its unexecuted portions void for want of mutuality.” 25 In Davis v. General Foods Corporation, 26 the plaintiff revealed an idea and recipe to the defendant for fruit flavors to be used in homemade ice cream. The defendant agreed to pay the plaintiff reasonable compensation if it used the recipe 21 See Floss, supra note 17. 22 See, Day’s Stores, Inc. v. Hopkins, 573 P.2d 1366 (Wyo. 1978); Varney v. Ditmars, 217 N.Y. 223, 111 N.E. 822 (1916); Calkins v. Boeing Company, 8 Wash. App. 347, 506 P.2d 329 (1973). 23 De Los Santos, supra note 15, 217 Neb. at 283, 348 N.W.2d at 844. 24 See id. 25 Id. at 286, 348 N.W.2d at 845. 26 Davis, supra note 17.  - 121 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 and idea in its business, and it wrote that any compensation paid would rest solely in the defendant’s discretion. The court found the parties’ agreement was so indefinite that it could not support a binding obligation. The court found that the defendant’s promise was illusory, reasoning that by agreeing to the defendant’s unlimited right to decide the compensation to be paid, the plaintiff was in effect throwing herself upon the mercy of those with whom she contracted. 27 Applying the foregoing principles to this case, we deter- mine that Greater Omaha’s promise to pay Acklie deferred compensation is fatally indefinite. The conditions relating to payment were not fully determined and were left to the dis- cretion of one contracting party only. Per the express terms of the agreement, Acklie’s expectancy interest is no greater than the possibility of receiving payment from Greater Omaha, unless Greater Omaha chose not to make such a payment. These terms did not create a binding contract or one under which Acklie could establish a right to any specific funds. 28 One of the primary reasons that an illusory promise is unen- forceable is that the indefiniteness of such a promise pre- cludes the court from being able to fix exactly the legal liabil- ity of the parties to the contract. 29 We find that the indefinite features of the agreement here are like those addressed in De Los Santos and Davis, because Greater Omaha’s right to control the amount of payment due, if any, is in effect a right to terminate the contract at any time. Accordingly, the agree- ment is not a valid, legally enforceable contract under which Acklie could recover. The arguments made by Acklie and Greater Omaha in anticipation of a determination that the agreement is unen- forceable are not persuasive. While both parties contend that 27 See id. 28 See, Charter Inv. & Dev. Co. v. Urban Med. Serv., 136 Ga. App. 297, 220 S.E.2d 784 (1975); Calkins, supra note 22. 29 Fagerstrom, supra note 19.  - 122 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 the duty of good faith and fair dealing saves the agreement from being rendered illusory, they provide no legal authority demonstrating why such is the case under the circumstances of this case. To be sure, there are circumstances under which the duty of good faith and fair dealing is sufficient to avoid the finding of an illusory promise. 30 However, this case does not present such a circumstance, because the illusory nature of the agreement stems from its express terms, and Greater Omaha’s exercise of rights clearly granted to it cannot constitute bad faith on its part. 31 The implied covenant of good faith and fair dealing exists in every contract and requires that none of the parties to the con- tract do anything which will injure the right of another party to receive the benefit of the contract. 32 However, in order for the implied covenant of good faith and fair dealing to apply, there must be in existence a legally enforceable contractual agreement. 33 In the case at bar, we have held that Acklie failed to prove the existence of an enforceable contract. Therefore, the implied covenant of good faith and fair dealing does not save the agreement from being rendered illusory. Additionally, there is no merit to the argument that the covenant not to compete provision saves the agreement from being rendered illusory. No party challenged the district court’s conclusion that the covenant not to compete provision is unenforceable, because it prohibits only working “within any of the restricted areas” and the agreement does not specify any restricted areas. Moreover, the fact that Greater Omaha 30 See, Milenbach v. C.I.R., 318 F.3d 924 (9th Cir. 2003); Fagerstrom, supra note 19; Corthell v. Summit Thread Co., 132 Me. 94, 167 A. 79 (1933); Horizon Corp. v. Westcor, Inc., 142 Ariz. 129, 688 P.2d 1021 (Ariz. App. 1984); Mezzanotte v. Freeland, 20 N.C. App. 11, 200 S.E.2d 410 (1973). See, also, Chadd, supra note 20. 31 See De Los Santos, supra note 15. 32 Spanish Oaks v. Hy-Vee, 265 Neb. 133, 655 N.W.2d 390 (2003). 33 Cimino v. FirsTier Bank, 247 Neb. 797, 530 N.W.2d 606 (1995).  - 123 - Nebraska Supreme Court Advance Sheets 306 Nebraska Reports ACKLIE v. GREATER OMAHA PACKING CO. Cite as 306 Neb. 108 made two contributions does not create an enforceable agree- ment, because the contract’s unambiguous language imposes no obligation upon Greater Omaha to pay Acklie any money from the account. Because the agreement lacks mutuality of obligation, the agreement does not create a binding obligation, making the agreement unenforceable. Because the agreement is unenforce- able, all of Acklie’s claims fail as a matter of law. Where the record adequately demonstrates that the decision of a trial court is correct—although such correctness is based on a ground or reason different from that assigned by the trial court—an appellate court will affirm. 34 Because we find that Acklie cannot recover under the agreement, we need not address his remaining assignments of error. CONCLUSION For the foregoing reasons, the judgment is affirmed. Affirmed. 34 State v. Barbeau, 301 Neb. 293, 917 N.W.2d 913 (2018). 

Users often encounter information such as policies (e.g., privacy and/or data-security policies), terms and conditions of a contract (e.g., in software product licenses, leases for cars and apartments), etc. during everyday activities. These activities include surfing the web and visiting sites that have implemented certain policies. Such information, e.g., legal information embedded in sources such as websites and other non-electronic and/or electronic documents can be difficult to locate and/or analyze. Therefore, user may be unaware of such policies, terms, etc. Also, in many situations the user cannot continue interaction with a website unless the user accepts the website's policy. Though the website may direct a user to the website's policy, user may not have understood the user's obligations and any rights granted to the website. As such, in order to continue interacting with an on-line destination (e.g., a website) the user may unknowingly consent to any requirements imposed by the policies and/or terms of the on-line destination, or may unknowingly violate such requirements.

274 F.Supp.2d 736 (2002) In re MICROSOFT CORP. ANTITRUST LITIGATION This document relates to: State of West Virginia, ex rel. Darrell V. McGraw, Jr., Attorney General, v. Microsoft Corporation No. MDL 1332. No. CIV. JFM-02-2091. United States District Court, D. Maryland. December 31, 2002. MEMORANDUM MOTZ, District Judge. Plaintiff, State of West Virginia ex rel Darrell V. McGraw, Jr., Attorney General ("the State" or "West Virginia"), moves to remand this action to the Circuit Court of Boone County, West Virginia. The motion will be granted. The motion for attorneys' fees and costs will, however, be denied. I. On May 18, 1998, West Virginia filed an action against Microsoft in the District of Columbia alleging violations of federal antitrust law, the West Virginia Antitrust Act, and the West Virginia Consumer Credit and Protection Act. The district court subsequently held a bench trial and entered judgment. See United States v. Microsoft Corp., 97 F.Supp.2d 59 (D.D.C. 2000); United States v. Microsoft Corp., 87 F.Supp.2d 30 (D.D.C.2000); United States v. Microsoft Corp., 84 F.Supp.2d 9 (D.D.C. 1999). On appeal, the D.C. Circuit Court of Appeals affirmed in part, reversed in part, and vacated the district court's judgment. United States v. Microsoft Corp., 253 F.3d 34 (D.C.Cir.) (en banc), cert. denied, 534 U.S. 952, 122 S.Ct. 350, 151 L.Ed.2d 264 (2001). Following remand, the United States and nine States agreed to a settlement of their claims against Microsoft and proposed a Revised Proposed Final Judgment ("RPFJ") to the district court. Nine other States, including West Virginia, and the District of Columbia opposed the settlement and sought more extensive remedies. On November 1, 2002, Judge Kollar-Kotelly of the district court issued several rulings. Judge Kollar-Kotelly conditionally approved the RPFJ. United States v. Microsoft, 231 *737 F.Supp.2d 144 (D.D.C.2002). Additionally, Judge Kollar-Kotelly denied the requests of West Virginia and the other so-called "dissenting" States for more extensive remedies than those sought in the RPFJ. New York v. Microsoft Corp., 224 F.Supp.2d 76 (D.D.C.2002). On December 3, 2001, West Virginia filed this action in the Circuit Court of Boone County, West Virginia, alleging only state law claims that Microsoft violated West Virginia's Antitrust Act, West Virginia's Consumer Credit and Protection Act, and West Virginia's Unfair Practices Act. After Microsoft removed the action to the Southern District of West Virginia, the State filed this motion to remand. The motion was pending when the action was transferred to this court on June 17, 2002 by the Judicial Panel on Multidistrict Litigation ("MDL"). II. In its motion, the State argues that remand is appropriate because none of the claims it has asserted arise under federal law. Microsoft, in response, points to the enigmatic "footnote two" in Federated Dep't Stores, Inc. v. Moitie, 452 U.S. 394, 397 n. 2, 101 S.Ct. 2424, 69 L.Ed.2d 103 (1981), as the basis for removal. A. Microsoft's removal to federal court is premised on federal question jurisdiction. "The well-pleaded complaint rule requires that federal question jurisdiction not exist unless a federal question appears on the face of a plaintiffs properly pleaded complaint." Columbia Gas Transmission Corp. v. Drain, 237 F.3d 366, 370 (4th Cir.2001) (citing Merrell Dow Pharm., Inc. v. Thompson, 478 U.S. 804, 808, 106 S.Ct. 3229, 92 L.Ed.2d 650 (1986)). There is, however, an exception to the well-pleaded complaint rule known as artful pleading. "Under the doctrine of `artful pleading,' a court is permitted to look behind a complaint to determine whether a plaintiff is attempting to conceal the federal nature of his claim by fraud or obfuscation." In re Wireless Tel. Radio Frequency Emissions Prod. Liab. Litigation, 216 F.Supp.2d 474, 492 (D.Md.2002) (citation omitted). Artful pleading is best described as "the manner in which some plaintiffs ... manage to plead claims that are actually federal ... under state law." Id. Two categories of artful pleading cases are firmly established: cases involving complete preemption of state law by federal law, see, e.g., Rivet v. Regions Bank of Louisiana, 522 U.S. 470, 475, 118 S.Ct. 921, 139 L.Ed.2d 912 (1998), and cases involving substantial questions of federal law. See, e.g., Merrell Dow, 478 U.S. at 807 n. 2, 106 S.Ct. 3229; Franchise Tax Board v. Constr. Laborers Vacation Trust for S. Col, 463 U.S. 1, 27-28, 103 S.Ct. 2841, 77 L.Ed.2d 420 (1983). The parties agree that neither of these categories applies in this case. Instead, Microsoft attempts to rely on a third potential category of artful pleading cases: those falling within Moitie's footnote two. Moitie began as an antitrust suit brought by the United States against various department stores in which it was alleged that the stores had violated section 1 of the Sherman Act, 15 U.S.C. § 1 by agreeing to fix the retail price of women's clothing sold in northern California. Moitie, 452 U.S. at 395, 101 S.Ct. 2424. Subsequently, various private plaintiffs filed seven parallel actions. Six plaintiffs, including Brown (Brown I), brought suit in the United States District Court for the Northern District of California. See id; see also Arthur R. Miller, Artful Pleading: A Doctrine in Search of Definition, 76 Tex. L.Rev. 1781, 1801 (1998). Moitie brought a separate parallel action in state *738 court (Moitie I). Each of the complaints tracked, almost identically, the language of the Government's complaint, although the Moitie I complaint referred solely to state law. Moitie, 452 U.S. at 396, 101 S.Ct. 2424. All of the actions originally filed in federal district court were consolidated before one judge and the Moitie I case was removed there on the basis of diversity and federal question jurisdiction. Id. Moitie did not challenge removal. See Miller, supra, at 1801. The District Court then dismissed all of the actions in their entirety because the plaintiffs had failed to plead an injury actionable under the Clayton Act, 15 U.S.C. § 15. Of the seven suits, plaintiffs in five of the suits appealed the dismissal. Moitie, 452 U.S. at 396, 101 S.Ct. 2424. The lawyer for Brown and Moitie, however, refiled the two actions in state court (Brown II and Moitie II). The complaints in both cases purported to raise solely state law claims. Both complaints, however, made allegations similar to those made in their previous complaints and in the Government's complaint. The defendants removed the case to federal court on the grounds that the complaints were artfully plead federal claims. The defendants also moved to have the claims dismissed. Id. Subsequently, the district judge denied Moitie and Brown's motion to remand, holding that the complaints, though artfully couched in terms of state law, were "in many respects identical" with the previous complaints and were properly removed because they raised "essentially federal law" claims. Id. The district court also held that under the doctrine of res judicata, Moitie II and Brown II were dismissed. On appeal, the Ninth Circuit affirmed the district court's ruling on removal; however, it also created a "novel exception to the doctrine of res judicata" and reversed the district's court's dismissal of Moitie II and Brown II. Id, at 397-98, 101 S.Ct. 2424. The Supreme Court granted certiorari to consider the validity of the Ninth Circuit's holding on res judicata. Id. at 398, 101 S.Ct. 2424. In its opinion, the Supreme Court paid little attention to the issue of removal and focused almost entirely on the res judicata issues. The Court addressed the issue of removal in one footnote that reads in its entirety: The Court of Appeals also affirmed the District Court's conclusion that Brown II was properly removed to federal court, reasoning that the claims presented were `federal in nature.' We agree that at least some of the claims had a sufficient federal character to support removal. As one treatise puts it, courts Svill not permit plaintiff to use artful pleading to close off defendant's right to a federal forum ... [and] occasionally the removal court will seek to determine whether the real nature of the claim is federal, regardless of plaintiffs characterization.' 14 C. Wright, A. Miller, & E. Cooper, Federal Practice and Procedure §§ 3722, pp. 564-566 (1976) (citing cases) (footnote omitted). The District Court applied that settled principle to the facts of this case. After `an extensive review and analysis of the origins and substance of the two Brown complaints, it found, and the Court of Appeals expressly agreed, that respondents had attempted to avoid removal jurisdiction by `artfulfly]' casting their `essentially federal law claims' as state-law claims. We will not question here that factual finding. See Prospect Dairy, Inc. v. Dellwood Dairy Co., 237 F.Supp. 176 (N.D.N.Y.1964); In re Wiring Device Antitrust Litigation, 498 F.Supp. 79 (E.D.N.Y.1980); Three J Farms, Inc. v. Alton Box Board Co., 1978 WL 1459, 1979-1 Trade Cases ¶¶ 62,423 (D.S.C. 1978), rev'd on other grounds, 609 F.2d 112 (C.A.4 1979), cert, denied, 445 U.S. 911, 100 S.Ct. 1090, 63 L.Ed.2d 327 (1980). *739 Moitie, 452 U.S. at 397 n. 2, 101 S.Ct. 2424. B. Following the Moitie decision, different courts of appeals took two different approaches in interpreting its footnote two.[1] In Travelers Indem. Co. v. Sarkisian, 794 F.2d 754 (2d Cir.1986), the Second Circuit developed a "forum election" interpretation of Moitie. See N.A.A.C.P. v. Metro. Council, 144 F.3d 1168, 1171 (8th Cir. 1998). The Second Circuit identified two conditions that must be met for removal to be appropriate under Moitie: (1) the elements of the state law claims are virtually identical to those of a claim expressly grounded on federal law; and (2) the plaintiff previously elected to proceed in federal court. Sarkisian, 794 F.2d at 760. Specifically, the Sarkisian court noted that: Brown had an initial opportunity to be master of his price-fixing claim and elected to assert it under the Clayton Act in federal court. Having done so and having foregone the opportunity to plead a pendent state law claim, he was not free to abuse the dual court system by filing in state court a second lawsuit and resubmitting his claim as one based solely on state law. Id. at 760-61. The "forum-election" interpretation of Moitie was explicitly rejected by the Fifth, Seventh and Ninth Circuits, in favor of a "claim-preclusion" interpretation. See Rivet v. Regions Bank of Louisiana, F.S.B., 108 F.3d 576, 585 (5th Cir.), reversed and remanded 522 U.S. 470, 118 S.Ct. 921, 139 L.Ed.2d 912 (1998); Doe v. Allied-Signal, Inc., 985 F.2d 908, 912-13 (7th Cir.1993); Sullivan v. First Affiliated Sec, Inc., 813 F.2d 1368, 1374-76 (9th Cir.1987). Under this interpretation, "Moitie should only apply where a plaintiff files a state cause of action completely precluded by a prior federal judgment on a question of federal law." Rivet, 108 F.3d at 586 (citing Carpenter v. Wichita Falls Indep. Sch. Dist, 44 F.3d 362, 370 (5th Cir.1995)). In part, due to the "considerable confusion in the circuit courts," the Supreme Court granted certiorari in Rivet, 522 U.S. at 478, 118 S.Ct. 921. Specifically, the Court "clarified] ... that Moitie did not create a preclusion exception to the rule, fundamental under currently governing legislation, that a defendant cannot remove on the basis of a federal defense." Id. at 478, 118 S.Ct. 921. Because claim preclusion of a prior federal judgment is a defensive plea, the Court concluded that it did not provide a basis for removal, thereby rejecting the "claim preclusion" interpretation of Moitie advanced by the Fifth, Seventh, and Ninth Circuits. Id C. The issue presented here is whether the "forum election" interpretation of Moitie is still a viable basis for removal. Microsoft's argument is essentially that because the Supreme Court did not overrule Moitie in Rivet, Sarkisian remains good law.[2] Microsoft further argues that the facts of *740 this case are analogous to those in Moitie and thus, under the Second Circuit's "forum election" interpretation, removal is appropriate. Although the Court in Rivet did not overrule Moitie or explicitly address the merits of the Second Circuit's "forum election" interpretation, it did note that "[t]he Moitie footnote ... was a marginal comment and will not bear the heavy weight lower courts have placed on it." Rivet, 522 U.S. at 477, 118 S.Ct. 921. Significantly, the Court also stated that by holding that removal was improper in the claim preclusion context, it was "clarify[ing] and confin[ing]" Moitie's footnote two "to its specific context." Id. at 472, 118 S.Ct. 921. Thus, the Court made clear that it was rejecting the expansive view given to the Moitie footnote by the courts of appeals, regardless of the interpretation. See generally Miller, supra, at 1816-28 (arguing that Moitie is of no precedential value for removal jurisdiction). On this basis alone, the "forum election" interpretation is no longer a viable basis for removal. Moreover, Rivet can be read as explicitly rejecting Sarkisian and the "forum election" interpretation.[3] The Court stated: "[t]he Courts of Appeals have adopted differing views regarding the propriety of removing a state court action to federal court on the ground that the claim asserted is precluded by a federal judgment." Id. at 924. The Court then cited Sarkisian in a footnote listing some of those Courts of Appeals cases. Id. at 925 n. 2. Thus, the Court made clear that it considered Sarkisian a case in which the Second Circuit developed a view based on claim preclusion. Accordingly, by rejecting the general concept of removal based upon claim preclusion by a federal judgment, the Court may well have intended to reject Sarkisian as well as Rivet. See 14B Charles Alan Wright et al., Federal Practice and Procedure § 3722, at 443 (1998) (stating that the Court explicitly rejected the Second Circuit's interpretation of the Moitie footnote). This view of Rivet draws support from the fact that the "forum election" interpretation is partially based on the premise that removal is appropriate where a plaintiffs state law claims are virtually identical to those of a federal claim. This element of the "forum election" interpretation is analogous to the claim preclusion requirement that the claims in the second matter are based upon the same cause of action involved in the earlier proceeding. For these reasons, I find that the "forum election" approach advanced by the Second Circuit in Sarkisian was overruled by the Supreme Court in Rivet. Accordingly, the State's motion to remand will be granted.[4] A separate order to that effect is being entered herewith.[5] *741 ORDER For the reasons stated in the accompanying memorandum, it is, this 31st day of December 2002 ORDERED that 1. Plaintiffs motion to remand is granted; 2. Plaintiffs motion for attorneys' fees and costs is denied; and 3. This action is remanded to the Circuit Court of Boone County, West Virginia. NOTES [1] The Fourth Circuit has never addressed the meaning of Moitie's footnote two. [2] The only authority cited by Microsoft in support of its argument is Metro. Council, 144 F.3d at 1171. In Metro. Council, the Eighth Circuit, upon remand from the Supreme Court, addressed whether its earlier opinion affirming the district court's exercise of removal jurisdiction was consistent with the Supreme Court's ruling in Rivet. Although the court in Metro. Council discussed Sarkisian and the history of Moitie, it never addressed the continuing viability of the "forum election" interpretation. Instead, the court reinstated its earlier opinion because that opinion was based on the All Writs Act. Id. at 1171. The court, in fact, specifically noted that its earlier opinion was not based on Moitie and, thus, declined to determine whether removal was warranted under the artful pleading doctrine. Id. Therefore, Metro. Council does not stand for the proposition attributed to it by Microsoft. [3] The fact that no court has relied upon the "forum election" approach since the Supreme Court's decision in Rivet further supports the view that the Court rejected Sarkisian in its opinion. [4] On December 27, 2002, Microsoft filed a "Supplemental Memorandum in Support of its Motion to Dismiss or, in the Alternative, to Stay." In this supplemental memorandum, Microsoft argues that the doctrine of claim preclusion bars West Virginia's state law claims in light of Judge Kollar-Kotelly's recent rulings. While Microsoft may be correct in asserting that claim preclusion applies, this court does not have jurisdiction over the matter, and thus the applicability of claim preclusion must ultimately be resolved by the West Virginia courts (subject to review by the Supreme Court of the United States). [5] The State has requested attorney's fees and costs be awarded to it pursuant to 28 U.S.C. § 1447(c). However, because the motion to remand has raised a novel and complex question and because there was no evidence of bad faith in removal, this request will be denied. See In re Lowe, 102 F.3d 731, 733 n. 2 (4th Cir. 1996); Nat'l Ass'n of State Farm Agents, Inc. v. State Farm Mut. Auto. Ins. Co., 201 F.Supp.2d 525, 531 n. 12 (D.Md.2002).

When it comes to sky-high anime collaborations, the fine folks at the Tokyo Skytree are not shy in decking out one of Tokyo’s hottest tourist attractions in all manner of decoration and special exhibits. This past Spring, I had the incredible opportunity to check out the official Attack on Titan collaboration, complete with titan attack simulations at a ground-breaking 350 meters in the sky. You can check our detailed photo report of that event right here. After their current Holiday event wraps up, however, the Skytree will be receiving another huge makeover; this time playing stage to not only space battles, but also space idols. That’s right — Macross is coming to the Tokyo Skytree, complete with series concert broadcasts at some seriously unbelievable heights. The ‘Macross Blue Moon Show Case in Tokyo Skytree’ collaboration is just a small part of the series’ 35th-anniversary celebration, and will run from January 8 until February 28. You can expect the Tembo deck of the Skytree to be, well, decked out with decals and pop-up stands featuring Macross series characters and props. Flashy concert footage will be streaming throughout the halls and projected on the windows, and of course, the gift shops and cafes will be offering merch and themed food aplenty. If you find yourself in Tokyo early next year, I dare say that there is no better time to check out one of the city’s must-see attractions. Aside from the great collaborations, seeing Tokyo from atop the world’s tallest broadcast tower is worth the price of admission alone.

Executive Summary ? The likely outcome of the 16 May elections is a victory by the BC Liberal Party (currently holding polls at 70%), a pro-business, right-of-center party led by Gordon Campbell. ? Major changes in British Columbia energy policy are likely under a Liberal government. ? A low snow pack, a return to regulation by the BC Utilities Commission and public concern about outstanding debts owed by US power consumers could force BC Hydro to stop out-of-province power sales once existing contracts expire ? BC Hydro
,s additional generation at Williston is likely undeliverable Liberal Party Platform ? Income tax cut that would make BC
,s income tax the lowest in Canada ? Independent audit of the province
,s books amid allegations of NDP mismanagement and incompetence ? Review of all Crown corporations (including BC Hydro) to enhance efficiency and management quality ? Campbell has also said that he wants to scrap the Corporate Capital Tax, the Machinery Equipment Tax and the Corporate Income Tax. Energy Agenda According to sources, under the Liberal party's rule, significant changes in the BC government's energy policy could include a move toward the privatization of some BC Hydro assets, perhaps including its transmission assets, as well as increased government support for independent power producers and coal-fired production. At the same time, a rate review and attempts to establish a broad electricity strategy for the province could lead to a lack of clarity about the province
,s overall energy strategy over the next few years. Campbell reportedly is a proponent of deregulation and of expanding coal-fired production. Campbell calls thermal coal,
&an asset that we want to be able to move forward with and to encourage once again in BC.
8 A high-ranking NDP source believes that Campbell will take the province back along the path of natural resources extraction rather than promoting new technology. The source expects this to lead to strong protests from environmentalists.
&These are confrontational moves, and people will be on the streets.
8 Campbell's most likely choice for energy minister is Richard Neufeldt, though we caution that this decision depends on the make-up of the legislature after the election. Neufeldt is responsible for the Liberal Party
,s energy, mining and northern development portfolio. Sources speculate that if right-wing Liberals are dissatisfied with the party
,s performance after the May election, Neufeldt could again defect to the Opposition. However, this gives Campbell even greater incentive to name Neufeldt energy minister, a high-profile position. Should the Liberals win the election, Gordon Campbell has indicated that he would return BC Hydro to regulation by the BC Utilities Commission. The BC government has derived $5.5 billion in revenue from BC Hydro since 1991 (roughly 85 percent of its profit). Critics say this has undermined the utility
,s ability to pay down approximately $7.5 billion in debt and invest in the future. This also has left Hydro without a rate stabilization fund, something that sources feel may be needed this year. Campbell reportedly intends to address these issues, and one can expect this to lead to calls for change. Electricity Export Policy Currently the BC Utilities Commission is demanding more information about BC Hydro
,s out-of-province sales. The Commission has warned that, given the low snow pack, the utility could be a net importer of power this year. Supporting this view, the Northwest Power Planning Council, representing BC Hydro
,s key trading partners in the US, has said that it would not be able to rely upon British Columbia or Alberta during peak consumption periods over the next few years, and that its customers face a 25 percent chance of not making it through the winter without power losses. The combination of a low snow pack, a return to regulation by the BC Utilities Commission and public concern about outstanding debts owed to BC Hydro by US consumers may force BC Hydro to stop out-of-province power sales once existing contracts expire. BC Hydro Privatization A key campaign energy issue for the Liberal party is the privatization of BC Hydro. Campbell has urged greater electricity competition, saying,
&We need to ensure the transmission infrastructure is available to all, producers and consumers, on an equal and non-discriminatory basis.
8 He stated that independent power producers have been discouraged at every turn.
&I want to change that big time,
8 he told the Canadian Institute of Energy. Campbell also urged more natural gas development, including pipelines and co-generation plants. Campbell backtracked on this stance last week after being challenged by NDP leader Ujjal Dosanjh. Campbell stated on 25 April,
&We have no intention of selling BC Hydro; we have no intentions of selling their transmission lines, no intention of selling their dams, we have no intention of selling their reservoirs.
8 Liberal Party spokesman Mike Morton also reiterated on 29 April that BC Hydro would not be for sale. A high-level NDP source commented that Campbell has been extremely careful in his choice of words regarding BC Hydro, essentially saying that he would not privatize the dams, transmission lines or generating stations, but that he is in favor of opening the sector up to competition. However, local sources believe that some parts of BC Hydro might be sold as part of an overall review of BC Crown Corporations to enhance efficiency. Likely sale prospects include BC Hydro
,s distribution channels and its energy trading subsidiary, Powerex. In addition, Gary Farrell-Collins, the Liberal finance spokesperson and possible second choice for energy minister (after Neufeldt), has stated that public ownership of BC Hydro
,s non-core businesses, such as Westech, its systems division, and customer billing, could come under review. BC Hydro Williston Generation Current reservoirs levels at BC Hydro
,s Williston hydro-generation facility are at 2,150ft, which allows BC Hydro to drop levels another 35 ft (170 Gwhs/ft) under their current permit. The one drawback to this plan
,s additional generation involves the Mackenzie pulp mill that would have to cease operation if water levels were to fall below 2,140ft. Sources close to the Minister of Mines & Energy - elect, Richard Neufeldt, indicate that levels at Williston probably will not be drawn down below Mackenzie
,s operational limits due to concern over political backlash.

How similar are recognition memory and inductive reasoning? Conventionally, memory and reasoning are seen as different types of cognitive activities driven by different processes. In two experiments, we challenged this view by examining the relationship between recognition memory and inductive reasoning involving multiple forms of similarity. A common study set (members of a conjunctive category) was followed by a test set containing old and new category members, as well as items that matched the study set on only one dimension. The study and test sets were presented under recognition or induction instructions. In Experiments 1 and 2, the inductive property being generalized was varied in order to direct attention to different dimensions of similarity. When there was no time pressure on decisions, patterns of positive responding were strongly affected by property type, indicating that different types of similarity were driving recognition and induction. By comparison, speeded judgments showed weaker property effects and could be explained by generalization based on overall similarity. An exemplar model, GEN-EX (GENeralization from EXamples), could account for both the induction and recognition data. These findings show that induction and recognition share core component processes, even when the tasks involve flexible forms of similarity.

National News High School Hate Crime Suspect Is Victim's Mom by Rob Quinn, Newser Staff (NEWSER) – A bizarre twist in the hate crime that caused a Massachusetts high school to end its football season early: Police now suspect the person who spray-painted racist graffiti on the home of 13-year-old Isaac Phillips was the boy's own mother, the Boston Globe reports. Andrea Brazier, who is white, was described as a "strong suspect" in the case after cops confiscated cans of spray paint during a search of the home she shares with husband Anthony Phillips, who is black. Investigators say most of the leads they have followed in the case have led back to the house—and Phillips has given conflicting explanations of where the aerosol cans police spotted in a fire pit came from.

7 Tips to Improve Usability in Mobile Web Design These days there are thousands or mobile websites all around the web, some of them can be considered to be a pure nightmare for mobile devices because of improper usability testing and design implementations. This causes overall diminishing of mobile web and users distrust to this useful functionality. The information about mobile web design, presented on the web, is a bit vague. Lots of websites have really poor mobile interface because they were not produced professionally. In this article we are going to describe several simple steps that would help you design effective mobile websites. Additionally, at the end of the article we described several software options that would help you adjust your website to the needs of various portable devices. Keeping in mind following tips you will be able to create mobile website that would satisfy needs of the most demanding users. Tips to Consider: Tip #1: Try to Understand What Your Users Want No matter what type of UI is created, first of all you need to establish some sort of a connection between designer and user. If you are building a mobile website with the best possible level of interaction between user and the interface, how would you be able to devise your steps effectively if you can’t even imagine user’s preferences on your exact matter? You need to provide a survey, it would give you information about user’s preferences. Once you have a good idea of what areas and design elements your users are attracted to the most, then you can move on to the next step. Tip #2: Minimalism is the Key Keeping everything to a minimum is a simple and effective solution. Since effective mobile interactions have everything to do with great usability and nothing to do with overcrowded designs, it is essential to keep your mobile designs as simple as possible. A simple mobile website will more than likely be 9 times out of 10 more effective than one that feels bloated. This depends greatly on the mobile device, the “heavier” your site is the more time device will need to download it. Keep in mind that most mobile devices have ≈ 512Mb of operating memory or even less. Tip #3: Overall Mobile Accessibility The key to effectiveness is the possibility for user to browse freely thorough the interface. For example, allow toggling as an options rather than force users to view them, hide rarely used features and widgets, and avoid having users fill out long forms. When users access mobile site, much of their attention should be re-focused to the content. This means that the content should be as equally accessible as it is legible. You should also use a variety of techniques that will help you redirect mobile users and/or detect specific screen resolutions. The standard screen resolution is 320×480. Tip #4: Try to Provide Information Through Color Color rendering plays an important role in mobile usability. When used right it gives a compelling manner to provide information without need to use additional spacing. In case you decide to use different colors you may refer to the W3C Mobile Web Best Practice this tells us that if we provide users with information in color, we have to make sure that this same information is available without any color. There has to be a definite contrast between a background color and text. Information that is conveyed using colors should contain a contrast between any of the other elements within the website design. Please remember that colors are used to provide information effectively but not just to make “things look pretty”. Tip #5: Do not Accept Mobile Device as Mini Computer To regard mobile devices as tiny computers is a major simplification and the idea that content can be just shrunk to size is wrong, to some extend. Web design for mobile devices requires major overhauls. You need to adjust fonts and color scheme to be legible on smaller screens, contrasts and resolutions need to be sharpened, complicated design features need to be dropped out or simplified, the information needs to be shifted so that the most important elements can be viewed together. Tip #6: Omit Pop-ups and Refreshes Most mobile browsers do not support pop-ups. The ones that support this function have a very narrow space to pop into. Try to use them less (or do not use them at all) and you will avoid unpredictable results. Also, omit the function of automatic page refreshing to avoid filling of the device limited memory. User can refresh the content manually or turn this option on in the settings of his/her device’. Tip #7: Testing Time! The development of effective usability of a mobile website requires constant testing of the design. Test your website on a cellular network; turn off Wi-Fi connection and use your wireless carrier’s data network. Then launch your web browser and enter your site’s URL. Start counting. If it takes five seconds or less to load your home page, that’s pretty good. If it’s 10 seconds or more, there are lots things that need to be improved. Usability testing is not a onetime event. You need to improve your website’s quality by providing tests on various devices with different screen resolutions, operating systems and performance features, to check how usable your website is. Software to Create Mobile Websites: When speaking of mobile usability it is essential to mention tools that can help you create a mobile version of your website, below you can find a list of resources and applications that will help you successfully fulfill your aim: Mippin is a fantastic tool for those who want to mobilize an RSS-driven site. It’s much quicker to use and the results look great, every time. What’s more, your site will be optimized to work on over 2,000 handsets and the service is completely free. It provides users with basic analytics in reports, as well as the ability to earn money through mobile advertising. At last count, 31,912 websites had been optimized for mobile phones using Wirenode, though this tool offers slightly more than Mippin. Using Wirenode’s users can configure their domain name, upload pictures, track visitors and page views and preview their site on an emulated phone. Editor interface lets fully personalize mobile site with colors and images, and create, edit, rearrange and delete individual pages. 2ergo has mobilized huge organizations like Rightmove and The National Guard, creating mobile-friendly websites for them which look great and load quickly. 2ergo’s customers can choose to use the self-service mobile publishing and content management tool, Mobile Site Builder, or let 2ergo design a custom site especially for them. The latter, obviously, is the more expensive option of the two. 2ergo’s service includes automatic device and carrier detection, data capture and collection forms, an integrated ad service platform, real-time tracking and top-notch technical support. Zinadoo is a free tool, which lets build mobile sites quickly and easily. Users can make the most of Zinadoo’s web and mobile widgets, as well as its text and email services, to promote their site to an online and offline community. Furthermore, they can optimize their site for Google Mobile with keywords and tags, and upload videos using Zinadoo’s Mobile Video. As if that wasn’t enough, users can also gain access to Zinadoo’s online Business Directory and Mobiseer, a Web 2.0 service for organizing, tagging, sharing and managing favorite mobile sites. Winksite is an excellent W3C mobileOK and .mobi standards-compliant mobile website builder which focuses on the community element of website promotion and social interaction. It’s packed with mobile-community features like forums, chat and polls. Users can use Winksite to create their own mobile portal for communicating with friends, sharing feeds and favorites. Users can also divert all of their texts, emails and Twitter messages to one mobile destination which people can interact with. *** Mobile sites have slightly different web address than full sites. Mobile version usually starts with “m.” before the regular web address, or ends with the suffix “.mobi” rather than “.com.” If a mobile user types in your regular URL or follows a link to the site from a search engine, the mobile version has to be loaded automatically. Though it happens not on every phone, just in case include at the top of your website a link to your mobile site, and vice versa. Following these simple steps, you will not only satisfy your mobile visitors creating a pleasant UI but you will become more visible in mobile search results: Try to understand your user’s wishes; Provide survey on your site or in your social community page, your visitors will help you improve your mobile website. Produce minimalistic design; Do not forget that you are creating mobile version of your website for devices that are limited in screen size and functionality, comparing to your computer. Improve total accessibility; Take your iPhone, Blackberry or any other mobile device you owe and test your mobile version on it. Use color coding for (less)important information; When color coding is applied you need to ensure user that the same information is accessible without color effects. Do not think of a mobile device as of a mini computer; No matter how advanced mobile device is, if its screen size is less than 7 inches it cannot be considered a mini computer, so keep in mind that most users have devices with screen sizes from 2.3 and up to 7 inches. Do not use pop-ups; Pop-up is the main thing that causes user frustration. Pop-ups not only distract, they “stir user’s wrath” if they can’t be closed, better omit this functionality than make your users hate you. Test, test and once again test; Testing is important not only for mobile websites but for all kinds of work you do, better check dozen times what you have done than to feel awkward or humiliated later. Good luck with your design products and do not forget to drop a line at the bottom concerning your mobile web experience. Also check out following responsive web design interactive infographic where all valuable information about RWD is gathered.

Q: What parts of an Android app should be fragments? I am going to develop an app with the following structure: Search: Lets user search for articles and displays search results in a list Article: Displays an article UserList: Displays a list of articles the user has chosen to add to the list UserListItem: An item that represents an article in the list mentioned above, and lets the user add custom information via some EditText-fields. The Search, Article and UserList seem like they could be implemented as fragments. But what about the UserListItem? There will of course be multiple UserListItems on the screen at the same time, could it still be implemented as a fragment? If not, how should it be implemented? I'm having some trouble grasping the whole fragment concept. It seems obvious how to use it in the standard scenario, i.e. Search-pane and Article-pane. But it's a bit unclear to me if it should/could be used in a scenario where you will have multiple instances of the same fragment displaying at the same time. I haven't yet written any code, because I want to have the overall structure clear before I start, so I don't have to go back and change everything. A: This might be a bit much if you are a beginner, but if you want to add searching capabilities in your application, consider creating a search interface. From the documentation on Fragments: You can think of a fragment as a modular section of an activity, which has its own lifecycle, receives its own input events, and which you can add or remove while the activity is running (sort of like a "sub activity" that you can reuse in different activities). That being said, there is a huge difference between incorporating a behavior in your screen's layout and wrapping that behavior in a Fragment. In your case, it really wouldn't make sense to wrap each list item in a Fragment as it would be ridiculously inefficient to instantiate a new Fragment for each item in your ListView. Representing each list item as a Fragment would give each row its own lifecycle, which is obviously not what you want. What you probably want to do instead is represent each list item in XML, and have the Fragment (or Activity) that holds your ListView manage these list items as necessary.

A hard disk drive (HDD) is an information storage device which has grown in popularity and has become almost indispensable in computers and various household electronics products, particularly for applications involving mass information storage. In a HDD, a magnetic recording method is employed, in which information is recorded in a magnetized state of a ferromagnetic thin film (magnetic recording film) formed on a recording medium. The magnetic recording film is an aggregate of minute magnetic particles, in which each magnetic particle is given a magnetic characteristic capable of stably maintaining one of two magnetized states corresponding to the recording information. Also, the adjacent magnetic particles are formed sufficiently separated from each other such that each magnetic particle can indicate an independent magnetized state irrespective of the surrounding magnetic particles. In a conventional magnetic recording method, magnetic particles making up the magnetic recording film have various sizes, and their arrangement is random. In forming the magnetic recording film through a thin film formation process, such as coating or sputtering, the growth or arrangement of magnetic particles is determined through a local formation process for the magnetic recording film, whereby such non-homogeneity is generally inevitable. The structure of these types of magnetic recording films is described in Japanese Patent Office (JPO) Pub. No. JP-A-2005-190552, as just one example. Also, one recording information unit (called one bit) is recorded for a group of many adjacent magnetic particles, using a magnetic head. At this time, the serration along the shape of each magnetic particle in a magnetization transition area of the recording bit appears as a “transition noise.” However, variations in the size or arrangement of each of the magnetic particles are averaged by allocating many magnetic particles to one bit, whereby a recordable and reproducible system can be constructed without error. That is, if the magnetic particle is sufficiently small for the size of the recording bit, a deterioration in the signal quality does not become noticeable. With the higher recording density used in HDD in recent years, there is a demand for making the area of forming one hit smaller. To maintain the number of magnetic particles per bit, the area of a magnetic particle is also reduced. However, in recent years, it has become more difficult to make the magnetic particles smaller, as a limit is fast approaching on the minute size already being used, e.g., the magnetic particles soon will not be able to be made smaller without losing their ability to hold information. This effect occurs because the magnetized state of the magnetic particle is always subject to a disturbance owing to ambient thermal energy. When the environmental temperature is T, the magnitude of thermal disturbance energy is estimated to be kBT (kB is the Boltzmann constant). On the other hand, the stability of the magnetized state of the magnetic particle is estimated in terms of KuV. Herein, Ku is a magnetic anisotropy energy of the material composing the magnetic particles, and V is the volume of magnetic particle. If the ratio KuV/kBT is smaller, the stability of the recording information is impaired. Ku has a restriction due to material selection or the magnetic field required for recording. Also, kBT is determined depending on the temperature (around 300K) at which the HDD is used. Accordingly, the fine quality of the magnetic particles (smaller V) necessarily leads to a decrease in KuV/kBT, making it impossible to keep the recording information stable, whereby the function of the recording medium is lost. The above problem cannot be avoided using conventional magnetic recording methods, and at present is an important factor in deciding the upper limit of the recording density of a HDD. To overcome this problem, a “bit pattern medium,” presupposing that one magnetic particle is allocated to one bit, is regarded as promising in the recording medium technology of the next generation. The particular features of a bit patterned medium are described in JPO Pub. No. JP-A-2008-123638 and IEEE Trans. Magn., vol. 43, p. 2142 (2007), but a quick summary of this technology follows. A magnetic particle in bit pattern medium, which is essentially different from a conventional magnetic particle, is an aligned pattern dot. To represent the recording bit with one magnetic particle or a smaller number of magnetic particles, the size and arrangement of magnetic particles cannot be random, as they conventionally are arranged. The size and arrangement are controlled with precision by the recording and reproducing system. With the precise size and arrangement, the recording position of information can be correctly determined or the recorded information can be read as a positional signal. On the other hand, the pattern dot is the minimum unit of magnetization reversal. If a plurality of regions having different magnetized states exist within the pattern dot, the correspondence between the recording information and the pattern dot is not detectable, so that the correct recording and reproducing cannot be made. By satisfying the above prerequisites, the area of one magnetic particle (pattern bit) can be put closer to the area occupied by one bit in the bit pattern medium than in conventional recording schemes. As a result, the volume of pattern dots in the magnetization reversal unit is significantly larger than the conventional volume; thereby, it is possible, in principle, to realize a higher recording density while maintaining thermal stability of the head and HDD. In IEEE Trans. Magn., vol. 43, p. 2142 (2007), a detailed examination for the recording and reproducing process for a bit pattern medium by simulation is made. In performing magnetic recording on the pattern dots formed on the substrate, switching of the direction of recording magnetic fields in synchronism with the pattern dot position is employed. It is noted that the recording synchronization timing lag remarkably increases the recording error on bit pattern medium. If the pattern dot position on the recording medium is displaced from the intended position because of a problem associated with the pattern formation process, there is the same influence. Also, recording quality is remarkably degraded due to head misregistration (tracking misregistration) in the track transverse direction. In IEEE Trans. Magn., vol. 43, p. 2142 (2007), the reason why there is a very strict restriction on the recording synchronization timing or pattern misregistration is that a magnetization reversal field dispersion of the pattern dot increases due to a magneto-static interaction with the adjacent pattern dot. The relationship between the magnetization direction of the pattern dot having already completed recording and the pattern dot on an adjacent track and the magnetization direction of the pattern dot subject to recording from now is always different. Accordingly, the magneto-static interaction between these pattern dots brings about an unpredictable variation in the effective recording magnetic field, causing a recording error. In JP-A-2008-123638, a method for solving this problem is disclosed in which an exchange interaction acting in the opposite direction to the magneto-static interaction is introduced between the pattern dots. In addition, a method for constructing the single pattern dot in which two portions having different magnetic characteristics are closely contacted and magnetically bonded with exchange interaction is described below. For bit pattern medium, the pattern dot is the minimum unit of magnetization reversal, as previously described. Accordingly, the two portions are bonded by the exchange interaction stronger than the magneto-static interaction. In J. Appl. Phys., vol. 100, p. 074305 and J. Appl. Phys., vol. 103, p. 07C504, a structure in which two magnetic layers having different anisotropy magnetic fields (Hk) are laminated in a direction perpendicular to a substrate plane is disclosed. Within the pattern dot having this structure, the portion having smaller anisotropy magnetic field starts the magnetization reversal ahead and then the magnetization reversal of the portion having larger anisotropy magnetic field is induced. In the sense of the structure for realizing such a non-uniform magnetization reversal process, this structure is called an exchange spring structure. With this exchange spring structure, it is possible to realize the magnetization reversal of the pattern dot in the small magnetic field, while maintaining the relatively high thermal stability (total sum of KuV in the upper and lower layers), as theoretically disclosed in J. Magn. Magn. Mater. Vol. 290-291, p. 551 (2005). Thereby, it is expected that high recording density can be realized by making the pattern dots finer, while suppressing the head magnetic field required for recording. In The Abstracts Book of The 52th Annual Conference on Magnetism and Magnetic Materials, GC-08, there is a description of a structure in which the single pattern dot is formed by two portions having different magnetization reversal fields (Hk). However, the document discloses that the structure in which two portions having different magnetization reversal fields Hk are closely contacted in the parallel direction to the substrate plane, not in the perpendicular direction. In this case, a non-uniform magnetization reversal mode peculiar to the exchange spring structure acts, whereby it is possible to reduce the head magnetic field required for recording, while maintaining the relatively high thermal stability. Therefore, to achieve higher recording density of a few Tb/in2 class in the bit pattern medium, as described above, is difficult while maintaining other desired properties of the head and HDD, such as decreasing the magneto-static interaction with adjacent pattern dots as much as possible, and suppressing a variation in the effective magnetization reversal field of the pattern dots caused by a difference in the surrounding magnetized state. The method of introducing the exchange interaction acting in an opposite direction to the magneto-static interaction between the pattern dots as proposed in JPO Pub. No. JP-A-2008-123638 can solve this problem, in an ideal state. However, if the exchange interaction between the pattern dots is not uniform, it is difficult to attain the desired effect, or rather, there is a danger that the dispersion of the magnetization reversal field increases. To obtain the uniform exchange interaction, it is required that the magnetic material for connecting the pattern dots is formed quite precisely, and the level of precision is not easy to obtain. Generally, if each pattern dot shape on the substrate plane is identical, it is possible to suppress the magneto-static interaction between the pattern dots relatively easily by reducing the thickness of the magnetic recording film composed of the pattern dots. For example, in a bit pattern medium in which the pattern dots (square shape, 20 nm×20 nm) are arranged every 25 nm on the substrate plane, if the thickness of the magnetic recording film is reduced from 20 nm to 5 nm, the magneto-static field is decreased to one-half or less. Also, for fixed regular intervals of pattern dots, the magneto-static interaction can also be decreased by reducing the area of the pattern dot to increase the gap between pattern dots. In the previous example, if the size of pattern dot is reduced from the square of 20 nm×20 nm to a square of 10 nm×10 nm, with the regular intervals of pattern dots fixed, the magneto-static field is also decreased to one-half or less. However, in the previous examples, the volume V of each pattern dot is greatly decreased. If the volume V is smaller, it is required that the magnetic anisotropy energy Ku is increased to maintain KuV, that is a thermal stability index, and it is inevitable that a material having a greater magnetization reversal field will be used, presupposing that the head magnetic field required for recording is increased. On the other hand, in consideration of reproduction of the magnetic information recorded on the pattern dot, the reproducing signal strength is greatly decreased, bringing about a danger that the signal to noise ratio (SNR) is deteriorated so much that reading the information may be impossible, especially when the spacing between the pattern dots is larger. In light of these circumstances, a magnetic medium and recording device, such as a HDD, which can have an increased margin for the recording synchronization timing lag or tracking misregistration on the pattern dot by combining such a structure so that the recording error is less likely to occur, even if the magneto-static interaction itself exists, would be very beneficial to the recording industry.

How to Clear Android Market Search and Download History Clearing the Android Market history is an easy task once you know how to do it. The same can't be said for erasing the download list. Find out how either is done in this guide to clearing Android Market search and download history. slide 1 of 4 The Evolution of the Android Market The Android Market has gone through various phases of development. Although still lagging behind the iOS version in terms of both efficiency and the number of applications available, the Android Market has been improving steadily. Find out whether these improvements have also had their effect on the ability to clean search and download history in the market. slide 2 of 4 How Do I Clear Search History in the Android Market (Froyo Devices)? There are a variety of ways of clearing the search history in the Android Market. The first, and easiest, method only works with Android version 2.2 (Froyo), and is fairly straightforward. The steps are as follows: Go to the settings screen by pressing menu, and then settings from the home screen. Once there, open the ‘Applications’ settings menu. Here downloaded, running and all applications can be managed centrally within Froyo. Go to ‘Manage Applications’ and select the ‘All’ Tab. Select the ‘Market Application’. This should be easy to find, especially when organizing the app list alphabetically. Once you find it, select the ‘Clear Data’ and ‘Clear Cache’ buttons, after which all Market search history is erased. You will find an indication of successfully completing the procedure when after re-opening the market app, you have to accept terms again. slide 3 of 4 How Do I Clear Search History in the Android Market (Non-Froyo Devices)? The above-mentioned method will not work for devices that run on older versions of the Android system. Especially for the handsets that still work on version 1.5 and 1.6 of Android an alternative method is needed to clear the Android Market search history. This can be done with a third party application called ‘HistoryEraser’ (for Android 1.6 and upwards), or ‘MarketHistoryEraser’ (for Android version 1.5). Erasing the search history is an easy task from here on: Within these free applications, select the ‘Google Apps’ button. Select the ‘Market Search Histories’ option and press ‘OK’. Now the Android search history is erased. The ‘HistoryErase’ Application is also useful for erasing other kinds of search history, such as call log, contacts, the standard browser or other Google apps, like Google Maps and YouTube. slide 4 of 4 How Do I Clear the Download History of the Android Market? Unfortunately, clearing the download list is not possible with Android, either by default or with any third party application. What Android does do by default is that when deleting an app, it will disappear from the download list after 24 hours. There is, however, a workaround for this, which is fairly complicated, but anyone desperate for an empty download list has no other option. Please note that this method is really a trial-and-error procedure, so results may vary: Firstly, make a backup of the applications you want to keep, using a backup app, such as MyBackup Pro or Titanium Backup. After the phone has gone back to the default settings, restore the applications, which will then be installed on the phone but do not appear in the ‘Downloads’ list of the market app. Even though the download list will be empty, there are obvious disadvantages to factory resetting your handset. When installing new applications or updating existing ones, the applications will appear in the download list as before, so a new factory reset would be required. While this is far from ideal, unfortunately it is currently the only method available to clear the downloaded history in the Android Market. Perhaps this issue will soon be solved with the upcoming release of Android 2.3, or ‘Gingerbread’. We will keep our fingers crossed.

Q: High CPU usage after using Redis cache in c# async I am using https://github.com/StackExchange/StackExchange.Redis. (StackExchange.Redis.StrongName.1.2.1) I have a async function like this which causes CPU to 100% and start getting timeout error after 4-5 min after serving 400 requests public async Task<T> GetOrSetAsync<T>(string cacheKey, Func<Task<T>> getItemCallback) where T : class { T item = null; IDatabase cache = Connection.GetDatabase(); var cacheValue = await cache.StringGetAsync(cacheKey); if (cacheValue.IsNull) { item = await getItemCallback(); await cache.StringSetAsync(cacheKey, JsonConvert.SerializeObject(item)); } else { item = await Task.Factory.StartNew(() => JsonConvert.DeserializeObject<T>(cacheValue)); } return item; } If i stop using redis cache and return direct values from DB, I am able to execute a load of 1300 request in 2 min 20 sec. CPU high still able to complete load. public async Task<T> GetOrSetAsync<T>(string cacheKey, Func<Task<T>> getItemCallback) where T : class { return await getItemCallback(); } If i just modify function below to getDatabase and do nothing. it cause the CPU to goto 100% immediately and stuck after 200 requests in 2 min , which is because of high CPU. public async Task<T> GetOrSetAsync<T>(string cacheKey, Func<Task<T>> getItemCallback) where T : class { IDatabase cache = Connection.GetDatabase(); return await getItemCallback(); } But question is why CPU usage increased only with addition of IDatabase cache = Connection.GetDatabase(); ? A: How is your "Connection" property implemented? Is it creating a new connection to Redis on each call? If so, that would not be recommended. You should share a single connection across your calls. private static Lazy<ConnectionMultiplexer> lazyConnection = new Lazy<ConnectionMultiplexer>(() => { return ConnectionMultiplexer.Connect("<your connection string here>"); }); public static ConnectionMultiplexer Connection { get { return lazyConnection.Value; } }

Introduction ============ Despite improvements in diagnostic technologies and breakthroughs in effective treatment in recent years, breast cancer remains the leading cause of cancer-related deaths in females worldwide, and the incidence and mortality rate generally increase with age ([@b1-ol-0-0-9687]). Triple-negative breast cancer (TNBC) is a sub-group of breast cancer that is characterized by the lack of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) expressions. TNBC accounts for approximately 15--20% of breast cancer cases and is associated with a poorer overall survival compared with other types of breast cancer ([@b2-ol-0-0-9687]). TNBC is the most aggressive breast cancer sub-type with a high possibility of metastasis ([@b3-ol-0-0-9687]). Moreover, due to the lack of ER, PR and HER2, TNBC is unresponsive to any hormonal treatment and there is currently no available targeted therapy, thereby increasing the chance of relapse, worsening prognosis and making TNBC difficult to treat ([@b4-ol-0-0-9687],[@b5-ol-0-0-9687]). Therefore, there is an urgent need to identify novel therapeutic targets for TNBC, and our study focused only on TNBC. TNBC patients are commonly treated with chemotherapy drugs, such as Taxol. Taxol is able to polymerize tubulin, promote the assembly/stabilization of microtubules, disrupt normal microtubule dynamics and arrest cells in mitosis. Cancer cells in TNBC should be killed by Taxol, but they maintain their viability via cellular responses, thereby promoting malignance ([@b6-ol-0-0-9687]). TNBC frequently recurs and metastasizes due to the acquirement of resistance to Taxol ([@b7-ol-0-0-9687]), which is one of the major obstacles to effective treatment. MiRNAs are small, non-coding, endogenous RNAs, 22--25 nucleotides in length, which regulate gene expression ([@b8-ol-0-0-9687]). Mounting evidence has indicated that miRNAs act as oncogenes or tumor suppressor genes in different types of cancer, including TNBC ([@b9-ol-0-0-9687]), indicating their potential as therapeutic targets ([@b10-ol-0-0-9687]). MiR-1207 was identified to be upregulated in younger breast cancer patients, and related to cell motility, invasion and proliferation ([@b11-ol-0-0-9687]). MiR-1207 overexpression was also found to promote cancer stem cell-like traits in ovarian cancer ([@b12-ol-0-0-9687]). In colorectal cancer, significant overexpression of miR-1207 was detected ([@b13-ol-0-0-9687]). These findings demonstrate the participation of miR-1207 in cancer progression. Consequently, the function of miR-1207 in the sensitivity of TNBC to Taxol was investigated in the present study. In summary, we observed a high level of miR-1207-5p in MDA-MB-231 cells. Treatment with antagomiR-1207-5p enhanced the cell growth arrest and cell apoptosis induced by Taxol in MDA-MB-231 cells, by regulating and increasing the protein level of LZTS1. Combined treatment with Taxol and antagomiR-1207-5p induced a sharp decrease in Bcl-2 and p-Akt expression, and an increase in the Bax protein expression level. A notable elevation in the expression of miR-1207-5p and a reduction in the expression of LZTS1 were identified in TNBC tissues but not adjacent tissues and Taxol non-responsive TNBC tissues but not responsive TNBC tissues. Our study showed the novelty of the interaction of miR-1207-5p regulating the LZTS1 gene expression and therefore, its role in taxol sensitivity. Our data suggest that miR-1207-5p may be a promising predictor of sensitivity towards Taxol in TNBC. Materials and methods ===================== ### Cell culture Human normal breast epithelial MCF-10A cells, TNBC cell lines (MDA-MB-231, MDA-MB-436 and MDA-MB-453) and 293 cells were purchased from ATCC, authenticated by cytogenetic analysis and were used within 6 months or stored in liquid nitrogen. Cells were cultured in Dulbecco\'s modified Eagle\'s medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences, Logan, UT, USA) in an incubator at 37°C with 5% CO~2~. ### Transient transfection For cell transfection, MDA-MB-231 cells were seeded onto 6-well plates at a density of 2×10^5^ cells/well. In brief, antagomiR-1207-5p (5′-CCCCUCCCAGCCUCCCUGCCA-3′, 100 nM; Guangzhou RiboBio Co., Ltd., Guangzhou, China), an antisense-based specific inhibitor against miR-1207-5p which was applied for specific silencing of endogenous miR-1207-5p, or antagomiR-NC (5′-UUCUCCGAACGUGUCACGU-3′, 100 nM; Guangzhou RiboBio Co., Ltd.) was diluted in DMEM with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The mixture was added into the 6-well plates to obtain a final concentration of 20 nmol/L and incubated for 48 h before the subsequent experiments. ### Taxol treatment Taxol (Selleck Chemicals, Shanghai, China) was stored in DMSO as a 10 µmol/L stock solution. In brief, prior to treatment with 10 nmol/L Taxol, 1×10^6^ MDA-MB-231 cells were first seeded onto 60-mm culture dishes and were cultured for 24 h. After incubation with Taxol for 3 days, fresh 10 nmol/L Taxol-containing DMEM was added and incubated for another 2 days. Finally, MDA-MB-231 cells were washed with PBS and were cultured in drug-free DMEM. The medium was replaced every 2 days until the commencement of the subsequent experiments. ### Bioinformatics analysis Bioinformatics analysis was performed using the online software program TargetScan 6.2 ([www.targetscan.org/](www.targetscan.org/)). ### Tissue specimens Tissue specimens (tumor tissues and non-cancerous tissues) were obtained from 30 TNBC patients who had undergone surgery at Linfen People\'s Hospital. Non-cancerous tissues were at least 2-cm distal to tumor margins. The definition of response to Taxol-based chemotherapy in TNBC patients was based on the RECIST criteria ([@b14-ol-0-0-9687]). Patients were categorized into two groups: The Taxol responsive group and the Taxol non-responsive group. Patients in the Taxol responsive group achieved a complete response (CR), while patients in the Taxol non-responsive group exhibited persistent disease (PR, SD and PD). There were 18 TNBC patients in the Taxol responsive group and 12 patients in the Taxol non-responsive group. Written informed consent was obtained from each patient. The study was conducted in accordance with Declaration of Helsinki and was approved by the Institutional Review Board of Linfen People\'s Hospital, China. ### Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) Total RNA was extracted from TNBC tissues and TNBC cells using TRIzol (Tiangen Biotech Co., Ltd., Beijing, China). Briefly, RNA was reverse transcribed into cDNA using a Reverse Transcription kit (Takara Biotechnology Co., Ltd., Dalian, China). qPCR analyses were performed using Power SYBR Green (Takara Biotechnology Co., Ltd.) in a 7500HT Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). RT-qPCR data were analyzed using the 2^−ΔΔCq^ method. The thermocycling conditions were as follows: 95°C for 5 min (pre-incubation), 30 cycles at 95°C for 30 sec (denaturation), 60°C for 1 min (annealing), and 72°C for 30 sec (elongation). The expression of GAPDH was used to standardize the amount of mRNA in each PCR tube. U6 was used to standardize the amount of miRNA in each PCR tube. Primers were as followed: LZTS1 forward, 5′-ACCTCTAGAAACCCAGAACTCA-3′ and reverse, 5′-TCCAGAAGAGCCCATATCACTA-3′; GAPDH forward, 5′-GCGCCCAATACGACCAA-3′ and reverse, 5′-CTCTCTGCTCCTCCTGTTC-3′; miR-1207-5p forward, 5′-GCCAGATCTTGATTGACTTACAGCCCAGTT-3′ and reverse, 5′-GCCGAATTCCACCTGTCTTTATTCCACCC-3′; U6 forward 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse 5′-CGCTTCACGAATTTGCGT-3′. ### Western blot analysis Cell lysates were prepared using RIPA buffer (Roche, Shanghai, China). Proteins were resolved by sodium dodecyl sulfonate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA) for the detection of proteins with primary antibodies against AKT1/2/3 (1:500, sc-8312; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), p-AKT1/2/3 (Ser 473)-R (1:500, sc-7985-R; Santa Cruz Biotechnology, Inc.), LZTS1 (1:1,000, LBP62153; Novus Biologicals, LLC, Littleton, CO, USA), Bax (1:1,000, 2772; Cell Signaling Technology, Inc., Danvers, MA, USA), Bcl-2 (1:1,000, 3498 Cell Signaling Technology, Inc.) and GAPDH (1:5,000, A5060; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at 37°C overnight. Membranes were then incubated with goat anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5,000, ab97080; Abcam, Shanghai, China) at room temperature for 1 h. Protein bands were treated with an enhanced chemiluminescence detection system (ECL; Bio-Rad Laboratories, Inc.), visualized with the ChemiDoc XRS system (Bio-Rad Laboratories, Inc.) and analyzed using Quality One 4.5.2 (Bio-Rad Laboratories, Inc.). Protein expression levels were normalized to GAPDH. ### Luciferase reporter assay 3′UTR of LZTS1 was amplified from cDNA of 293 cells. Oligonucleotides that contained LZTS1 cDNA fragments, including miR-1207-5p binding sites were amplified and cloned into pmirGLO plasmids (Promega Corporation, Madison, WI, USA) to obtain luciferase reporter plasmids, pmirGLO-LZTS1-WT. Mutant LZTS1 (pmirGLO-LZTS1-MUT) acted as a negative control and was obtained by site-directed mutagenesis PCR with platinum pfx DNA polymerase, according to the manufacturer\'s protocol. Cells (3×10^4^) were seeded onto 24-well plates and cultured for 24 h. Then, pmirGLO-LZTS1-WT or pmirGLO-LZTS1-MUT and miR-1207-5p mimics (5′-UGGCAGGGAGGCUGGGAGGGG-3′) or miR-NC mimics (5′-UUCUCCGAACGUGUCACGU-3′) and 3 ng pRL-TK Renilla plasmid were transfected into cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). At 48 h after transfection, a Dual Luciferase Reporter Assay (Promega Corporation) was performed in a luminometer, according to the manufacturer\'s protocol, to examine the relative luciferase activity. ### Flow cytometric analysis Cell apoptosis was detected using an Annexin-V/Dead Cell Apoptosis kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer\'s protocol. In brief, MDA-MB-231 cells were trypsinized and suspended in 1 × annexin binding buffer. Subsequently, propidium iodide (PI) and Annexin V-FITC were added to the cell suspension and cultured for 15 min. Stained cells were analyzed using a FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). ### MTT assay An MTT assay (Invitrogen; Thermo Fisher Scientific, Inc.) was performed to evaluate the cell proliferation rate in each group. In brief, MDA-MB-231 cells were washed with PBS, trypsinized, and seeded onto 96-well plates. Then, MTT reagent (10 µl) was added and plates were incubated in an incubator at 37°C with 5% CO~2~ until purple precipitate was observed. Thereafter, 100 µl dimethylsulfoxide was added to dissolve the formazan crystals and the plates were incubated at 37°C for 2 h in the dark. Absorbance was read at 570 nm by a microplate reader. ### Statistical analysis Data were analyzed using SPSS version v.13 (SPPS, Inc., Chicago, IL, USA) and are expressed as the mean ± standard deviation. Comparisons between two groups were analyzed using Student\'s t-test, and comparisons among multiple groups were analyzed by one-way analysis of variance followed by Student-Newman-Keuls test. The correlation between LZTS1 and miR-1207-5pb was analyzed by Spearman\'s correlation analysis. P\<0.05 was considered to indicate a statistically significant difference. Each experiment was repeated three times. Results ======= ### miR-1207-5p expression was significantly elevated in MDA-MB-231 cells TNBC is the most aggressive breast cancer sub-type with a high possibility of metastasis ([@b3-ol-0-0-9687]). Moreover, TNBC is unresponsive to any hormonal treatment, making TNBC difficult to treat ([@b4-ol-0-0-9687],[@b5-ol-0-0-9687]). Therefore, there is an urgent need to identify novel therapeutic targets for TNBC, our study focused only on TNBC, and we chose TNBC MDA-MB-231, MDA-MB-436 and MDA-MB-453 cell lines for our study instead of ER+, PR+/-, HER2- T47D or MCF7 cells despite of their response to chemotherapy ([@b15-ol-0-0-9687],[@b16-ol-0-0-9687]). We evaluated the expression of miR-1207-5p in TNBC MDA-MB-231, MDA-MB-436 and MDA-MB-453 cell line. Compared with normal MCF-10A cells, miR-1207-5p expression was increased in MDA-MB-436 and MDA-MB-453 cells (P\<0.05). However, the greatest increase in the miR-1207-5p expression level was in MDA-MB-231 cells (P\<0.01; [Fig. 1A](#f1-ol-0-0-9687){ref-type="fig"}). Therefore, the MDA-MB-231 cells were selected for our research model. The effect of antagomiR-1207-5p on miR-1207-5p expression was evaluated in MDA-MB-231 cells by RT-qPCR. There was no significant difference in miR-1207-5p expression between the control group and the antagomiR-NC group. However, the expression level of miR-1207-5p was significantly decreased after treatment with antagomiR-1207-5p, compared with expression in the antagomiR-NC group (P\<0.01; [Fig. 1B](#f1-ol-0-0-9687){ref-type="fig"}). Since miR-1207-5p was found to be up-regulated in the MDA-MB-231 cells compared with expression in the MCF-10A cells, this suggested an oncogenic role of miR-1207-5p in TNBC. Therefore, using the online software programs TargetScan 6.2, we aimed to identify target mRNAs of miR-1207-5p that functioned as tumor suppressor factors during tumor progression. ### LZTS1 was a direct target for miR-1207-5p LZTS1 was previously found to be decreased in cutaneous squamous cell carcinoma ([@b17-ol-0-0-9687]) and osteosarcoma ([@b18-ol-0-0-9687]), and was identified to suppress colorectal cancer proliferation ([@b19-ol-0-0-9687]). Moreover, LZTS1 reduction conferred Taxol resistance and was associated with a poor prognosis in patients with breast cancer ([@b20-ol-0-0-9687]). Additionally, loss of LZTS1 contributed to the lymph node metastasis of breast invasive micropapillary carcinoma ([@b21-ol-0-0-9687]). Notably, LZTS1 was predicted to be a potential target for miR-1207-5p in our study, and the predicted binding sites between LZTS1 and miR-1207-5p are presented in [Fig. 2A](#f2-ol-0-0-9687){ref-type="fig"}. The interaction between LZTS1 and miR-1207-5p was verified by luciferase reporter assay. There was a significant reduction in luciferase activity in cells transfected with pmirGLO-LZTS1-WT and miR-1207-5p mimics compared with activity in cells transfected with pmirGLO-LZTS1-WT and miR-NC mimics (P\<0.01). Meanwhile, no significant difference was found between cells transfected with pmirGLO-LZTS1-MUT and miR-NC mimics or pmirGLO-LZTS1-MUT and miR-1207-5p mimics, as presented in [Fig. 2B](#f2-ol-0-0-9687){ref-type="fig"}. Based on these results, we inferred that miR-1207-5p regulated LZTS1. However, antagomiR-1207-5p could not bind to LZTS1, this luciferase reporter assay cannot demonstrate 'direct interaction' of molecules, which was a limitation. The function of miR-1207-5p and LZTS1 in the sensitivity of TNBC to Taxol has not been studied previously. Therefore, the present study carried out experiments to investigate this. ### LZTS1 expression was repressed by miR-1207-5p The influence of miR-1207-5p on the mRNA and protein expression level of LZTS1 was evaluated by RT-qPCR and western blotting, respectively. The results demonstrated that, compared with cells in the antagomiR-NC group, there was a significantly higher protein expression level ([Fig. 3A](#f3-ol-0-0-9687){ref-type="fig"}) as well as mRNA level (P\<0.01; [Fig. 3B](#f3-ol-0-0-9687){ref-type="fig"}) of LZTS1 in cells transfected with antagomiR-1207-5p. These results suggested that miR-1207-5p inhibited the expression of LZTS1. ### AntagomiR-1207-5p enhanced the Taxol-induced reduction in cell proliferation and increase in cell apoptosis As presented in [Fig. 4](#f4-ol-0-0-9687){ref-type="fig"}, compared with the control group, Taxol significantly reduced the cell proliferation rate (P\<0.01), which was further reduced by the co-administration of Taxol and antagomiR-1207-5p (P\<0.01). As presented in [Fig. 5A and B](#f5-ol-0-0-9687){ref-type="fig"}, compared with the control group, Taxol significantly increased the cell apoptosis rate (P\<0.01), which was further increased by the co-administration of Taxol and antagomiR-1207-5p (P\<0.01). These results regarding the effects of miR-1207-5p on cancer cell proliferation and apoptosis were consistent with those of a previous report ([@b12-ol-0-0-9687]). ### AntagomiR-1207-5p enhanced Taxol-induced Bax upregulation, and Bcl-2 and p-Akt downregulation According to the aforementioned findings, we inferred that miR-1207-5p affected cell proliferation and apoptosis after Taxol treatment. However, the molecules that were regulated by miR-1207-5p were unknown. Therefore, we investigated pathways or molecules that were associated with cell proliferation and apoptosis. We found that the PI3K/Akt signaling pathway is important in regulating cell proliferation, migration, apoptosis, and angiogenesis ([@b22-ol-0-0-9687],[@b23-ol-0-0-9687]); meanwhile, the Bcl-2 protein family including Bax (pro-apoptosis) and Bcl-2 (anti-apoptosis), takes part in the apoptotic process ([@b24-ol-0-0-9687]). Therefore, we wanted to investigate whether expression of Bax, Bcl-2 and p-Akt could be influenced by miR-1207-5p after administration of Taxol. We detected the protein expression of p-Akt, Bax and Bcl-2 after antagomiR-1207-5p treatment in MDA-MB-231 cells. The results indicated that, compared with the control group, Taxol induced notable up-regulation of Bax, and downregulation of Bcl-2 and p-Akt (P\<0.01), which was further induced by the co-administration of antagomiR-1207-5p (P\<0.01; [Fig. 6A-D](#f6-ol-0-0-9687){ref-type="fig"}). These results suggested that miR-1207-5p functioned through regulation of apoptosis-related pathways and molecules via regulating the expression of LZTS1. The role of miR-1207-5p in regulating the expression of LZTS1 was evidenced by the results as follows: 1. Luciferase assay; 2. the elevated mRNA/protein levels of LZTS1 after AntagomiR-1207-5p treatment. ### miR-1207-5p was negatively correlated with LZTS1 in TNBC patients We investigated whether there were differences in miR-1207-5p and LZTS1 expression levels between the adjacent normal tissues and tumor tissues from TNBC patients using RT-qPCR. As shown in [Fig. 7A and B](#f7-ol-0-0-9687){ref-type="fig"}, miR-1207-5p expression was significantly increased (P\<0.01), while LZTS1 expression was significantly decreased (P\<0.01) in tumor tissues compared with normal adjacent tissues. Moreover, there was a negative correlation between miR-1207-5p and LZTS1 expression (P=0.0031, r=−0.5222; [Fig. 7C](#f7-ol-0-0-9687){ref-type="fig"}). ### Elevated miR-1207-5p and reduced LZTS1 in Taxol non-responsive TNBC tissues Among the 30 TNBC patients, we found that there were 18 TNBC patients who responded to Taxol and 12 patients who were non-responsive to Taxol. Furthermore, we evaluated the expression of miR-1207-5p and LZTS1 in Taxol-responsive and Taxol non-responsive TNBC tissues. The results demonstrated that, compared with Taxol-responsive TNBC tissues, there was a significant elevation in the expression of miR-1207-5p (P\<0.01; [Fig. 8A](#f8-ol-0-0-9687){ref-type="fig"}) and a significant reduction in the expression of LZTS1 (P\<0.01; [Fig. 8B](#f8-ol-0-0-9687){ref-type="fig"}) in the Taxol non-responsive TNBC tissues. Discussion ========== Due to the lack of ER, PR and HER2 expression, TNBC is unresponsive to any hormonal treatment ([@b2-ol-0-0-9687],[@b5-ol-0-0-9687]). Although there have been multiple effective treatment strategies developed for breast cancer, TNBC patients are commonly treated with chemotherapy agents, such as Taxol ([@b6-ol-0-0-9687]), resistance to which makes TNBC patients more susceptible to relapse ([@b7-ol-0-0-9687]). Therefore, there is an urgent requirement to identify novel therapeutic targets. Decreases in tumor suppressor miRNAs or increases in onco-miRNAs are known to be involved in the pathogenesis of human cancer ([@b25-ol-0-0-9687]). MiRNAs also have the potential to be therapeutic targets ([@b10-ol-0-0-9687]). MiR-1207 was identified to be up-regulated in younger breast cancer patients ([@b11-ol-0-0-9687]) and colorectal cancer patients ([@b13-ol-0-0-9687]), and overexpression of miR-1207 also promoted the cancer stem cell-like traits of ovarian cancer ([@b12-ol-0-0-9687]). These reports suggest a potential oncogenic role of miR-1207 in cancer. Moreover, a previous report about the effects of miR-1207-5p expression in peripheral blood on cisplatin-based chemosensitivity in primary gallbladder carcinoma patients, indicating the lower miR-1207-5p expression in effective group than in the ineffective group after chemotherapy ([@b26-ol-0-0-9687]), suggesting its role in chemosensitivity. Therefore, the present study first detected the expression level of miR-1207-5p in normal MCF-10A cells and TNBC MDA-MB-436, MDA-MB-453 and MDA-MB-231 cell lines, and found that, compared with normal MCF-10A cells, there was a higher miR-1207-5p expression level in the TNBC cell lines, with the highest level being observed in the MDA-MB-231 cells. This suggested an oncogenic role for miR-1207-5p in TNBC. Therefore, we aimed to identify the target mRNAs that functioned as tumor suppressor factors during tumor progression for miR-1207-5p using the online software programs TargetScan 6.2. LZTS1 was found to be decreased in cutaneous squamous cell carcinoma ([@b17-ol-0-0-9687]) and osteosarcoma ([@b18-ol-0-0-9687]), suggesting a tumor suppressor role for LZTS1 in cancer. Interestingly, the tumor-suppressor gene LZTS1 suppressed colorectal cancer cell proliferation through inhibition of the Akt/mTOR signaling pathway ([@b19-ol-0-0-9687]), and inhibited hepatocellular carcinoma cell proliferation through inhibition of the PI3K/Akt signaling pathway ([@b27-ol-0-0-9687]). LZST1 reduction was correlated with a poor prognosis, increased cell motility/invasion and epithelial-to-mesenchymal transition of breast carcinoma ([@b28-ol-0-0-9687]). Meanwhile, LZST1 reduction conferred Taxol resistance and was associated with a poor prognosis in breast cancer ([@b20-ol-0-0-9687]). However, there was no report about the relationship between miR-1207-5p and LZTS1. In the present study, LZTS1 was first predicted and verified to be a potential target for miR-1207-5p. The function of miR-1207-5p and LZTS1 in the sensitivity of TNBC cells to Taxol treatment has not yet been elucidated. Therefore, we carried out experiments to investigate this. Compared with the control group, Taxol dramatically reduced the cell proliferation rate and increased the cell apoptosis rate in MDA-MB-231 cells. These effects were further promoted by the co-administration of Taxol and antagomiR-1207-5p. Accordingly, we inferred that miR-1207-5p affected cell proliferation and apoptosis after Taxol treatment. However, it was unknown which molecules could be regulated by miR-1207-5p or LZTS1. We investigated signaling pathways or molecules that were correlated with cell proliferation and apoptosis. LZTS1 suppressed the proliferation of colorectal cancer and hepatocellular carcinoma cells by inhibiting the Akt/mTOR signaling pathway ([@b19-ol-0-0-9687]) and the PI3K/Akt signaling pathway ([@b27-ol-0-0-9687]), respectively. Bax and Bcl-2 are involved in the apoptotic process ([@b24-ol-0-0-9687]). Therefore, we tested the protein levels of Bax and Bcl-2, as well as the activation level of p-Akt by western blotting. Up-regulation of Bax, and downregulation of Bcl-2 and p-Akt, was observed after transfection of antagomiR-1207-5p compared with the control and Taxol groups. This suggested that miR-1207-5p functioned through regulating apoptotic-related pathways and molecules via regulating the expression of LZTS1. A significant increase in miR-1207-5p expression and a decrease in LZTS1 expression were observed in TNBC tissues compared with normal adjacent tissues. Additionally, there was a negative correlation between miR-1207-5p and LZTS1 expression. Moreover, in comparison with Taxol-responsive TNBC tissues, there was a notable elevation in miR-1207-5p expression and a reduction in LZTS1 expression in non-responsive TNBC tissues. Compare with the literature that previously reported LZTS1 gene as tumor suppressor gene related to paclitaxel resistant in cancer therapy in, our results was consistent with it ([@b20-ol-0-0-9687]). In conclusion, miR-1207-5p may be a promising predictor of sensitivity to Taxol in TNBC. Our study showed the novelty of the interaction of miR-1207-5p regulating the LZTS1 gene expression and therefore, its role in taxol sensitivity. Unfortunately, there are limitations of our study: 1. The absence of data on breast cancer cell lines that are not of the triple negative subtype; 2. the use of a single TNBC cell line; 3. miR-1207-5p may target not only LZTS1 but also other molecules critical for MDA-MB-231 cell proliferation, apoptosis and TNBC development. Comprehensive gene expression analysis of these cells with or without miR-1207-5p inhibitor should be performed in future studies to understand its real effects. Not applicable. Funding ======= No funding was received. Availability of data and materials ================================== The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. Authors\' contributions ======================= XH, ZN and LL performed the experiments and analyzed the data. QG, HL and XY conducted the experiments. XZ conceived the study, analyzed the data and prepared the manuscript. Ethics approval and consent to participate ========================================== Written informed consent was obtained from each patient. The present study was conducted in accordance with Declaration of Helsinki and was approved by the Institutional Review Board of Linfen People\'s Hospital (Shanxi, China). Patient consent for publication =============================== Not applicable. Competing interests =================== The authors declare that there were no competing interests. {#f1-ol-0-0-9687} {#f2-ol-0-0-9687} {#f3-ol-0-0-9687} {#f4-ol-0-0-9687} {#f5-ol-0-0-9687} {#f6-ol-0-0-9687} {#f7-ol-0-0-9687} {#f8-ol-0-0-9687}

INTRODUCTION {#sec1-1} ============ Psoriasis is a chronic hyperproliferative inflammatory disease of the skin, scalp, nails, and joints that present in several clinical forms. The prevalence of psoriasis varies widely among different groups and in different parts of the world (0.1--3%).\[[@ref1][@ref2]\] The prevalence of psoriasis in Kashmir has been estimated to be about 3.4%.\[[@ref3]\] Psoriasis has a multifactorial etiology, involving environmental (infections, drugs, stress, smoking, and climate) and genetic factors. Currently, 41 genetic susceptibility loci for psoriasis have been established at genome-wide level of significance (*P* \< 5 × 10^−8^).\[[@ref4][@ref5][@ref6][@ref7][@ref8][@ref9][@ref10][@ref11][@ref12][@ref13]\] Among these, the psoriasis susceptibility (*PSORS*)1 locus on chromosome 6p21 is the one most strongly associated with psoriasis. Recent studies have demonstrated the association of a common deletion of late cornified envelope genes *LCE3B* and *LCE3C* (in the region that contains the *PSORS4* locus on chromosome 1q21), with psoriasis in several populations.\[[@ref14][@ref15][@ref16][@ref17]\] These genes form a part of the epidermal differentiation complex, a cluster of genes that encodes proteins found in the stratum corneum. These proteins are of great importance for keratinocyte differentiation and skin barrier maintenance. The late cornified envelope proteins are incorporated into the cornified envelope late in the process of maturation during epidermal differentiation; hence the name. The *LCE* gene cluster consists of 18 members which are divided into 6 families *LCE1-6*.\[[@ref18]\] The expression of late cornified envelope genes is induced following skin barrier disruption even in individuals who normally lack the mRNA for these genes, thus helping in the restoration of the skin barrier.\[[@ref19]\] Individuals homozygous for *LCE3C_LCE3B-del* fail to mount this response thus conferring a higher risk for the development of psoriasis. This study was conducted to establish a correlation between *LCE3C_LCE3B* deletion and psoriasis susceptibility in ethnic Kashmiri population of North India. MATERIALS AND METHODS {#sec1-2} ===================== This was a hospital based, case-controlled study conducted on patients attending the out-patient unit of our department over a period of 1 year (from April 01, 2012 to March 31, 2013). The recruitment process was started only after ethical clearance from the Institutional Ethical Committee as per norms and all the individuals gave their informed consent to participate. A total of 100 clinically typical cases of psoriasis from the ethnic Kashmiri population and an equal number of age and gender matched controls comprising of patients presenting to our department for some other unrelated insignificant complaint, the hospital staff, and healthy volunteers were included in the study. Patients diagnosed with arthritis prior to psoriasis and non-Kashmiri population was excluded from the study. A detailed history was taken from all patients, and a complete clinical examination was carried out. The severity of disease was assessed on the basis of psoriasis area and severity index (PASI). PASI ranges from 0 to 72 with PASI \> 10 recognized as indicative of severe disease. In addition, routine investigations, wherever deemed necessary, were carried out. The blood samples from the psoriasis patients and controls were obtained and were collected in 5 ml collection vials containing ethylenediaminetetraacetic acid and immediately stored at −80°C. Genomic DNA from the blood samples was isolated using a kit based method \[[Figure 1](#F1){ref-type="fig"}\]. The kit used was quick-g DNA^™^ MiniPrep supplied by Zymo Research (India). The integrity of the genomic DNA was examined by gel electrophoresis using 1% agarose gel. The quantity of the DNA was determined by measuring optical density at 260 and 280 nm by double beam spectrophotometer. To determine the *LCE3C_LCE3B-del* genotype, we performed a three-primer polymerase chain reaction (PCR) assay in 100 psoriasis cases and 100 controls. The *LCE3B* fragment was 422bp long and was amplified with primers GGGCTTCATAAAACCATTTGTAGAG (forward) and TTTCCTCTAAAGTCGCTTGTCTCA (reverse). The *LCE3C* was a 448bp fragment amplified with primers GGTCTGAGGGTTCTGTGCTCA (forward) and TCTGGAAAAGCATGCATCAGG (reverse). Genomic DNA from patients and controls was PCR-amplified in a single tube containing each of *LCE3F* (forward), *LCE3CR* (reverse), and *LCE3CR2D* (reverse) primers. The PCR approach was described previously by de Cid *et al*.\[[@ref19]\] and was used to amplify nondeletion allele and deletion allele. The principle of this PCR method lies in the amplification of the nondeletion allele visualized as a fragment of 240 bp (*LCE3CF-LCE3CR* product), and the deletion as a fragment of 199 bp (*LCE3CF-LCE3CR2D* product). PCR amplification was achieved using a thermal cycler (gradient thermal cycler from Eppendorf Mastercycler Pro). Reactions were hot-started at 95°C for 5 min, followed by addition of Taq polymerase, followed by 35 cycles of melting (95°C for 30 s), annealing (60°C for 30 s) and extension (72°C for 30 s) and by final extension step at 72°C for 4 min. After amplification, 10 µl of each reaction were electrophoresed on 2% agarose gel, stained with ethidium bromide, in which the deletion and nondeletion alleles were visualized as a fragment of 199 and 240 bp, respectively. {#F1} Categorical variables were analyzed using Chi-square test and quantitative variables presented as a mean ± standard deviation. *P* \< 0.05 was considered to be statistically significant. RESULTS {#sec1-3} ======= The study comprised 100 psoriasis patients, 69 (69%) being males and 31 (31%) being females with a male: female ratio of 2.2:1. The age of the cases ranged from 9 to 65 years with a mean age of 35.67 ± 14.21 years. Of the 100 controls, 64 were males and 36 were females with a mean age of 31.23 ± 12.32 years (range: 12--58 years). The age of onset of psoriasis was ≤40 years in 75 (75%) patients, and 25 (25%) patients developed the disease for the 1^st^ time at an age of more than 40 years. The duration of disease in the cases ranged from 6 days to 27 years and the mean duration of disease was 6.3261 ± 6.06 years. A family history of psoriasis was reported by a total of 14 (14%) patients, of which 8 (57.2%) were males and 6 (42.8%) were females. First-degree relatives were affected in 9 (64.3%) of 14 patients. Various types of psoriasis seen in our study included chronic plaque psoriasis which was seen in 87 (87%) patients, guttate psoriasis is seen in 6 (6%) patients, pustular psoriasis in 3 (3%) patients, and erythrodermic psoriasis in 4 (4%) patients. Nail changes were observed in 38 (38%) patients. The PASI score was more than 12 in 23 (23%) patients and \<12 in 77 (77%) patients. Genomic DNA was successfully isolated from all 200 samples (100 cases and 100 controls). The genotype for the common *LCE3C_LCE3B* deletion in 100 psoriasis patients and 100 controls was determined \[[Figure 2](#F2){ref-type="fig"}\]. {#F2} Genotype and allele frequencies for the *LCE3C_LCE3B-del* in patients and controls are given in [Table 1](#T1){ref-type="table"}. ###### Genotype frequencies for the *LCE3C_LCE3B-del* among cases and controls  Genotype frequencies for the LCE3C_LCE3B-del were compared between sporadic and familial cases, between patients with early onset and those with late onset psoriasis and between patients with severe and those with nonsevere psoriasis. Comparison of genotype frequencies among different groups is given in [Table 2](#T2){ref-type="table"}. ###### Comparison of genotype frequencies for *LCE3C_LCE3B-del* among different groups  The difference in genotype frequencies was analyzed using the Chi-square test. Hardy--Weinberg test for equilibrium: The observed values for genotype frequencies were as follows - D/D (0.43), I/D (0.4), I/I (0.17) against the expected genotype frequencies of 0.4,0.5 and 0.1, respectively, with a *χ*^2^ test *P* = 0.88. Hence, the observed genotype frequencies were consistent with Hardy--Weinberg equilibrium. DISCUSSION {#sec1-4} ========== Psoriasis is a chronic hyperproliferative inflammatory disease of the skin with a prevalence of 0.1--3% in different parts of the world.\[[@ref1][@ref2]\] Psoriasis has a multifactorial etiology with a polygenic mode of inheritance.\[[@ref20]\] The *LCE3C_LCE3B-del* leads to a compromised skin barrier function which may play a significant role in the development of psoriasis,\[[@ref21]\] as demonstrated in several Caucasian populations. The results of these studies, however, cannot be generalized to non-Caucasians. The present study was undertaken to establish a correlation between *LCE3C_LCE3B* deletion and psoriasis susceptibility in ethnic Kashmiri population of North India. The age of the patients in this study ranged from 9 to 65 years with a mean age of 35.67 ± 14.21 years. Males constituted 69% of the patients in our study with a male: female ratio of 2.2:1. It is generally believed that psoriasis is equally common in males and females.\[[@ref22]\] In a study where comprehensive data was collected from various medical colleges in India, the ratio of male: female in psoriatic patients was very high (2.46:1) which could not be clearly accounted for.\[[@ref23]\] In another prevalence study of psoriasis from North India, male: female sex ratio was found to be 2.5:1.\[[@ref24]\] Similar results were replicated in other studies.\[[@ref25][@ref26]\] Hence, it can be inferred that in India, psoriasis is twice more common in males compared to females. The majority of patients (47%) belonged to the age group of 20--40 years. The age of onset of psoriasis was \<40 years in 74% of patients and more than 40 years in 26% of patients. A bimodal age of onset of psoriasis has been recognized in several large studies. Henseler and Christophers reported two clinical presentations of psoriasis, Type I and II distinguished by a bimodal age at onset where Type 1 begins on or before age 40 years; Type II begins after the age of 40 years and Type I disease accounts for more than 75% of cases.\[[@ref27][@ref28]\] A family history of psoriasis was reported by 14% of patients in our study. First-degree relatives were affected in 9 (64.3%) out of 14 patients. Of patients with psoriasis, 36--71% have one relative who is also affected by psoriasis.\[[@ref29]\] Indian studies, however, report a lower familial incidence of the disease. Bedi reported a positive family history of psoriasis in 14% of their patients while Kaur *et al*. reported family history in only 2% of their patients with first degree relatives being affected in 84% of the cases and second-degree relatives in 12% of cases.\[[@ref25][@ref26]\] The most common type of psoriasis encountered in this study was chronic plaque psoriasis seen in 87% of patients followed by guttate psoriasis seen in 6% of patients. Chronic plaque psoriasis is the most common form of psoriasis, occurring in about 80% of all psoriasis patients. Bedi and Kaur *et al*. reported chronic plaque psoriasis in 90% and 93% of their cases, respectively while guttate, pustular, and erythrodermic psoriasis were uncommon accounting for \<2% of cases.\[[@ref25][@ref26]\] In our study, the homozygous deletion (D/D) genotype frequency was higher among psoriatic patients compared to controls (43% vs. 35%) although the difference did not reach statistical significance (*P* = 0.507). de Cid *et al*. found a significantly higher frequency of D/D homozygotes among the patients (total D/D frequency, 0.45 in patients vs. 0.34 in controls; odds ratio = 2.04, 95% confidence interval = 1.59--2.62, *P* = 1.71e-08).\[[@ref19]\] This was further confirmed by Hüffmeier *et al*. in individuals of German origin.\[[@ref15]\] We did not find this difference when the psoriasis patients were compared to controls. However, in agreement with these authors, the D/D genotype was more frequent among patients with psoriasis. A small study in North African population failed to detect any evidence of an association between *LCE3C_LCE3B-del* and psoriasis.\[[@ref30]\] Wiwanitkit did a summative meta-analysis of the case-control studies of the frequency of *LCE3C_LCE3B-del* genotype among patients with psoriasis and controls and found that there is no relationship between *LCE3C_LCE3B-del* genotype and psoriasis.\[[@ref31]\] A meta-analysis including 12,196 psoriatic patients and 13,092 controls from 19 comparative studies, conducted by Song *et al*. however demonstrated a significant association between psoriasis and *LCE3C_LCE3B-del* polymorphism in Europeans and Asians.\[[@ref32]\] On comparing the genotype frequencies for the *LCE3C_LCE3B-del* between sporadic and familial cases, the D/D frequency was higher (50%) among familial cases compared to sporadic cases (44.2%). The difference, however, was not statistically significant (*P* = 0.719). Coto *et al*. found a higher D/D frequency of 39% among sporadic cases compared to familial cases where the D/D frequency was only 24%.\[[@ref14]\] In a study\[[@ref33]\] in Tunisian psoriatic population, frequency of the *LCE3C_LCE3B-del* was similar between patients and healthy controls but subanalyses by family history revealed that the frequency of *LCE3C_LCE3B-del* was significantly higher in patients with a positive family history than in control individuals, as well as in individuals with a positive family history versus those without family history in the case cohort. Xu *et al*.\[[@ref16]\] also found a significant difference in deletion frequency between patients with a positive family history and controls. The D/D genotype for *LCE3C_LCE3B-del* occurred in a frequency of 41.9% in patients with early onset psoriasis and 46.2% in patients with late onset psoriasis in our study. The *LCE3C_LCE3B-del* does not appear to be related to early onset of disease in our population. Coto *et al*.,\[[@ref14]\] Hüffmeier *et al*.\[[@ref15]\] and Li *et al*.\[[@ref17]\] also found that the deletion was not significantly associated with the age of disease onset. Xu *et al*.\[[@ref16]\] however found that *LCE3C_LCE3B* D/D frequency was significantly different between patients with early-onset psoriasis and controls. Among the 23 patients with severe form of psoriasis, D/D genotype for *LCE3C_LCE3B-del* was seen in 52.8% of cases. This was much higher compared to the D/D frequency in patients with a nonsevere form of psoriasis (40.2%). This implies that cases with a common deletion of *LCE3C_LCE3B* genes may be at risk of developing more severe forms of psoriasis. The difference, however, when compared statistically was not found to be significant (*P* = 0.530). This finding is supported by a previous study\[[@ref34]\] where the del/del genotype frequency between these two groups was compared, and no difference was observed between the two groups. From our study, no significant association was found between *LCE3C_LCE3B* deletion and the risk of psoriasis in general. However, further studies with larger sample size need to be carried out in our population to find the exact correlation between *LCE3C_LCE3B* deletion and susceptibility to psoriasis. Financial support and sponsorship {#sec2-1} --------------------------------- Nil. Conflicts of interest {#sec2-2} --------------------- There are no conflicts of interest.

The manufacture of fibres and films from cellulose by the viscose process has been known for more than a hundred years. Even today, almost all cellulose-based fibres are manufactured by the viscose method. It is a known method, by which various properties of the final product are achieved by varying the material and process parameters. However, the viscose method involves significant drawbacks: the preparation of the spinning solution includes laborious work stages, the carbon disulphide used for the dissolution is toxic, inflammable and combustible, and it is difficult to recover. Furthermore, some of the carbon disulphide is decomposed to hydrogen sulphide, which is also toxic and explosive. In addition, the viscose solution is an unstable product, whereby it cannot be stored as an intermediate product, but all the steps of the manufacture must be taken without a delay from the beginning to the end, keeping the mass at a low temperature. Several attempts are known to replace the viscose method with a more ecological method. The most promising one has been the conversion of cellulose to cellulose carbamate by means of urea (see, for example, D. Klemm et al., Comprehensive Cellulose Chemistry, Wiley-VCH 1998). In spite of its obvious advantages and several known attempts, this method has, however, remained on the laboratory scale. Reasons have included problems in the homogeneity of the product, the recovery and residues of organic auxiliary agents (e.g. hydrocarbon) and/or solvents (normally ammonia) used, the properties of the final products (primarily fibres), which have been not more than satisfactory, and the operation costs of the methods developed. Known attempts to provide a method for manufacturing cellulose carbamate have been based on the soaking of pulp sheets in an alkaline solution (mercerization), which has, in some cases, included an addition of ammonia and/or other solvents or accelerators. After the mercerization, the pulp, partly dried by compressing, is treated in a urea solution, which may include an addition of an alkalizing agent, normally also ammonia and possible solvents or salts. Finally, the reaction between urea and the pulp is carried out in an oven at a temperature of about 130° C. The methods have required the best viscose cellulose whose DP level has been reduced, for example, by long-term curing in a mercerization solution or by irradiation in advance. Examples of the above-described processes are presented in patents FI 61033, EP 0 402 606 and WO 00/08060. One of the first attempts to manufacture cellulose carbamate is presented in U.S. Pat. No. 2,134,825. It uses the aqueous solution of urea and sodium hydroxide, with which the pulp sheets are first impregnated. After the impregnation, settling and compression, the mass is dried and heated in the oven to achieve a reaction between the cellulose and urea. The patent presents a number of chemicals to improve the absorption and to reduce the gelling tendency of the solution. This patent also presents the use of hydrogen peroxide for the purpose of reducing the viscosity of the solution. However, pulps manufactured on the basis of the patent have been only partly soluble in such a way that a large quantity of unreacted fibres is left in the solution, jamming the spinning nozzle. This is probably due to the unevenness of the substitution. In all known methods for manufacturing cellulose carbamate, an alkaline solution (aqueous sodium hydroxide) is used for activating (swelling) the pulp, as in conventional mercerization of pulp. An exception to this, U.S. Pat. No. 2,134,825 experiments the use of hydrogen peroxide with and without sodium hydroxide to activate the pulp for the purpose of reducing the viscosity of the solution. Cellulose carbamate is alkali soluble at a substitution degree of 0.2 to 0.3. The formation of cellulose carbamate begins when the mixture of cellulose and urea is heated to a temperature exceeding the melting point of the latter (133° C.). When heated, urea is decomposed to isocyanic acid and ammonia according to the following reaction formula:NH2—CO—NH2→HN═C═O+NH3 Isocyanic acid is very reactive and it forms carbamates with the hydroxy groups of cellulose as follows:Cell-OH+H—N═O→Cell-O—CO—NH2 Possible side reactions include the reaction of urea and isocyanic acid to a biuret, or the formation of cyanuric acid and other polymerization products of isocyanic acid.

Q: how to use Linq to get a sitecore field I have a search that I'm wanting to exclude any search result that has the name of the "Title" field in the search. For example, say I type in "Contact" in the search bar. I don't want the Contact Us page to come up, but if someone wants to search something that has words in the Contact Us page, then its ok. I am able to get templateName and IDs but can't seem to get fields... Item homeItem = Main.Utilities.SitecoreUtils.getHomeItem(); var query = PredicateBuilder.True<SearchResultItem>(); query = query.And(i => i.Paths.Contains(homeItem.ID)); query = query.And(i => i.Content.Contains(searchTerm)); query = query.And(i => i.TemplateName != "MenuFolder"); This is what I have, but I want to add something to it to exclude the "Title" field and maybe the "SEO" field. So probably something like: query = query.And(i => i.Fields["Title"]; But in this case its including not excluding it. And I can't do: query = query.And(i != i.Fields["Title"]; It won't accept that answer. A: Try to use code like that i => !i["Title"].Contains(searchTerm): Item homeItem = Main.Utilities.SitecoreUtils.getHomeItem(); var query = PredicateBuilder.True<SearchResultItem>(); query = query.And(i => i.Paths.Contains(homeItem.ID)); query = query.And(i => i.Content.Contains(searchTerm)); query = query.And(i => i.TemplateName != "MenuFolder"); query = query.And(i => !i["Title"].Contains(searchTerm)); A: If you want to strongly type it, you just need to extend the SearchResultItem class with your field name. public class SitecoreItem : SearchResultItem { [IndexField("title")] public string Title { get; set; } [IndexField("__smallcreateddate")] public DateTime PublishDate { get; set; } [IndexField("has_presentation")] public bool HasPresentation { get; set; } } Then your code would be like this IQueryable<SitecoreItem> query = context.GetQueryable<SitecoreItem>(); SearchResults<SitecoreItem> results = null; query = query.Where(x => x.Title.Contains(searchText); results = query.GetResults();

Bohemians 1905 Bohemians Praha 1905 (previously named FC Bohemians Praha) is a Prague-based football club, which was founded in 1905 as AFK Vršovice. The club won the 1982–83 Czechoslovak First League, its only league championship. Its colours are green and white. The best known player from Bohemians' history is Antonín Panenka, who is now the club chairman. Bohemians' mascot is a kangaroo, the legacy of a 1927 tour of Australia. Following the tour, the club was awarded two live kangaroos, which they donated to the Prague Zoo. History Founded as AFK Vršovice, the club played at the top level of football in the Czechoslovak First League between 1925 and 1935. They spent seasons in and out of the top division for the next 40 years before remaining in the top flight between 1973 and 1995, the most successful era for the club. In the 1982–83 season the club won the Czechoslovak First League and advanced to the semi-finals of the UEFA Cup. In the year 2005 it survived a crisis, which was a consequence of bad management. The club was prevented from taking part in the second part of the 2004–05 Czech 2. Liga and its results were expunged. The club was relegated to the 3rd Czech division due to its financial insolvency, but later was saved by its fans who paid off a portion of the club's debts. The club finished third in the 2005–06 Bohemian Football League, missing out on promotion, but advanced to the Second League regardless, as they bought a license to play in the Second League from SC Xaverov. The club was then able to advance back to the top flight in 2007, where they played until relegation in 2012. After only one season in 2. Liga Bohemians returned to the First League in 2013. Historical names 1905: AFK Vršovice 1927: Bohemians AFK Vršovice 1941: Bohemia AFK Vršovice 1945: Bohemians AFK Vršovice 1948: Sokol Vršovice Bohemians 1949: Sokol Železničaři Bohemians Praha 1950: Sokol Železničaři Praha 1951: Sokol ČKD Stalingrad Praha 1953: Spartak Praha Stalingrad 1962: ČKD Praha 1965: Bohemians ČKD Praha 1993: Bohemians Praha 1999: CU Bohemians Praha 2001: FC Bohemians Praha 2005: Bohemians 1905 2013: Bohemians Praha 1905 Australia Tour In 1927 Australian football officials were looking for a European football club to come and tour. They decided on Czechoslovakia and approached Slavia Prague and Viktoria Žižkov who both declined. AFK Vršovice took up the offer. Before leaving the team looked for a suitable name as they felt the Australians would not know where Vršovice was, never mind say it. They decided on Bohemians, taking the English spelling of the name, as it resembled the country they were from. Matches Played 4:2 British Army XI Colombo (Ceylon (Now Sri Lanka) 11:3 Western Australia, Perth 6:4 Western Australia, Perth 11:1 Southern Australia, Adelaide 2:1 Australia Repr. XI, Adelaide 1:0 Victoria Melbourne, Melbourne 4:1 Australia Repr. XI, Melbourne 9:0 Wagga-Wagga XI, Wagga-Wagga 4:5 New South Wales, Sydney 2:1 Illawara District, Wollongong 4:3 New South Wales XI, Newcastle 6:4 Australia, Sydney 2:3 Australia, Brisbane 5:5 Australia, Brisbane 1:3 Maitland, Maitland 5:3 Quensland, Ipswich 5:3 Metropolis, Sydney 4:4 Australia, Sydney 3:2 Western Australia, Perth Naming dispute with FK Bohemians In 1993, Bohemians 1905 broke away from the TJ Bohemians Praha sports franchise and became a separate legal entity. The club functioned normally until financial troubles came up and the club nearly collapsed in 2005. TJ Bohemians took advantage of the situation and rented out the Bohemians logo to FC Střížkov Praha 9, a lowly team in the third tier of Czech football. TJ were able to pour money into the small club and help them rise to the first division. However, fans remained loyal to the Bohemians 1905 team, and helped the large club to recover. In September 2012, a Czech court ruled that the former Střížkov club must not continue to use the name Bohemians after 31 January 2013. However, in December 2012, the club was granted the right to appeal against the decision, thus protracting the process yet further. Stadium The home stadium, located in Vršovice, is called Ďolíček. However, from the 2010–11 season, for a period of five years, Bohemians undertook to play its home matches at Synot Tip Arena. This arrangement was discontinued in 2012 after the club was relegated from the Czech First League, due to the regulations on stadiums being different between the two leagues. Supporters and rivalries Bohemians are one of the most popular clubs in the Czech Republic. The club is one of the few in the country to have fans with a left-wing ideology, although most fan groups identify themselves as apolitical, and there are supporters who are right-wing. The ultras group is one of the strongest in terms of choreographies and visual displays in the country. They maintain friendly contacts with Dubliners Bohemian FC, in the past they had friendships with FC St. Pauli and Górnik Wałbrzych. The most prestigious match is the derby with Slavia Prague. The "Vršovice Derby" is the second most prestigious derby in Prague (after the Slavia-Sparta derby). Slavia and Bohemians are located in the Vršovice district of Prague and their stadiums are separated by only 1 km. Sparta Prague are considered their biggest rivals, and Viktoria Zizkov is the other team with whom they contest the city derbies. FK Bohemians Prague (Střížkov) are considered to be impostors and the entire club as a fraud, however that rivalry manifests itself on the pitch and towards the club management as the Střížkov club has very little support and no organised fan movement. Players Current squad . Out on loan Notable former players For all players with a Wikipedia article, see :Category:Bohemians 1905 players Reserves As of 2019/20, the club's reserve team Bohemians 1905 B plays in the Bohemian Football League (3rd tier of Czech football system). They play their home matches at the club's stadium, Ďolíček. Player records . Highlighted players are in the current squad. Most appearances in Czech First League Most goals in Czech First League Most clean sheets in Czech First League Managers Karel Meduna (1934–35) Ladislav Ženíšek (1940–44) Antonín Lanhaus (1945–51) Bohumil Musil (1972–77) Tomáš Pospíchal (1977–83) Josef Zadina (1983) Jiří Rubáš (1983) Tomáš Pospíchal (1983–87) Michal Jelínek (1987) Dušan Uhrin (1987–88) Josef Zadina (1988–89) Josef Ledecký (1989–91) Josef Hloušek (1991–92) Petr Packert (1993) Mario Buzek (1994) František Barát (1994–95) Svatopluk Bouška (1995) Dalibor Lacina (1995) Josef Hloušek (1996) Miloš Beznoska and Antonín Panenka (caretakers) (1996) Vladimír Borovička (caretaker) (1996) Vlastimil Petržela (1996–02) Vladimír Borovička (caretaker) (2002) Dušan Uhrin, Jr. (July 2002 – June 04) Zbyněk Busta (July 2005 – April 08) Pavel Hoftych (July 2008 – June 11) Pavel Medynský (July 2011 – March 12) Jozef Weber (March 2012 – March 14) Luděk Klusáček (March 2014 – June 14) Roman Pivarník (June 2014 – May 16) Miroslav Koubek (May 2016 – April 2017) Martin Hašek (April 2017 – October 2019) Luděk Klusáček (since October 2019) History in domestic competitions Seasons spent at Level 1 of the football league system: 17 Seasons spent at Level 2 of the football league system: 8 Seasons spent at Level 3 of the football league system: 1 Seasons spent at Level 4 of the football league system: 0 Czech Republic Notes: † results expunged History in European competitions UEFA Cup (1975/76) UEFA Cup (1979/80) UEFA Cup (1980/81) UEFA Cup (1981/82) UEFA Cup (1982/83) European Champions' Cup (1983/84) UEFA Cup (1984/85) UEFA Cup (1985/86) UEFA Cup (1987/88) Honours Czechoslovak First League (first tier) Champions (1): 1982–83 Runners-up (1): 1984–85 Czechoslovak Cup Runners-up (1): 1982 Czech 2. Liga (second tier) Champions (2): 1998–99, 2008–09 Runners-up (2): 2006–07, 2012–13 Mitropa Cup Finalists (1): 1987 Club records Czech First League records Best position: 4th (2001–02) Worst position: 16th (1996–97) Biggest home win: Bohemians 4–0 Blšany (2000–01) Biggest away win: Příbram 1–5 Bohemians (2001–02) Biggest home defeat: Bohemians 0–4 Žižkov (1994–95), Bohemians 0–4 Ostrava (2001–02), Bohemians 0–4 Sparta Prague (2011–12) Biggest away defeat: Drnovice 6–0 Bohemians (1996–97) References External links Official website Supporters' website English Language Supporters' website Category:Football clubs in the Czech Republic Category:Football clubs in Prague Category:Association football clubs established in 1905 Category:Czechoslovak First League clubs Category:Czech First League clubs Category:Fan-owned football clubs Category:Football clubs in Czechoslovakia

package imagedata import "github.com/gophercloud/gophercloud" const ( rootPath = "images" uploadPath = "file" stagePath = "stage" ) // `imageDataURL(c,i)` is the URL for the binary image data for the // image identified by ID `i` in the service `c`. func uploadURL(c *gophercloud.ServiceClient, imageID string) string { return c.ServiceURL(rootPath, imageID, uploadPath) } func stageURL(c *gophercloud.ServiceClient, imageID string) string { return c.ServiceURL(rootPath, imageID, stagePath) } func downloadURL(c *gophercloud.ServiceClient, imageID string) string { return uploadURL(c, imageID) }

Introduction {#sec1} ============ Low molecular weight gels (LMWG) are receiving a lot of attention.^[@ref1]−[@ref9]^ Unlike covalently cross-linked polymer gels, LMWG are formed when small molecules self-assemble into one-dimensional structures such as fibrils, fibers, or tubes. At a sufficiently high concentration (the so-called minimum gelation concentration (mgc)), these structures entangle and branch to a sufficient degree that a sample spanning network is formed. This immobilizes the solvent, resulting in a gel. Typically, the mgc will be less than 1 wt%. Such gels are reversible, for example reverting to a solution on heating.^[@ref7]^ For peptide-based LMWG, the main driving forces of gel formation are noncovalent interactions. Changes in temperature or pH and the addition of salts can all lead to changes in the interactions between LMWG molecules that drive self-assembly into a kinetically trapped state. The kinetics and thermodynamics of dipeptide gelation, specifically focusing on diphenylalanine, has been reviewed recently,^[@ref10]^ although the thermodynamic aspects of gelation remain less well understood. Drying could lead to changes in the kinetically trapped structures to a thermodynamic energy minimum such as crystallization or the fibers could be maintained. There is significant interest in such gels for applications in cell culturing,^[@ref4],[@ref11]^ controlled release,^[@ref12]^ optoelectronics,^[@ref5]^ drug therapies,^[@ref13]^ and oil recovery.^[@ref14]^ For these applications, key properties include the absolute mechanical strengths, the recoverability after shear (for example, in drug delivery where the gel would be passed through a needle),^[@ref15]^ or the thermal reversibility.^[@ref16],[@ref17]^ All of these properties depend on the fiber network, which means that characterizing and understanding this network is absolutely vital. To characterize such gels, a range of methods have been used. Rheological methods inform as to the mechanical properties, but the network type has to then be inferred.^[@ref18],[@ref19]^ Techniques such as infrared spectroscopy or circular dichroism can provide information as to the molecular packing, but cannot provide detail about the network. It is most common for a range of microscopy techniques to be used. Moving down in microscopy length scales, optical microscopy simply cannot provide the necessary resolution to image the self-assembled fibers. Confocal microscopy can provide information at a relatively large length scale (although these techniques are improving constantly, and there are some extremely effective high resolution methods that are just coming on line).^[@ref20],[@ref21]^ However, for confocal microscopy, either the molecule has to be synthetically adjusted such that it is fluorescent, which is likely to change its self-assembly behavior, or a fluorescent stain has to be added, which may affect the system. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) have been widely used.^[@ref22]^ Both of these methods usually require that the gel is dried. Further, for SEM it is common to sputter a metal onto the structures, and for TEM it is common to stain the structures, for example, with a heavy metal salt. The structures are then imaged under high vacuum. Although it is commonly assumed that the structures are related to those in the native, wet gel, there is often little evidence that this is the case. Cryo-SEM can be used, but there can easily be artifacts arising from freeze-concentration effects. In some cases, cryo-TEM is used.^[@ref23],[@ref24]^ Here, the sample is imaged in a vitrified hydrated state, which is presumably closer to the native structure. However, the sample preparation requires a thin film, which is difficult to access for a gel sample. Most experimental procedures involve placing a TEM grid on a gel or dipping into the gel. As such, the network may be disrupted and it might be that truly entangled fibers are not removed, but rather only free fibers are adsorbed. Certainly, the requirement of a maximum thickness means that analyzing the gel state is difficult. Finally, it should also be noted that such microscopy can only possibly access a tiny fraction of the structures in the gel due to the magnification used. Scattering methods, however, allow the bulk sample to be analyzed. For gels, small-angle X-ray and neutron scattering experiments are widely used.^[@ref25]−[@ref30]^ While requiring access to a facility, the data is relatively easy to collect. Bulk samples can be analyzed and, critically while in the wet, solvated state at ambient temperatures. This means that there is no need to dry or stain the sample (although for small angle neutron scattering, it is necessary to use a deuterated solvent for contrast). Having collected the data, these are then fitted with a mathematical model to access information about the fibers, and the network if a sufficiently wide *Q*-range can be accessed (*Q* is the scattering variable, an inverse length scale defined as *Q* = (4π/λ)sin(θ/2), where λ is the neutron wavelength and θ is the scattering angle). As stated, it is critical to understand the fiber network. There are few examples where multiple forms of analysis are used to probe the network, including examples showing a combination of scattering and microscopy.^[@ref17],[@ref29],[@ref31]−[@ref33]^ In some cases, there is a discrepancy between the microscopy data and the scattering. Since the scattering is collected in the wet state, it is tempting to assume that the microscopy suffers from drying artifacts, especially since the structures imaged have a higher apparent radius than that suggested by the scattering data.^[@ref34]−[@ref39]^ Here, we use small angle neutron scattering (SANS) to probe a number of hydrogels formed from dipeptide gelators. We compare the wet gels and the corresponding xerogels. We also use SANS to allow the influence of remaining water within the structures to be better understood through the contrast difference between hydrogen and deuterium. We compare these data with microscopy on the gels. These data allow us to discuss the effect of drying on these LMWGs. Experimental Methods {#sec2} ==================== Materials {#sec2.1} --------- The dipeptide LMWG were prepared as we have described previously.^[@ref40],[@ref41]^ The deuterated analogues were prepared from deuterated 2-naphthol or deuterated amino acids following the same synthetic procedures. Full experimental and characterization data are provided in the [Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf). D~2~O, GdL, and NaOD were purchased from Sigma Aldrich and used as received. The NaOD was purchased as a 40 wt% solution and diluted with D~2~O to 0.1 M. Gel Preparation and Drying Procedures {#sec2.2} ------------------------------------- Solutions of each LMWG were prepared at 10 mg/mL in H~2~O (or D~2~O where required), including 1 mol equiv of 0.1 M NaOH (or NaOD). The pH values of the solutions were between 10 and 11 at this point (pD was converted to pH using a standard approach).^[@ref42]^ The gels were formed by adding 1 mL of solution of a gelator to GdL (16 mg) in a vial; depending on the technique, the sample was transferred to a cuvette (for wet SANS), or transferred to a mold (all dried samples) with aluminum foil, providing the base layer onto which the gel is eventually dried (or a glass coverslip for the AFM/SEM samples). The samples were then left to gel sealed overnight. Air-dried samples were released from the mold, loosely covered to reduce dust or other sources of contamination or damage while drying in air on the bench at room temperature. A small control set of samples were instead dried inside an incubator at 25 °C to ensure temperature fluctuations did not affect the drying process. Freeze-dried samples were kept in the mold and placed into a lab freezer at −20 °C for approximately 7 h before being placed into a Labconco freezone 4.5 freeze-dryer with a condenser temperature of −50 °C and a shelf temperature of 20 °C overnight. A small number of samples were placed in liquid nitrogen instead of the lab freezer prior to freeze-drying. Analytical Techniques {#sec2.3} --------------------- ### Small Angle Neutron Scattering (SANS) {#sec2.3.1} Solutions were prepared as described for other techniques, with D~2~O and NaOD (unless otherwise stated). Gels were prepared as above using GdL. UV spectrophotometer grade, quartz cuvettes (Starna) with a 5 mm path length were filled with the solution immediately after the addition of GdL, allowed to gel sealed overnight and housed in a temperature-controlled sample rack at 25 °C during the measurements. For the dried film samples, the films were mounted over apertures in a cadmium plate, which was then placed in the same sample rack. For the in situ drying experiment, the gel was released from the mold after overnight gelation and mounted on the same cadmium plate as the dried films. SANS measurements were performed using the SANS2D instrument (ISIS pulsed neutron source, Oxfordshire, U.K.). A neutron beam allowed measurements over a large range in *Q* \[*Q* = 4π sin(θ/2)/λ\] of 0.005--0.7 Å^--1^ using incident wavelengths (λ) from 1.75 to 16.5 Å and employing a sample-to-detector distance of 4 m, with the 1 m^2^ detector offset vertically 60 mm and sideways 100 mm. The measuring times were 1--4 h dependent on the contrast. Each raw scattering data set was corrected for the detector efficiencies, sample transmission and background scattering and converted to scattering cross-section data (∂Σ/∂Ω vs *Q*) using the instrument-specific software.^[@ref43]^ These data were placed on an absolute scale (cm^--1^) using the scattering from a standard sample (a solid blend of hydrogenous and perdeuterated polystyrene) in accordance with established procedures.^[@ref44]^ The scattering from D~2~O (the solvent) was also measured and subtracted from the wet data. For data from dried samples, the empty beam was subtracted. The instrument-independent data were then fitted to customized models in the SasView software package;^[@ref45]^ these combined an absolute power law with a (Kratky-Porod) flexible cylinder, as described previously.^[@ref46]^ The *Q*-dependent power law (*Q*^--*N*^) accounts for the mass fractal contribution to the scattering intensity, which is superimposed on that from the cylindrical structures, that is, the fibers. The fibers of the gel are represented as a flexible worm-like chain of cylindrical Kuhn segments. ### Atomic Force Microscopy {#sec2.3.2} AFM imaging was performed in ambient conditions using the ScanAsyst mode using a Bruker Multimode 8 Nanoscope instrument with a J-scanner (Bruker Nano Inc., Santa Barbara, CA). The samples were imaged with a Bruker RTESPA-150 probe from with a nominal spring constant of 5 N/m. Images with size 5 μm × 5 and 1 μm × 1 μm were collected at a probe modulation frequency of 2 kHz. The topography images were analyzed offline using Bruker NanoScope Analysis v 1.5 software for topography measurements. The Section tool was used for measuring fiber diameter. Fiber diameters were measured using the "Section tool" within the software. ### Scanning Electron Microscopy {#sec2.3.3} SEM images were collected using a Hitachi S-4800 FE-SEM at 3 keV in deceleration mode at a height between 2 and 3 mm. For air-dried samples the gel was dried onto a glass coverslip and attached to a 15 mm screw in aluminum stub attached via a sticky carbon tab (Agar Scientific). For freeze-dried samples a small amount of the freeze-dried samples was stuck directly onto the sticky carbon tab. The freeze-dried samples were very fluffy and so had to be gently pressed flat using a glass coverslip to make them easier to focus on for imaging. Loose freeze-dried gel was then removed using compressed air. These images were still difficult to collect due to the nonflat surface the freeze-drying creates making it difficult to focus the beam properly. None of the samples were sputter coated with metal as the fibers were very small, this ensured that measuring the fiber widths was accurate. Images were collected in different places on the sample chosen at random to ensure that the images were representative. ### Cryo-TEM {#sec2.3.4} Cryogenic TEM imaging was performed on the FEI Tecnai 12 TWIN Transmission Electron Microscope, operating at 100 kV. Gels were immediately diluted five times with water to reduce their viscosity and 6 μL of sample solution was placed on a holey carbon film supported on a TEM copper grid (Electron Microscopy Services, Hatfield, PA). All the TEM grids used for cryo-TEM imaging were treated with plasma air to render the lacey carbon film hydrophilic. A thin film of the sample solution was produced using the Vitrobot with a controlled humidity chamber (FEI). After loading of the sample solution, the lacey carbon grid was blotted using preset parameters and plunged instantly into a liquid ethane reservoir precooled by liquid nitrogen. The vitrified samples were then transferred to a cryo-holder and cryo-transfer stage, which was cooled by liquid nitrogen. To prevent sublimation of vitreous water, the cryo-holder temperature was maintained below −170 °C during the imaging process. All images were recorded by a SIS Megaview III wide-angle CCD camera. ### Thermal Gravimetric Analysis {#sec2.3.5} TGA measurements were carried out on a TA Instruments SDT Q600 TGA machine using a constant air flow of 100 mL/min. Samples were heated at a rate of 10.00 °C/min to 120.00 °C and held there for 20 min before further heating at 10.00 °C/min to 200.00 °C. The sample mass used in all cases was between 3.5 and 7.5 mg. There was no difference in sample preparation or storage from that of the SANS samples. Fiber Width Measurements {#sec2.4} ------------------------ For cryo-TEM and SEM, fiber width measurements were collected using ImageJ. The scale bar was used to set the scale for the width measurement. A total of 70 measurements of fibers were used to create the histograms. These were done on several images of the same gels to ensure the widths were representative. Only objects that were clear single fibers (rather than aggregates or undetermined fibers) were measured to ensure primary fibers were being measured. Results and Discussion {#sec3} ====================== The gels examined here are all formed using dipeptide gelators.^[@ref6]^ Initially, solutions at high pH (or pD) are prepared in water (or D~2~O) at a concentration of 1.0 wt%. The pH is then lowered by the addition of glucono-δ-lactone (GdL). GdL quickly dissolves, and then slowly hydrolyses to gluconic acid, resulting in a slow pH change and the formation of very reproducible gels.^[@ref47],[@ref48]^ For this work, we have used a subset of our expanded library ([Figure [1](#fig1){ref-type="fig"}](#fig1){ref-type="fig"}). ). Note, for **3**, the alpha substituent is a deuteron rather than a proton, as it is for **1**, **2**, **4**, **5**, and **6**.](bm-2017-00823j_0006){#fig1} The in situ hydrated primary self-assembled structures of LMWG that lead to the gel can be probed using SANS across a wide length scale from a few nanometers to a couple of hundred nanometres.^[@ref25],[@ref26]^ SANS is particularly suited to aqueous systems such as those described here, as the water component is easily replaced by D~2~O to provide scattering length density (ρ) contrast; we refer to this as a H-gel in D~2~O since the gelator is fully hydrogenous ([Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}). It is also possible to change the contrast by preparing an analogous deuterated gelator, a so-called D-gel ([Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}). The scattering length densities (SLDs) for all gelators are shown in [Table S5](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf) ([Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)).  in [Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)), and therefore, ρ for the matrix could be slightly higher than 0. This illustrates how deuteration enhances the contrast of the xerogel.](bm-2017-00823j_0007){#fig2} The results from SANS of the wet H-gels ([Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"} and [Figure S4, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)) investigated here are consistent with our previous work, which have included the gelators **1**, **4**, and **6**.^[@ref38],[@ref46],[@ref49]^ Model fitting to the data using a modified Kratky-Porod flexible cylinder model provides information on the radius and Kuhn length of the primary fibers.^[@ref38]^ An indication of the network segregation is given by the power law exponent, which fits the decay of the data in the low-*Q* region, attributed to mass-fractal type behavior. When wet, the H-gels of **1**, **4**, and **6** have fiber radii in the region of 3--4 nm ([Tables S2--4 in Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). . Data for the other systems is shown in the [Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf).](bm-2017-00823j_0001){#fig3} Applying the same scattering approach to dried material requires careful experimental design ([Figure [2](#fig2){ref-type="fig"}](#fig2){ref-type="fig"}) as the removal of D~2~O from the gel significantly changes the scattering length density difference (Δρ) between the gelator fibers (ρ in the region of 1--2 × 10^--6^ Å^--2^; [Table S5, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)) and the matrix by which they are surrounded (D~2~O, ρ = 6.3 × 10^--6^ Å^--2^ or air, ρ = 0 Å^--2^). Hence, there would be a significant decrease in contrast from a Δρ of \>4 × 10^--6^ Å^--2^ to \<2 × 10^--6^ Å^--2^ on drying. Thus, the overall scattering intensity and the intensity of the features arising from the form factor are reduced, as illustrated by the general scattering equation ([eq [1](#eq1){ref-type="disp-formula"}](#eq1){ref-type="disp-formula"}). The scattering intensity *I*(*Q*) is also determined from the volume fraction, defined as ϕ, the particle volume *V*~p~ and the form and structure factors of the scattering, *P*(*Q*) and *S*(*Q*), respectively. Simultaneously, the incoherent background, *B*, from the increased proportion of hydrogenous material overshadows any features at high *Q*. Scattering from Hydrogenous Xerogels {#sec3.1} ------------------------------------ Initially, to examine the effect of drying, we used our hydrogenous gelators. Gels were prepared in molds ([Figure S5a, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). After complete gelation, the samples were either air-dried on the benchtop or frozen and dried using a freeze-dryer. Both of these are typical sample preparation methods reported in the literature for preparation of samples for imaging. On air-drying, the networks collapse to form a thin film (hence, aerogels are not formed). Using the freeze-drier, a more expanded aerogel-type material was formed ([Figure S5, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). It should be noted that it was not possible to scale the SANS data to gain absolute intensities for the xerogel samples. This is because the thickness of the samples was not as uniform as would normally be achieved for wet samples in cuvettes. Therefore, one measured thickness would not provide an accurate representation of the sample, particularly for the freeze-dried xerogels containing a high proportion of air. A nominal thickness of 0.1 mm was used to reduce all the xerogel data, providing an estimated scaling. The data have been left as reduced on the same axes as the absolutely scaled wet gel data for ease of comparison. The shape of the data, however, is not affected by the scaling and in the fitting the change in scale is absorbed by the free fitting scale factors and background parameter. For the xerogels ([Figures [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"} and [S4, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)), the scattering intensity in the region between 0.01 and 0.1 Å^--1^ decreases compared to the wet gels, reducing any features that can be associated with fiber structures. This is most clearly seen for the air-dried and freeze-dried sample of **4**, as shown in [Figure [3](#fig3){ref-type="fig"}](#fig3){ref-type="fig"}. The fit to this data shows that only the power-law component and incoherent background remain in the scattering data. This suggests that ρ of the matrix is close to contrast matching the fibers, despite only 6--10% water remaining in the samples (as measured using thermal gravimetric analysis (TGA), [Figures S1--3 and Table S1, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)), which would result in ρ = 0.4 to 0.6 × 10^--6^ Å^--2^. However, the features associated with fibers, in particular the inflection between 0.01 and 0.1 Å^--1^, are present in other xerogels but are difficult to define by eye, for example in the case of **1** ([Figure S4, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). The reproducibility of SANS from the xerogel films, the benchtop air-drying method, and film stability were confirmed ([Figures S6--8, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). All of these data show that it is difficult to determine whether the fibers remain in a form that can be detected by SANS upon drying. Where there are features, they are less well defined, reducing the confidence in the sizes determined for the H-gels due to a lack of contrast. Hence, following the drying process in situ using the H-gels would not be possible. Therefore, deuteration of the LMWG itself was used to increase the scattering length density of the material and subsequently both increase Δρ within the xerogels and lower the incoherent background. In Situ Drying {#sec3.2} -------------- Initially, we examined the effect of drying in situ using a partially deuterated gelator to maximize the contrast in its more dehydrated states. A gel of **2** was prepared and placed in the neutron beam while still wet ([Figures [4](#fig4){ref-type="fig"}](#fig4){ref-type="fig"} and [S5c,d, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). The sample was exposed to air, allowed to dry in a temperature-controlled environment at 25 °C. As the sample dried, the overall scattering intensity first decreased with the flexible cylinder features disappearing after 8 h ([Figures [4](#fig4){ref-type="fig"}](#fig4){ref-type="fig"} and [S9, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). The intensity then increased again until the sample had been drying for 24 h. In the latter stages of drying, between 18 and 24 h, the features attributable to fibers had returned to the original scattering pattern. Close to absolute scaling was achieved here by using extrapolated thicknesses assuming a linear rate of D~2~O loss based on multiple thickness measurements at three time points during the experiment. We highlight here that it is not possible to discriminate during the drying process with SANS between water that interacted strongly with the dipeptides compared with the water that was weakly trapped and, therefore, would be lost first from the gel. {#fig4} There are a few contributing factors to this changing SANS intensity and increased incoherent background. As the sample is open to the air, there could be a small effect of exchange between the D~2~O in the gel and the H~2~O (ρ = −0.56 × 10^--6^ Å^--2^) in the atmosphere, which would reduce ρ for the water surrounding the fibers. Any interface between the evaporating water and air could add to the fractal contribution to the scattering, exhibited by a *Q*-dependent power law, but as the slope in the lowest *Q* region below 0.01 Å^--1^ does not vary, this is unlikely to be a significant factor. However, the larger contribution is likely to come from the contrast change caused by the evaporation of the D~2~O and the partial replacement of the solvent with air inside the fiber network, in addition to the collapse of the network on formation of a thin film. As the ratio of hydrated and dried parts of the network changes, the average ρ of the matrix decreases toward that of air. As the chosen gelator, **2**, is partially deuterated, the contrast match point where the SANS intensity is lowest is relatively early in the drying process (between 8 and 12 h). Another factor that could potentially contribute to the reduced intensity is the rearrangement of the structures during drying. However, when the flexible cylinder features return in the scattering pattern (most clearly after 18 h), their position and shape are relatively similar to the initial state. This indicates that there has not been a dramatic change in structure. This assertion is also supported by a second in situ sample of **2** examined just for the first 13 h prepared in air contrast matched water (H~2~O and D~2~O mixed to ρ = 0 Å^--2^). The larger incoherent background makes the fiber scattering features less clearly defined than in the pure D~2~O sample but as the background decreases and the scattering intensity at low *Q* increases, the fiber-matrix contrast increases ([Figure S10, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). However, the inflection between 0.01 and 0.1 Å^--1^ is approaching the same shape and position as in the D~2~O data, indicating that the structure sizes have not changed with the contrast of the water matrix. This highlights the importance of contrast in the changes to the overall scattering intensity and confirms that the solvent contrast change is the main reason for the scattering intensity changes. Along with the data for the hydrogenous gelators above, these results show that the reduction in contrast that arises from either dried H-gels or D-gels part way through the drying process (when the contrast match point is found) makes the size of the fibers impossible to determine under those conditions. As it would be impractical to improve the dried gel contrast of the H-gel samples by changing the air (e.g., drying them in a D~2~ atmosphere), more contrast needs to be introduced by modifying the hydrogen/deuterium content of the gelator itself. Scattering from Deuterated Xerogels {#sec3.3} ----------------------------------- The partially deuterated compounds, used to enhance contrast, show much clearer scattering patterns in their xerogel forms ([Figure [5](#fig5){ref-type="fig"}](#fig5){ref-type="fig"} and [Tables S6--8, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). Comparisons of how the best fit from the wet (D~2~O matrix) gel would look with the background matrix replaced by air or an air/D~2~O mix of ρ = 0.5 × 10^--6^ Å^--2^ are shown to illustrate the effects of contrast change on the scattering pattern ([Figure S11, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). .](bm-2017-00823j_0003){#fig5} The gelators that were partially deuterated show similar flexible cylinder features to the wet hydrogenous gels. Subtle changes in the dimensions of the cylinders are to be expected, owing to the slightly differently defined boundaries to the fibers, arising from the packing of the molecules within the fibers, and the location of any remaining water. There will also be some expected shifts in the scattering pattern owing to the changes in contrast between the systems ([Figure S11, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). However, the deuterated versions **2** and **3** show a slight decrease in radius upon drying compared to a slight increase in the radius for **1**. The very small contribution of the flexible cylinder features to the xerogel scattering patterns of **1** mean that the data from **2** and **3** seem more reliable. LMWG **5** appears to retain relatively similar dimensions on drying. This could not be understood from its hydrogenous equivalent **4**, which suffered from apparent contrast matching upon drying. We hypothesized that the freeze-drying approach would provide clearer scattering patterns owing to a more open network, with the boundaries between the fibers and the air matrix more clearly defined. Hence, ρ of the matrix would be much closer to 0 Å^--2^, despite TGA indicating that some water is either retained or reabsorbed once processed and stored under atmospheric conditions. In general, we observed that the freeze-dried xerogels were more likely to retain features attributable to the fibers in the SANS data. The only exceptions to that hypothesis were gelators **1** and **4**. When the data was fitted in some cases, such as for **6**, the fitted radii of the freeze-dried xerogel were the same as for the wet gels, within the uncertainty of the fitting ([Table S4, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). Cryogenic freeze-drying of one sample of LMWG **2** was also used in order to see whether the vitrification of the water made a difference to the fiber network as seen by SANS ([Figure S12, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). The power law contribution was seen to dominate with the simple power law model providing the best fit to the data with an exponent of 3.5 ± 0.1. This indicates that the network has moved from the mass fractal into the surface fractal regime, which arises from the rough surface scattering from dense clusters where there is minimal internal contrast. Comparison between SANS and Microscopy {#sec3.4} -------------------------------------- As LMWG **5**, the deuterated version of **4**, was shown to retain similar fiber dimensions upon drying when measured using scattering, SEM and AFM images were collected for xerogels of **4** and **5** ([Figures [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}a and [S13--16, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)) and compared to the values obtained from scattering. The diameters, *D*, of the fibers recorded in the AFM and SEM images are generally between 6 and 12 times larger than the values obtained from model fits to the scattering. A comparison of these with SANS parameters is given in [Table [1](#tbl1){ref-type="other"}](#tbl1){ref-type="other"} for LMWGs **4** and **5**. Model fits for both **4** and **5** using fiber radii approximately equivalent to those observed in the SEM (at 28.5 nm radius, polydispersity of 0.2) are shown in [Figure [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}c,d. While the fringe features in these model fits are smoothed out by a polydispersity in the radius, the shapes remain different from the experimental data recorded. These model fits highlight how the xerogel data from **4** is dependent only on the power law as asserted earlier and therefore the size of the fibers cannot be deduced from that data. However, for both the wet gel of **4** and all gels of **5**, the fits are clearly not as good when the larger radius is used. This also confirms that the SANS technique is capable of measuring features in this size range, if they were the primary fiber size over the whole sample area. The difference in fiber radius between the SANS and microscopy also appears larger than we might expect simply from the different ways in which the edges of the fibers will be defined by the three techniques. ###### Comparison of Diameters Measured Using SANS and Microscopy for **4** and **5**[a](#tbl1-fn1){ref-type="table-fn"} diameters measured (in nm) by: SANS AFM SEM cryo-TEM -------------------------------- ------------ ------------ ----------- ---------- --------- ----------- **4** 8.0 ± 0.8 \- \- 52 ± 13 57 ± 28 7.6 ± 2.0 **5** 10.0 ± 1.0 12.0 ± 1.0 9.2 ± 1.0 \- 57 ± 23 7.1 ± 3.0 "-" indicates that the value was not determined. . (b) Histogram of the widths of fibers measured from the SEM images (black) and cryo-TEM (red) of **5**, along with the distribution expected from a Gaussian distribution (generated from SigmaPlot with a standard deviation of 0.4) around the mean diameter determined by SANS (blue). (c) SANS data for **5** with the model fits with radius (*R* = 28.5 nm), Kuhn length (50 nm), and length (2 μm) equivalent to the sizes determined from the AFM and SEM images both with and without the power law exponent in order to highlight the differences with the best fits to the data. Other parameters were kept the same as in the best fits. The long dash line is without both polydispersity and the power law model, the medium dash line is with the polydispersity of 0.2 and without the power law model, the dotted line is without the polydispersity but with the power law model (*N* = 2.5) and the short dash line is with both a polydispersity of 0.2 and a power law model (*N* = 2.5). Open circles represent the wet gel, open squares the air-dried xerogel, and filled squares the freeze-dried xerogel. The solid red lines depict the model fits to the data as parametrized in [Supporting Information (Tables S8)](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf). (d) Example of the cryo-TEM image for **5**, with a scale bar of 200 nm. The white arrow highlights where two primary fibers seem to wrap around each other. Other images are shown in [Figures S18 and S19, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf).](bm-2017-00823j_0004){#fig6} Since the SANS data shows that the scattering before and after drying is very similar, there remains a discrepancy between the SANS and microscopy. As mentioned above, there are relatively few comparisons between small angle scattering data and microscopy for such gels. In some cases, a close match between the radii measured using both methods are found. Examples include Pochan and Schneider's β-hairpin based LMWG,^[@ref31],[@ref50]^ some examples of Stupp's peptide amphiphiles,^[@ref51],[@ref52]^ and some ionic peptides.^[@ref53],[@ref54]^ In other examples, there are significant discrepancies between the data. These include some of our work,^[@ref38],[@ref46],[@ref49]^ as well as related work from Thordarson.^[@ref39],[@ref55]^ In these cases, the microscopy implies that the radii are significantly greater than that measured by small angle scattering. Hence, there are two questions that need answering. First, why do the data for microscopy and scattering differ for our systems and not for others? We hypothesize that the apparent differences between samples can be explained by the degree of charge on the self-assembled fibers. For the examples where the data from the microscopy and scattering are in agreement, there is significant charge left on the self-assembled fibers.^[@ref29],[@ref53]^ However, for our LMWG, there is a single charged group at high pH, which conceptually is removed on pH decrease and gelation. We have recently shown for our class of LMWG that even after the pH has been decreased and a gel has formed, there is some residual charge on the fibers,^[@ref56]^ but significantly less than the other examples described above. In some cases, further removal of charge leads to fiber--fiber association and syneresis of the gel phase.^[@ref57],[@ref58]^ We therefore suggest that fiber aggregation is easier for our relatively uncharged gelators as compared to other LMWGs. This may also be related to the association with water that presumably is more prevalent for charged LMWG than for uncharged LMWG. The second question is why is there a discrepancy between the sizes determined by SANS and microscopy for the xerogels? As mentioned above, model fits to hypothetic fibers with diameters found by microscopy show that SANS is capable of measuring features in this size range if they were the primary fiber size over the whole sample area. Work by Zhang et al. has shown that when peptide amphiphile fibers laterally aggregate (as shown by microscopy),^[@ref30]^ changes in the small-angle X-ray scattering are measured; this again implies that we might expect that SANS would be sensitive to the aggregation. To further probe this, cryo-TEM of gels of **4** and **5** was carried out. From the data, it is clear that the gel consists of a network of fibers in the vitrified state ([Figures [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}d, [S18, and S19, Supporting Information](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). To image the gels using this technique, it is necessary to dilute the gel. As such, the images cannot show the true network, but can be used to probe the fibrous structures that are present. Image analysis was used to determine the fiber widths, and the diameters were found to be 7.7 ± 2.0 nm for **4** and 7.1 ± 3.0 nm for **5**. These are significantly smaller than the data from the SEM and AFM of the xerogel and close to the values determined from the SANS fitting. Hence, it appears that the SANS probes the primary fibers. These clearly aggregate to some degree even when in the vitrified gel phase, as shown by the cryo-TEM data (an example where two fibers are aggregating is highlighted in [Figure [6](#fig6){ref-type="fig"}](#fig6){ref-type="fig"}d), but the aggregation is even more pronounced on drying. The aggregation is not observed in the SANS data either in the gel or xerogel state. What is clear is that the AFM and SEM data do not represent the fiber network in the gel state, as shown by the significant discrepancy between data from the cryo-TEM and SEM. Conclusions {#sec4} =========== We have shown here the first in situ drying study for LMWGs. To maximize scattering intensity, deuteration of the LMWG is beneficial. Deuteration allows for sufficient scattering intensity to follow the drying in situ, and to probe the xerogels. Our data show that the method of drying is very important; comparison of the data before and after drying shows that in a number of cases there are significant differences in the scattering. Our data show that SANS is capable of probing the primary fibers for these gels, but is insensitive to lateral association of the fibers, either in the wet gel phase or on drying. The cryo-TEM data shows the presence of fibers with radii which are consistent with the SANS data, as well as aggregates; essentially, the AFM and SEM only show large aggregates. Hence, our data show that for such LMWGs, the SANS data is extremely useful and represents the primary fiber network. However, for those LWMGs where the fibers are hydrophobic and not heavily charged, microscopy on dried gels does not represent the network, but rather aggregation of the fibers. It is not possible to observe the primary fibers by AFM and SEM, although SANS can still determine that these larger structures are formed from thinner fibers. Microscopy on the dried gels is extremely common, but our data suggests that the images should therefore be treated with caution. The Supporting Information is available free of charge on the [ACS Publications website](http://pubs.acs.org) at DOI: [10.1021/acs.biomac.7b00823](http://pubs.acs.org/doi/abs/10.1021/acs.biomac.7b00823).Synthesis and characterization details for the LMWG, TGA data, SANS model fit parameters, SANS curves for additional LMWGs and indicating reproducibility, and additional SEM, AFM, and cryo-TEM images ([PDF](http://pubs.acs.org/doi/suppl/10.1021/acs.biomac.7b00823/suppl_file/bm7b00823_si_001.pdf)). Supplementary Material ====================== ###### bm7b00823_si_001.pdf The authors declare no competing financial interest. L.M., A.C., B.D., and E.D. thank the EPSRC for funding (EP/L021978/1). D.A. thanks the EPSRC for a Fellowship (EP/L021978/1). M.N. thanks the University of Liverpool for a DTA studentship. G.S. acknowledges funding support from an ERC Advanced Investigator Grant (PISA 320372). Experiments at the ISIS Pulsed Neutron and Muon Source were supported by a beamtime allocation (RB1520075, RB1520074) from the Science and Technology Facilities Council. This work benefitted from the SasView software, originally developed by the DANSE project under NSF Award DMR-0520547. We thank Dr. Michael Barrow (University of Liverpool) for his help with the TGA measurements.

Friday, August 29, 2008 Because I have nothing to say. Crap. Got this one from Jennifer (technically she didn't tag me but I'm gonna do it anyway, so there :P ) 10 years ago... August 1998. I was starting my senior year of high school and applying to college. I applied only to two: Texas A&M and t.u. Obviously, my decision after being accepted to both (thank you top 10% rule!) was A&M. I felt at home on that campus while on an official campus tour with my mom. Even though I had practically been raised to be an Aggie and had been on its campus before, I did give t.u. a fair chance. Of course I applied to that other school for only one reason... my boyfriend at the time John 1.0 (I call him 1.0 to distinguish DBF from the first John I dated. My sister likes to call DBF, John 10.0 because she says he's 10 times better than the first. I tend to agree, at least in terms of being better for me). I digress. In August 1998, life pretty much focused on school, swimming and finishing up the summer season of lifeguarding. Life was easy - at least looking back on it I think of it as easy, I'm sure at the time I didn't think so - and I was looking forward to my last year of high school and moving out of my parents' house. 5 years ago... August 29, 2003. I was in Boston, having moved there just 5 days prior. This was both incredibly exciting and incredibly scary. I had 3 roommates I barely knew. I was living in a city where I knew no one. Not to mention how incredibly different it was from where I had grown up and where I went to undergrad. I was intimidated and exhilarated at the same time. As I started to meet people in my program and around the city, whenever I would tell them I was from Texas, I would get this look that spoke all too well of the stereotypes running through their minds. And I did manage to bust through some of them (well I do have a big/loud mouth. What? Don't look at me like that. Shit.) as well as teach them some things they didn't know (Texas was it's own country. Not a great country. But still. We governed ourselves for 10 years or so. Crap. Maybe that's what started it. Also, if you're in El Paso, you are closer to LA than the eastern border of Texas. :O ). This is one of the best - if not the best - experiences of my life. I learned so much - and not all of it was in school. 5 months ago... At the beginning of the month, DBF was still unemployed having been laid off in January. By the end of the month though not only had he found a job, but he had also moved to Plano which was much closer to me than North Richland Hills. I was more than thrilled at this. I also was dogsitting Zoe for my parents given their hectic schedules that month. Other than that, life was pretty normal. 5 things on my to do list tomorrow... 1. Sleep2. Pick up my prescription3. Read4. Hang out by the pool5. Watch Noises Off 5 things people don't know about me... 1. I once went to a Nsync concert. Some girlfriends and I were obsessed with them for a year or two in college. We'd watch their tour DVD over just to watch Justin shake his hips.2. I cannot stand gum. I think it's tacky and gross to be chewing the same thing without ever swallowing. 3. I have watched every single episode of Charmed at least 4 times. 4. When I was little and my dad would come home late, I would imagine him having to fight ninjas, which was what was making him late coming home from work.5. When we were little, I convinced my sister to sneak up into the attic with me because I thought it would be cool. And then I watched her fall through the sheetrock onto the concrete floor of the garage. No permanent damage. I think. 5 bad habits... 1. Road rage. Anyone who's either been in the car with me or been on the phone with me while I was driving knows this all too well.2. Not thinking before talking. I've had way too many foot in mouth moments to even care to think about.3. Sarcasm. I need to learn when to dial it back.4. Swearing... as much. No way I could give it up completely. Shit.5. Making excuses for myself. I have dreams. So why am I holding myself back? 1 comment: Anonymous said... Sarcasm is a bad habit? Damn, That will have to go on my list then too. That seemed to have been a little more than nothing to say. I've never memed I may have to consider it if I run out of things too. Subscribe Now About Me This blog is my place to write about my life. Sometimes it's good. Sometimes it's not so good. This blog is my catharsis. I got the nickname Becky Mochaface while working at Starbucks. During one particularly hellish shift working the cold bev station, I was making a mocha frappuccino and when I pumped the mocha syrup into the pitcher of ice it bounced back up and hit me in the face. Being busy I didn't have time to wipe it off until the end of my shift. My fellow partners thought it was hilarious and started calling me Becky Mochaface. It stuck and I've grown partial to it.

Holey Puzzle and Board Games, developed by Encore, is a huge collection of classic games like Hangman, Mahjongg and Sudoku, plus over 1200 different Crosswords. The collection guarantees entertainment for gamers of all ages. Caf&eacute; Partner is an exclusive programe for internet caf&eacute;s to earn money by promoting the all new ibibogames. You can build your Customer base so you can keep them engaged &amp; earn long term loyalty.Customers will earn FREE talk time. SupraHLE is a free emulator for the Nintendo 64, built on the UltraHLE that gave great results with great games like Zelda 64 or Mario 64.It works simply, and the possibility to get ROMs to play isn`t difficult. All Seeing Eye is a program to connect you quickly and easily to the best on-line gaming servers to play your favourite games like Counter-Strike Retail, Battlefield 1942, Quake III, Unreal tournament, Counter strike 1. APOCALYX is a 3D engine based on OpenGL, OpenAL and other free libraries suitable in particular for the development of Programming Games, the genre of games like GUN-TACTYX or JROBOTS, where the player programs the AI of his own team of bots to make Dream Solitaire is an enjoyable combination of traditional puzzles and popular card games like Solitaire. You only need to make chains with cards keeping to the Solitaire rules. Sounds easy, doesn't it? Lex Venture: A Crossword Caper mixes features of board crossword games like Scrabble with elements of puzzles. Help Eugene's party to recover their Letter Machine and win the Science Fair! Fun for the family! If you are a fan of puzzle games like Tetris, then you will probably like Samulos, an exciting game wherein you have to use your mental skills in order to get the maximum score. Your main objective will be to match blocks of the same color. Play one of the world's most popular word games like never before with SCRABBLE PLUS, a re-imagined version of the classic crossword game! Arrange SCRABBLE letter tiles into high-scoring words in four fantastic game modes! The Settlers series is already a classic in the genre of real-time strategy games, thanks to its carefully built system resources, considered the best of its kind, above even games like Age of Empires.

an annual basis. If it passes, the township’s total EIT would drop from .75 to .625 percent, according to township Manager Richard Fisher. The open space fund was approved by voter referendum in May 2007, but township officials say the account is... Read more ready to go in the morning. Although every now and then he does forget. “He runs out in his underwear sometimes," laughed Richard Fisher, a sanitation worker with Republic Services. Logan is so excited to greet his garbage men that in the past,... Read more ready to go in the morning. Although every now and then he does forget. “He runs out in his underwear sometimes," laughed Richard Fisher, a sanitation worker with Republic Services. Logan is so excited to greet his garbage men that in the past,... Read more Carmen was sentenced to 11 to 23 months in prison, and will have to pay court indebtedness upon his release from custody. Richard Fisher, 66, of Vandemere, was convicted of two counts of Possession with Intent to Sell or Deliver Schedule II... Read more - Anglican (Canon Simon Holland, Rev Toby Boutle at the rear) Catholic, Methodist and URC, and at the extreme right, Richard Fisher the CEO of the Bible Reading Fellowship A charity dedicated to befriending and supporting older people of all... Read more not something they rigged by “trying to create a wealth effect” in “front-running the stock market” as former Fed governor Richard Fisher said of the actions he was involved in, but that it is just a side-effect of their stimulus that now pressures... Read more

Saturday September 28. National Drink Beer Day 11:00am - 2:00am Join us for National Drink Beer Day on Sept 28th and try one of our many craft brews! Saturday September 28 11:00amSaturday September 28 2:00amAmerica/New_YorkNational Drink Beer DayJoin us for National Drink Beer Day on Sept 28th and try one of our many craft brews!Zumas Tex Mex GrillZumas Tex Mex [email protected] Friday October 4. National Taco Day 11:00am - 2:00am As if we needed an excuse... join us for National Taco Day October 4th! Friday October 4 11:00amFriday October 4 2:00amAmerica/New_YorkNational Taco DayAs if we needed an excuse... join us for National Taco Day October 4th!Zumas Tex Mex GrillZumas Tex Mex [email protected]

Introduction ============ Obesity is one of the major community health problems and its occurrence is notably growing in developed and developing countries ([@B1], [@B2]). Based on recent reports, the rate of obesity has tripled during the last two decades in developing countries ([@B3]). Iran has been no exception. According to the latest report of WHO, more than half of the Iranian adults are overweight or obese ([@B4]). In adults, the most prevalent and practical indicator for evaluation of overweight and obesity is Body Mass Index (BMI) ([@B5]). Obesity and abdominal obesity are the main risk factors for developing cardiovascular diseases (CVD), diabetes, hypertension and dyslipidemia ([@B6]--[@B9]). Increasing of obesity prevalence is related to the significant modification in the lifestyle in particular dietary habits and limited physical activity in both urban and rural regions ([@B10], [@B11]). Some of the ethnic dimensions underlying causes of obesity are low socioeconomic status, genetic factors, and the different eating patterns ([@B12]--[@B15]). In Iran, family history of obesity, aging, early marriage, low physical activity, parity, and education are responsible for both obesity and central obesity in the urban population ([@B16]). There is no recent data available for prevalence and associated factors of overweight or obesity and abdominal obesity in Iran. This population-based investigation focused mainly on providing the estimates of obesity in Iran and also evaluating its association with various risk factors in the Iranian adult population in the urban and regional areas. Materials and Methods ===================== The data for this study were collected in 2015 as a part of the major Lifestyle Promotion Project (LPP) ([@B17], [@B18]) conducted in the districts of East Azerbaijan (urban and regional parts), one of the largest provinces of Iran. This study performed by probability proportional to size (PPS) multistage stratified cluster sampling through which 150 clusters selected. In each cluster, 20 participants (15--65 yr) were enrolled (3000 participants). All procedures performed in this study were in line with the ethical values of the Ethics Committee of Tabriz University of Medical Science and Informed consent was obtained from all participants included in the study. Exclusion of incomplete questionnaire yielded 2818 final sample, subjected to statistical analysis. The final sample consists of 1370 and 1448 residents in the capital city (Tabriz) regional areas (including Marand, Mianeh, Varzegan, Khodafarin, Bonab, Osku, and Ilkhichi) respectively. International Physical Activity Questionnaire (IPAQ) which the validity of the translated form was evaluated in the previous study on Iranian subjects ([@B19]). Dietary assessment is performed by means of quantitative food frequency questionnaires ([@B20]). BMI was calculated from height and weight data as kg/m^2^. Overweight was defined as BMI 25--29.9 kg/m^2^ and obesity as BMI≥30 kg/m^2^. Waist circumferences (cm) were measured in duplicate with an anthropometric tape at the minimum circumference between the iliac crest and the rib cage and conicity index was calculated as follow: Conicity index = waist circumference in meters/(0.109\*square root of weight in kg/height in meters). Statistical analysis -------------------- SPSS ver.18 (Chicago, IL, USA) Statistical computer software was used for all statistical analyses. Means and standard deviations (SD) were calculated for continuous variables, and proportions were calculated for categorical variables. Between-group comparisons were made by independent *t-*test, chi-square test, and ANCOVA. The multinomial logistic regression models were used to examine the relationships between over-weight/obesity/abdominal obesity and associated factors by adjusting for covariates. All analyses were performed for men and women separately since the literature usually reports gender differences for factors associated with obesity. A significance level of 0.05 was used. Results ======= The prevalence of overweight, obesity and central obesity in the urban and regional areas is shown in [Table 1](#T1){ref-type="table"}. The rates of age, marital, occupational, educational and physical activity status, smoking habit, overweight, obesity and abdominal obesity were significantly different in the urban and regional areas (*P*\<0.05). ###### The prevalence of overweight, obesity and abdominal obesity in urban and regional areas ***Urban (n= 1370)*** ***Regional(n= 1448)*** ***Total (n= 2818)*** ------------------------------------------------------------------------------ ----------------------- ------------------------- ----------------------- **Age, % (n)[^\*^](#TFN1){ref-type="table-fn"}** 15--25 5.1 (71) 8.5 (123) 6.8 (191) 26--35 18.7 (257) 22.2(322) 20.5(578) 36--45 32 (439) 28.4(412) 30.2(851) 46--55 24 (330) 23.2(335) 23.8(671) 56--65 19.8 (272) 17.7(256) 18.7 (527) **Marital status, % (n)** Married[^\*^](#TFN1){ref-type="table-fn"} 89.1 (1220) 85.5 (1239) 87.1 (2454) **Occupational status, % (n)[^\*^](#TFN1){ref-type="table-fn"}** Employed or self employed 39.2 (537) 42.4 (614) 40.9 (1153) Student 5.6 (77) 6.7 (97) 6.2 (175) Unemployed 55.2 (756) 50.9 (737) 52.9 (1490) **Educational status, % (n)[^\*^](#TFN1){ref-type="table-fn"}** Illiterate 11.2 (153) 14.8 (214) 13.0 (366) Under graduate 67.1 (920) 71.2 (1031) 69.2 (1950) College 21.7 (279) 14.1 (204) 17.8 (501) **Smoking habit, % (n)[^\*^](#TFN1){ref-type="table-fn"}** yes 9.5 (130) 12.7 (184) 11.1 (313) Occasionally 1.3 (18) 2.0 (28) 1.7 (48) No 89.1 (1221) 85.4 (1236) 87.2 (2457) **Physical activity, % (n)[^\*^](#TFN1){ref-type="table-fn"}** Inactive 43.3 (593) 18.1 (262) 30.3 (854) Minimally active 34.8 (477) 29.2 (423) 31.9 (899) Health enhancing activity 21.9 (300) 52.7 (763) 37.7 (1062) **Prevalence of overweight, % (n)[^\*^](#TFN1){ref-type="table-fn"}** 41.6 (570) 37.7 (546) 39.6 (1116) **Prevalence of obesity, % (n)[^\*^](#TFN1){ref-type="table-fn"}** 25.7 (352) 22.4 324) 24.0 (676) **Prevalence of abdominal obesity, % (n)[^\*^](#TFN1){ref-type="table-fn"}** 76.3 (1045) 74.1 (1074) 75.2 (2119) (*P*\<0.05), differences tested by chi-square test The prevalence of overweight, obesity and central obesity was significantly higher in the urban areas (*P*\<0.01); however, health-enhancing physical activity and smoking were significantly more prevalent in the regional areas (*P*\<0.001). [Table 2](#T2){ref-type="table"} illustrates the prevalence of overweight, obesity, and abdominal obesity by age and sex. The prevalence of overweight, obesity and abdominal obesity were higher in middle**-**aged adults compared to young adults. Moreover, the prevalence of central obesity in normal weight subjects was 15.3% (men: 16.7%, women: 14.1%). ###### The prevalence of overweight, obesity, and abdominal obesity by age and sex ***Variables*** ***Men (n=1368)*** ***Women (n=1450)*** ***P-value^\*^*** --------------------------------------------------------------------- -------------------- ---------------------- ------------------- Weight, kg, (mean±SD)[^†^](#TFN2){ref-type="table-fn"} 76.4±13 69.7±13 \<0.001 15--25 64.9±12.7 59±12.1 0.005 26--35 74.7±13 64.3±12.4 \<0.001 36--45 80.1±12.4 70.6±12.5 \<0.001 46--55 78.8±11.9 72.8±12.6 \<0.001 56--65 77.1±11.8 73.1±12 \<0.001 *P*-value \<0.001 \<0.001 Height, cm, (mean±SD)[^†^](#TFN2){ref-type="table-fn"} 171.9±8.4 157.2±13.7 \<0.001 15--25 171.9±9 160.2±7.5 \<0.001 26--35 174.8±7.4 159.4±14.6 \<0.001 36--45 173.6±8.4 157.5±14.8 \<0.001 46--55 171.4±9 157.3±16.2 \<0.001 56--65 169±7.5 153.6±18.7 \<0.001 *P*-value \<0.001 \<0.001 BMI, kg/m^2^, (mean±SD)[^†^](#TFN2){ref-type="table-fn"} 25.9±4.7 28±5.6 \<0.001 15--25 22.2±4.2 22.9±4.5 0.127 26--35 24.5±4 25±4.4 0.09 36--45 26.7±5 28±5.3 \<0.001 46--55 27±4.6 29.4±4.9 \<0.001 56--65 27±4.1 30.4±6.2 \<0.001 *P*-value \<0.001 \<0.001 Waist circumference, cm, (mean±SD)[^†^](#TFN2){ref-type="table-fn"} 91.6±12.3 91.2±12.7 0.44 15--25 79.1±10.2 77.7±12.9 0.42 26--35 86.3±11.4 84.4±11.8 0.06 36--45 92.7±12.4 90.7±11.1 0.01 46--55 94.9±10.5 94.2±12.1 0.49 56--65 96.9±10.8 98.5±10.4 0.027 *P*-value \<0.001 \<0.001 Prevalence of overweight, %[^‡^](#TFN3){ref-type="table-fn"} 42.2 37.1 0.01 15--25 16.1 16.4 0.56 26--35 30.8 28.6 0.62 36--45 44.6 42.3 0.55 46--55 49.4 40.7 0.046 56--65 52.3 37.5 0.001 *P*-value \<0.001 \<0.001 Prevalence of obesity, %[^‡^](#TFN3){ref-type="table-fn"} 15.1 32.2 \<0.001 15--25 2.7 7.2 0.16 26--35 8.6 15.1 0.039 36--45 18.9 29.5 0.001 46--55 18.2 42.6 \<0.001 56--65 19 47.5 \<0.001 *P*-value \<0.001 \<0.001 Prevalence of abdominal obesity, %[^‡^](#TFN3){ref-type="table-fn"} 68.6 81.4 \<0.001 15--25 20.0 36.2 \<0.04 26--35 43.9 63.9 \<0.001 36--45 75.3 84.0 \<0.001 46--55 81 90.7 \<0.001 56--65 86.6 96.6 \<0.001 *P*-value \<0.001 \<0.001 Differences tested by unpaired Student's *t*-test// Differences tested by chi-square test Odds ratios for overweight/obesity and abdominal obesity for demographic, socioeconomic and lifestyle factors were presented in [Table 3](#T3){ref-type="table"}. Results of logistic regression analysis, which controlled to confounders (age, marriage, residency area, employment, education, smoking and physical activity status, the number of kids and the family history of obesity) showed that in both sexes, higher age was the risk of over-weight/obesity and abdominal obesity. In married men, the risk of being overweight/obese and centrally obese was more than twice as high compared to single ones. Moreover, nonsmokers and subjects having the family history of obesity were also more expected to be overweight or obese and centrally obese than the others. In addition, 15% and 58% higher risk of obesity and abdominal obesity was seen in women with health-enhancing physical activity. ###### Logistic regression analysis for the association of overweight/obesity/abdominal obesity and demographic, socio-economic, lifestyle factors **Men(n=1368)** **Women(n=1450)** --------------------------- ----------------------------------------------------------- ------------------------------------------------------------ ----------------------------------------------------------- -------------------------------------------------------------- Age groups 15--25 1.00 1.00 1.00 1.00 26--35 1.85 (0.83,4.14) 1.93 (0.88, 4.20) 2.09 (0.98, 4.45) 2.15 (1.08, 4.27)[^\*^](#TFN4){ref-type="table-fn"} 36--45 4.24 (1.77, 10.14) [^\*\*\*^](#TFN6){ref-type="table-fn"} 6.14 (2.59, 14.53) [^\*\*\*^](#TFN6){ref-type="table-fn"} 6.43 (3.02,13.70) [^\*\*\*^](#TFN6){ref-type="table-fn"} 6.18 (3.06, 12.49) [^\*\*\*^](#TFN6){ref-type="table-fn"} 46--55 4.6 (1.90,11.27) [^\*\*\*^](#TFN6){ref-type="table-fn"} 9.53 (3.88, 23.39) [^\*\*\*^](#TFN6){ref-type="table-fn"} 12.5 (5.71, 27.42) [^\*\*\*^](#TFN6){ref-type="table-fn"} 11.03 (5.14, 23.69) [^\*\*\*^](#TFN6){ref-type="table-fn"} 56--65 6.24 (2.49, 15.63) [^\*\*\*^](#TFN6){ref-type="table-fn"} 11.31 (4.37, 29.25) [^\*\*\*^](#TFN6){ref-type="table-fn"} 15.3 (6.61,35.41) [^\*\*\*^](#TFN6){ref-type="table-fn"} 44.95 (14.33, 141.04) [^\*\*\*^](#TFN6){ref-type="table-fn"} Residential place Urban 1.00 1.00 1.00 1.00 Rural 0.98 (0.74, 1.29) 1.24 (0.88, 1.74) 0.82 (0.63, 1.07) 0.95 (0.74, 1.22) Marital status Single 1.00 1.00 1.00 1.00 Married 2.24 (1.35, 3.73) [^\*\*\*^](#TFN6){ref-type="table-fn"} 2.09 (1.24, 3.15) [^\*\*\*^](#TFN6){ref-type="table-fn"} 1.76 (1.03, 3.01) [^\*^](#TFN4){ref-type="table-fn"} 1.72 (1.10, 3.04) [^\*^](#TFN4){ref-type="table-fn"} Occupational status Employed 1.00 1.00 1.00 1.00 Student 1.10 (0.49, 2.44) 1.15 (0.29, 4.63) 0.61 (0.21, 1.78) 2.07 (0.70, 6.08) Unemployed 1.93 (1.03, 2.99) [^\*\*^](#TFN5){ref-type="table-fn"} 0.81 (0.43, 1.52) 1.13 (0.68, 1.87) 0.87 (0.53, 1.41) Educational status Illiterate 1.00 1.00 1.00 1.00 Under graduate 1.40 (0.76, 258) 1.50 (0.78, 2.89) 1.55 (0.9, 1.99) 0.94 (0.62, 1.43) College 1.42 (0.73, 2.77) 1.35 (0.64, 2.82) 0.99 (0.57, 1.74) 1.41 (0.83,2.41) Smoking habit yes 1.00 1.00 1.00 1.00 Occasionally 1.64 (0.72, 3.76) 0.59 (0.23, 1.54) 2.30 (0.20,26.00) 1.09 (0.06, 19.23) No 1.64 (1.19, 2.28) [^\*\*^](#TFN5){ref-type="table-fn"} 1.69 (1.17, 2.44) [^\*\*^](#TFN5){ref-type="table-fn"} 2.57 (0.54, 12.13) 3.68 (0.61, 22.01) Physical activity Inactive 1.00 1.00 1.00 1.00 Minimally active 1.00 (0.68, 1.46) 1.21 (0.80, 1.83) 0.90 (0.65, 1.24) 1.06 (0.73, 1.55) Health enhancing activity 1.06 (0.72, 1.55) 1.32 (0.86, 2.01) 0.88 (0.63, 1.23) 1.58 (1.06, 2.30) [^\*^](#TFN4){ref-type="table-fn"} Family history of obesity No 1.00 1.00 1.00 1.00 Yes 1.93 (1.13, 3.31) [^\*^](#TFN4){ref-type="table-fn"} 1.90 (1.34, 2.69) [^\*\*\*^](#TFN6){ref-type="table-fn"} 1.78 (1.30, 2.43) [^\*\*\*^](#TFN6){ref-type="table-fn"} 2.03 (1.22, 3.38) [^\*\*\*^](#TFN6){ref-type="table-fn"} Number of kids 0--1 1.00 1.00 1.00 1.00 ≥2 0.65 (0.03, 11.6) 1.07 (0.66, 1.72) 1.59 (1.23, 2.05) [^\*\*\*^](#TFN6){ref-type="table-fn"} 2.08 (1.35, 3.19) [^\*\*\*^](#TFN6){ref-type="table-fn"} *P* \< 0.05 *P* \< 0.01 *P* \< 0.001 Multiple logistic regressions considering the simultaneous effect of all the explanatory variables The energy and macronutrient intake of men and women in different subgroups of anthropometric measures are represented in [Table 4](#T4){ref-type="table"}. In both sexes, after adjusting for age, educational and professional profile, overweight/obese men and women presented a lower energy intake from fat than their leaner counterparts. Additionally, men with central obesity were existing higher and lower energy intake from carbohydrates and proteins respectively. ###### Energy and macronutrient intake of men and women in different subgroups of anthropometric measures ***BMI*** ***Abdominal obesity*** ------------------------------------- ----------- ------------------------- ------- ---------- ---------- ------ Men Energy intake (Kcal/day) 3695±956 3468±942 0.18 3719±966 3558±960 0.11 Energy intake from carbohydrate (%) 48.6±8.3 50.5±8.5 0.14 51.6±5.2 55.1±7.9 0.03 Energy intake from protein (%) 19.2±3.4 19.5±3.0 0.40 20.3±2.2 19.3±3.3 0.04 Energy intake from fat (%) 32.2±7.1 30±7.0 0.04 28.4±5.4 25.6±7.3 0.11 Women Energy intake (Kcal/day) 2941±755 3115±825 0.28 3090±768 3020±723 0.60 Energy intake from carbohydrate (%) 49.4±8.0 51.8±9.4 0.12 49.3±8.4 48.4±7.9 0.41 Energy intake from protein (%) 18.9±3.0 19.1±3.2 0.60 19.1±3.0 18.7±3.4 0.45 Energy intake from fat (%) 31.7±7.3 29.1±8.3 0.048 31.6±8.5 32.9±6.7 0.15 BMI: Body Mass Index; CI: Conicity Index // ANCOVA, adjusted for age, employment status, marital status, education, residential place, smoking habit, physical activity and number of kids Discussion ========== We provided population-based estimates of obesity and associated factors in East Azerbaijan, Iran. Around 63.6% of the participants were either overweight or obese. This rate reflects a significant national obesity problem. In this study, higher rates of overweight and obesity were observed when compared with estimates for the Spanish (17%) ([@B21]) and Turkish (19%) ([@B22]) adult population. The results of current study are comparable to those reported by the National Health and Nutrition Examination Survey \[NHANES\] (more than one-third of adult were obese)([@B23]), and in Pakistan (25.0%)([@B24]). According to the results of current study, 75.2% (81.4% in women and 68.6% in men) of the population had of central obesity. Abdominal obesity is a health problem in Iran ([@B25]--[@B27]). The prevalence of abdominal obesity reported being 39.2% in Rio de Janeiro([@B28]), 24.1% in Egypt([@B29]), 30.5% in Australia ([@B30]), and 64.4% in Oman ([@B31]). Additionally, in agreement with other studies, overweight/obesity was significantly more prevalent in the urban than regional areas with rates of 67.3% versus 60.1%([@B32]; [@B33]). Compared to the previous report in Iran ([@B34]) and based on the results of this study, the prevalence of over-weight and obesity is also rapidly increasing among regional residents along with urban ones which have different resons ([@B35]--[@B37]). The prevalence of overweight/obesity and central obesity was even more alarming (76.4%) especially among females (69.3% and 83.2%). These results were dissimilar to the studies in China ([@B38]) and Japan ([@B39]); however, it was in accordance with other provincial and national studies([@B1], [@B16], [@B40]) and consistent with the findings from studies performed in some other countries ([@B16], [@B40], [@B41]). The number of pregnancies, the amount of weight gain in each pregnancy ([@B42]), physical activity pattern and more importantly dietary habits, the social norms and gender responsibilities in traditional communities, where females are perceived primarily as child bearers, may contribute to this gender difference. The results of this study showed that obesity is increasing sharply with age in both sexes which is consistent with the data from other countries ([@B43]--[@B46]). In this study, the alarming point is that 45% of women in the 46--65 yr old age group were obese. Weight gain after menopause, age-related lower metabolic consumption ([@B47]), the decrease in the level of physical activity with age([@B48]) and decrease in height as a person ages([@B33]) were probably the relative causes of increasing obesity with increasing age. In addition, in consistence with other published studies, age has been considered as a predictor of abdominal obesity ([@B49]--[@B52]). Our data indicated that being single was linked with the lower frequency of overweight/obesity and abdominal obesity in both sexes, confirming results of other studies ([@B1], [@B53]). In this study, a high risk of overweight/obesity among unemployed men was also recognized. Unemployed subjects may have lower opportunities for physical activity and, on the other side, may have irregular eating patterns ([@B54]). Unlike other studies, there was no connection between education and obesity in this study ([@B49], [@B55]--[@B58]). Among men, nonsmokers were also more likely to be overweight or obese and abdominally obese than the others. The smoking-BMI connection may be due to the effect of smoking on physiological processes that cause the changes in appetite, food choices, and basal metabolic rates (BMR) ([@B59]). Despite our results, low physical activity and central obesity were associated in other studies reported from Iran and other countries ([@B58]; [@B60]). This observation may be due to this fact that in recent years, many interventions to improve physical activity have been carried out in women between 18 and 65 yr of age in Iran and it seems that obese women tended to increase their physical activity in response to these intervention programs ([@B61]). The connection between family size and the number of children and the prevalence of obesity have been reported in previous studies ([@B32], [@B45], [@B62]). This may be attributed to the age, pregnancy and breastfeeding, the situations most women suppose that it is healthier both for mother and baby to raise their energy intake ([@B63]). Subjects with overweight/obesity and centrally obese subjects reported higher energy intake from fat and carbohydrate. Moreover, abdominally obese men reported lower protein intake than the others. The result of one study showed lower energy intake from proteins in abdominally obese men. High protein diet may increase the thermogenic response and decrease the calorie intake by satiety ([@B64], [@B65]). On the other hand, a high-carbohydrate diet causes hyperinsulinemia, high serum triglycerides and low HDL-C levels ([@B66]) which may cause central obesity. A low-fat, high-carbohydrate diet mainly consisting of highly refined grains and products with added sugar which may increase prevalence of obesity ([@B67]). Conclusion ========== There is high prevalence of overweight/obesity (63.6%) and abdominal obesity (75.2%) among adults. More longitudinal study is desired to investigate the association between socio-demographic factors and obesity. Ethical considerations ====================== Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. The authors wish to thank the Tabriz Health services management research center at Tabriz University of Medical Sciences and Eastern Azerbaijan Governor General for financial support. **Conflict of interest** The authors declare that there is no conflict of interests.

Q: Powershell script that finds and changes hyperlinks in word saves doc and creates a new copy as PDF I am trying to figure out how to write a script that goes through a folder and grabs all word documents in the folder to search for a hyperlink and change the link to another link. Then to save that word document as well as create another version of it converting it to a pdf. How can I adjust the script below to grab all word documents in a folder then search all hyperlinks for "https://www.yahoo.com" to "https://www.google.com". Some how looping through the entire document searching through ALL hyperlinks. Saving that document and then converting and giving a new pdf. Is this possible? What I have so far $word = New-Object -ComObject word.application $document = $word.documents.open("path to folder") $hyperlinks = @($document.Hyperlinks) $hyperlinks | ForEach { $newURI = ([uri]$_.address).AbsoluteUri Write-Verbose ("Updating {0} to {1}" -f $_.Address,$newURI) -Verbose $_.address = $newURI } If (_$.address -eq "https://www.yahoo.com/") { $_.Address = "https://www.google.com/" } ElseIf ($_.Address -eq "http://def.com/motorists") { $_.Address = "http://hij.com/" } $document.save() $word.quit() Get-ChildItem -Path $document -Include *.doc, *.docx -Recurse | ForEach-Object { $doc = $word.Documents.Open($_.Fullname) $pdf = $_.FullName -replace $_.Extension, '.pdf' $doc.ExportAsFixedFormat($pdf,17) $doc.Close() } $word.Quit() I am new to powershell will someone please help walk me through these steps. I hear powershell is probably the best and strongest language to get this sort of thing accomplished. A: Hadn't done this before, so it was nice to figure it out. We both get to learn today! You were very close. Just needed a few adjustments and a loop for handling multiple files. I'm sure someone more knowledgeable will drop in but this should get you the desired result. $NewDomain1 = "google" $NewDomain2 = "hij" $OurDocuments = Get-ChildItem -Path "C:\Apps\testing" -Filter "*.doc*" -Recurse $Word = New-Object -ComObject word.application $Word.Visible = $false $OurDocuments | ForEach-Object { $Document = $Word.documents.open($_.FullName) "Processing file: {0}" -f $Document.FullName $Document.Hyperlinks | ForEach-Object { if ($_.Address -like "https://www.yahoo.com/*") { $NewAddress = $_.Address -Replace "yahoo","google" "Updating {0} to {1}" -f $_.Address,$NewAddress $_.Address = $_.TextToDisplay = $NewAddress } elseif ($_.Address -like "http://def.com/*") { $NewAddress = $_.Address -Replace "def","hij" "Updating {0} to {1}" -f $_.Address,$NewAddress $_.Address = $_.TextToDisplay = $NewAddress } } "Saving changes to {0}" -f $Document.Fullname $Document.Save() $Pdf = $Document.FullName -replace $_.Extension, '.pdf' "Saving document {0} as PDF {1}" -f $Document.Fullname,$Pdf $Document.ExportAsFixedFormat($Pdf,17) "Completed processing {0} `r`n" -f $Document.Fullname $Document.Close() } $Word.Quit() Let's walk through it... We'll first move your new addresses into a couple of variables for ease of referencing and changing in the future. You can also add the addresses that you're looking for here, replacing the hard-coded strings as needed. The third line uses a filter to grab all .DOC and .DOCX files in the directory, which we'll use to iterate over. Personally, I would be careful using the -Recurse switch, as you run the risk of making unintended changes to a file deeper in the directory structure. $NewAddress1 = "https://www.google.com/" $NewAddress2 = "http://hij.com/" $OurDocuments = Get-ChildItem -Path "C:\Apps\testing" -Filter "*.doc*" -Recurse Instantiate our Word Com Object and keep it hidden from view. $Word = New-Object -ComObject word.application $Word.Visible = $false Stepping into our ForEach-Object loop... For each document that we gathered in $OurDocuments, we open it and pipe any hyperlinks into another ForEach-Object, where we check the value of the Address property. If there's a match that we want, we update the property with the new value. You'll notice that we're also updating the TextToDisplay property. This is the text that you see in the document, as opposed to Address which controls where the hyperlink actually goes. This... $_.Address = $_.TextToDisplay = $NewAddress1 ...is an example of multi-variable assignment. Since Address and TextToDisplay will be set to the same value, we'll assign them at the same time. $Document = $Word.documents.open($_.FullName) "Processing file: {0}" -f $Document.FullName $Document.Hyperlinks | ForEach-Object { if ($_.Address -like "https://www.yahoo.com/*") { $NewAddress = $_.Address -Replace "yahoo","google" "Updating {0} to {1}" -f $_.Address,$NewAddress $_.Address = $_.TextToDisplay = $NewAddress } elseif ($_.Address -like "http://def.com/*") { $NewAddress = $_.Address -Replace "def","hij" "Updating {0} to {1}" -f $_.Address,$NewAddress $_.Address = $_.TextToDisplay = $NewAddress } } Save any changes made... "Saving changes to {0}" -f $Document.Fullname $Document.Save() Here we create the new filename for when we save as a PDF. Notice $_.Extension in our first line. We switch to using the pipeline object for referencing the file extension since the current pipeline object is still the file info object from our Get-ChildItem. Since the $Document object doesn't have an extension property, you'd have to do some slicing of the file name to achieve the same result. $Pdf = $Document.FullName -replace $_.Extension, '.pdf' "Saving document {0} as PDF {1}" -f $Document.Fullname,$Pdf $Document.ExportAsFixedFormat($Pdf,17) Close the document up and the loop will move to the next file in $OurDocuments. "Completed processing {0} `r`n" -f $Document.Fullname $Document.Close() Once we run through all documents, we close Word. $Word.Quit() I hope that all makes sense!

[Mental disorders in meningiomas of the olfactory fossa]. In 19 patients with meningiomas of the olfactory fossa the author established a certain development of the psychopathological symptomatology. First of all asthenia ensues, eventually a complacent mood with an underestimation of the severity of the disease and an emotional crudeness is seen. These disorders are gradually substituted by euphoric dementia with a tendency towards foolish jokes, anosognosia of the disease, severe intellectual disorders and a desintegration of the "personality nuclei" with desinhibited drives. The intellectual disorders are expressed not in formal disturbances (logic operations), but in insufficient goal-directness and uncritical thinking.

Wakefield resident promoted to partner at Dalton & Finegold Monday Jan 29, 2018 at 11:51 AMJan 29, 2018 at 11:51 AM Dalton & Finegold LLP, a law firm that specializes in real estate with offices in Andover, Boston and Nashua, New Hampshire, announced that Wakefield resident Brendan Boyle was promoted to partner. Boyle will concentrate on real estate and business law with a focus on the financing, acquisition, disposition and leasing of commercial real estate. Boyle joined Dalton & Finegold in December 2012. He represents institutional and private lenders in the structuring and documentation of commercial real estate loans and the negotiation of documents evidencing such loans. He also represents individual and institutional developers and investors in connection with the acquisition, disposition and leasing of commercial real estate. Boyle also represents individuals and existing companies in connection with organizational formation and general corporate matters. “Dalton & Finegold is a wonderful place to work, as it offers the convenience and flexibility of a suburban office, while attracting high level clients who traditionally would limit their representation to downtown law firms,” said Boyle. “It is a testament to the caliber of attorneys we have here at D&F, all of whom have been instrumental in my professional development.” “Brendan came to the firm while he was still a student at Suffolk Law, and started out as an assistant to the residential paralegal team,” said managing partner Barry Finegold. “What has impressed me the most about Brendan is how he interacts with everyone as equals and values their input. He has defined what treating people with excellence is all about. He has also been someone who helps out whoever he is asked and has been instrumental in the firms’ leadership.” Boyle holds a Bachelor of Arts degree from Boston College, and received his law degree, cum laude, from Suffolk University Law School. Boyle lives in Wakefield with his wife Clare and daughter Lucy. He is originally from Norwell.

People pound their meat to tenderize it. Any meat (chicken too) can be pounded really, but people tend to do steak because it's tough. You can also use meat tenderizers to soften the meat up. In terms of when it is enough, that's not so cut and dry.

In a short time Grand Rêve Vintnershas made a very large impression on the Washington wine scene. The winery, founded by Paul McBride and Ryan Johnson, pairs some of Washington’s best winemakers with fruit from one of the state’s best vineyards – Red Mountain’s Ciel du Cheval (read a Focus Report on the winery here). A hillside vineyard above Ciel also bore its first fruit in 2010. More plantings are in the works. Grand Rêve recently released three new wines – the 2007 Collaboration Series I made by winemaker Ben Smith of Cadence Winery; 2008 Collaboration Series II made by Ross Mickel of Ross Andrew Winery; and 2007 Collaboration Series IV made by Carolyn Lakewold of Donedei. All are stunning, hedonistic wines, perhaps the most impressive from each winemaker yet. The Grand Rêve wines are sold via a mailing list with a limited amount held back for select retailers. These are wines worth seeking out – and cellaring. This is also a Washington winery whose mailing list is worth getting on as Grand Rêve is going nowhere but up. Maison Bleuewinemaker Jon Martinez started out making waves in Washington with a compelling lineup of white wines (read reviews of the 2009 releases here). However, as the winery’s new releases indicate, Martinez is equally skilled with the reds. The 2009 Jaja Red Wine is a new addition to Maison’s lineup - a companion wine to the Jaja White. As I mentioned on Facebook, this wine is a steal at $20. The Gravière, from Upland Vineyard on Snipes Mountain, is also a new offering. This wine is fifty percent Syrah with the rest equal parts Grenache and Mourvedre. The 2009 La Montagnette Grenache is also from Upland (the previous vintage was from Alder Ridge). These two wines show that this tiny viticultural area is one to keep an eye on as an increasing number of winemakers focus on its fruit. All of the 2009 Maison wines are youthful and exuberant with incredibly pure, rich fruit flavors. Impressively, La Montagnette and Gravière tasted as good or better after being open for five days, a sign that patience with these wines will be handsomely rewarded. Maison Bleue La Montagnette Grenache Upland Vineyard Snipes Mountain 2009 $35Rating: */** (Excellent/Exceptional) Brilliantly colored. Aromas of plum, blueberries, and raspberries along with herbal and mineral notes on a lightly aromatic wine that opens up with each swirl of the glass. Tart and richly flavorful with a persistent intensity on the mid-palate and a steely, acidic spine. Capped off by a lingering, fruit filled finish. This wine is still in its youth and will only get better with additional time in the bottle. 95% Grenache, 5% Syrah. 14.8% alcohol. 104 cases produced. Sample provided by winery. Waters WineryWaters Winery has made its mark over the years in part by offering a series of vineyard-designated Syrahs from three Walla Walla vineyards - Forgotten Hills, Pepper Bridge, and Loess. In a recent post on the winery, I noted that making single vineyard Syrah puts one at the mercy of the whims of each vintage. This has never been more apparent than in the last several years for Waters. Frost significantly affected Forgotten Hills Vineyard in 2008, 2009, and 2011 – not allowing winemaker Jamie Brown to make vineyard-designated wines (the juice was instead moved into the Wines of Substance Syrah). The jury is still out on whether a 2010 Forgotten Hills Syrah will make the grade. Things at Pepper Bridge Vineyard have been similarly challenging. This makes the winery’s current releases from the 2008 vintage all the more special. The 2008 Loess Syrah, from Leonetti Cellar’s vineyard, and its Pepper Bridge counterpart are a study in contrast. The Loess is considerably more earthy with thirty percent dry stems added back, contributing to the wine’s tannins and mouthfeel. Ten percent Viognier was also added. The Pepper Bridge wine is considerably more fruit-driven, while still demonstrating earth notes. Both exhibit Waters’ house style of high acid, low oak wines. Waters Winery Loess Syrah Walla Walla Valley 2008 $45Rating: * (Excellent) An appealing, brambly nose with abundant floral notes, orange peel, black olive, sea air, and savory aromas. Over time meat and mineral notes come to the fore. The palate is perfumed and full of fruit – more so than some of the recent vintages – along with earth flavors crisply etched by acidity. Give some additional bottle age and consume with food bring out its best. Syrah with 10% co-fermented Viognier. Aged 16 months in neutral French oak. 14.1% alcohol. 190 cases produced. Sample provided by winery. Walking the aisles at Trader Joe’s recently I came upon a pleasant surprise – a bottle of Rulo Winery’s 2007 Columbia Valley Syrah. Wine Enthusiast writer Paul Gregutt awarded this wine 96 points in the magazine’s August 1st issue – quite an accomplishment for a $20 wine. “Could it possibly be that good?” a reader inquired when I noted on Facebook that I had picked up the bottle. Yes. The 2007 Rulo Syrah is that perfect nexus of an outrageously good wine at an even more outrageous price. Better yet, it will only improve with additional time in the bottle. This wine is a shot across the bow of the state’s many $30+ offerings. Rating: ** (Exceptional) A moderately aromatic wine with pure aromas of blackberry, raspberries, Dimetapp, dark chocolate, mineral notes, and herbs. The palate is incredibly, incredibly dense with rich fruit flavors, almost to the point of being impenetrable. Coats the palate while still remaining light on its feet. Only gets better with more time to breath. Give 1-2 years or decant extensively. 14.5% alcohol. Kaella Winery Rosé of Sangiovese Ciel du Cheval Red Mountain 2010 $17 Nothing says spring like the rosés hitting the shelves. Here Woodinville’s Kaella Winery harkens in the warm weather with a 100% Sangiovese from Ciel du Cheval. This wine was recently featured by Gary Vaynerchuck at Wine Library TV on its 999th show. Rating: + (Good) A very pretty light cherry red color. Spice, strawberry, sour cherry, and bubble gum aromas rise up from the glass. The palate is off-dry and has a full feel with crisp acidity and a spice note on the finish. 13.2% alcohol. 1.65% Residual Sugar. 50 cases produced. Sample provided by winery.

Introduction {#Sec1} ============ Digital health {#Sec2} -------------- According to the World Health Organization (WHO), digital health or eHealth (short for "electronic health") is defined as the cost-effective and secure use of information and communication technologies (ICTs) for health and health-related fields. mHealth (or "mobile health"), as a component of eHealth, involves the provision of health services and information via mobile technologies, such as mobile phones, tablet computers and Personal Digital Assistants (PDAs) \[[@CR1]\]. As stated during the 71st World Health Assembly in Geneva (2018), mobile wireless technologies have the potential to revolutionize the interaction of citizens with national health services. The use of simple and easily accessible digital technologies can improve quality and coverage of care, increase the access to health information and services, raise awareness and promote positive changes in health behaviors to prevent the onset of acute and chronic diseases \[[@CR2]--[@CR4]\]. As the comprehensive implementation of digital health programmes forms a considerable challenge, the WHO Director General encouraged Member States to identify standardized approaches for applying digital health in their health systems and services. Several aspects of traditional health care will be changed by this digital health revolution: (a) the point of care will no longer be the clinic or laboratory, but the patient; (b) the approach to care will be based on the individual patient instead of patient groups with similar diseases; (c) the traditional hierarchy between doctor and patient (the former as an authority) based on prescriptions and orders will be replaced by a partnership-like collaboration (doctor as a guide); (d) patients' data will be determined as personal property, not that of any institution; (e) decisions will be based on the analysis of big data sets in addition to the doctors' experience; (f) the costs of care will be diminished \[[@CR5]\]. Digital health in Allergology {#Sec3} ----------------------------- Digital Health may also have a very positive impact on the management of allergic patients. As stated in a position paper by the American College of Allergy, Asthma and Immunology (ACAAI), allergic patients benefit from telemedicine, for example through a better patient-doctor collaboration, easy access and adherence to allergists' consultation as well as simplified prescription procedures. This positive impact is especially important for patients living in rural or remote areas. However, the authors also point out the need for improved regulations, certification programs, high attention to data protection, and the development of adequate reimbursement systems \[[@CR6]\]. Recently, a Task Force of the European Academy of Allergy and Clinical Immunology (EAACI) published a position paper on "The Role of Mobile Health Technologies in Allergy Care" \[[@CR7]\]. The study group examined over 130 allergy-related apps and reported on the role of mHealth technologies in the area of allergic rhinoconjunctivitis, asthma, atopic dermatitis, chronic urticaria as well as food allergies, anaphylaxis, drug, and venom allergies \[[@CR7]\]. Apps for allergic rhinitis {#Sec4} -------------------------- Although many apps are dedicated to the management and monitoring of allergic rhinitis, only few have been used in studies published in peer-reviewed international journals \[[@CR7], [@CR8]\]. A very large collaborative network focused on rhinitis and its treatment is accumulating evidence through the worldwide use of MASK-Air (MASK standing for Mobile Airways Sentinel Network). This electronic clinical diary assesses nasal, ocular and lung symptoms, as well as work impairment and global health via a visual analogue scale (VAS) \[[@CR9]\]. MASK-Air has already accumulated real-life data from a large number of patients worldwide, whose analysis has led to innovative knowledge on productivity at work, innovative patterns of treatment, and new allergic disease phenotypes \[[@CR10]\]. A model of individualized prediction of allergic rhinitis symptoms, named Patient's Hay-fever Diary (PHD), has been developed in Austria \[[@CR11]\]. By combining input from the patients (symptoms and medications) along with environmental information, an improved management of the disease is pursued through symptom forecasting \[[@CR11]\]. In this review, we summarize the clinical and research experience that our group has gathered over the last decade with the platform "AllergyMonitor", an eDiary for allergic rhinitis and allergen immunotherapy whose first version was developed in Rome, Italy, in 2009. In the following sections, we shall illustrate the structure and content of the digital platform, show exemplary reports of clinical cases, an illustration of the scientific studies based on AllergyMonitor, the perspective of studies in progress and the implications for allergy practice in real-life settings. AllergyMonitor {#Sec222} ============== AllergyMonitor: targets, structure, functions {#Sec5} --------------------------------------------- Allergymonitor (TPS software production, Rome, Italy) is an online service developed in 2009 with the aim of enabling the recording of clinical symptoms, drug consumption and adherence to allergen-specific sublingual immunotherapy (SLIT) as well as monitoring efficacy of SLIT or subcutaneous immunotherapy (SCIT) by patients with allergic rhino-conjunctivitis and/or asthma. The system, available to everyone and straightforward to use, consists of two parts: a patient app (front end) and a website for the attending doctor (back-office), and the whole system is free during the actual Covid-19 pandemic. The app, that patients can freely download form Google Play and Apple Store, is available in different languages. On a daily basis, the user is requested to fill a short and visually enhanced questionnaire about his/her symptoms of the eyes, nose and lungs, as well as a visual analogue scale on his/her general allergic condition. Once activated by the doctor via the back-office, the app user is also enabled to record his/her daily medication intake, adherence to sublingual immunotherapy and potentially occurring side effects. In order to provide a summary and feedback to the user, all entered data can be easily accessed within the app in summarized graphs showing the evolution of symptoms over time (Fig. [1](#Fig1){ref-type="fig"})**.**Fig. 1Screenshot examples of the front end of AllergyMonitor app. On a daily basis, the user fills a short and visually enhanced questionnaire about his symptoms of the eyes, nose and lungs, as well as a visual analogue scale on his/her general condition. Once activated by the doctor via the back-office, the user is also enabled to record his/her daily medication intake, adherence to sublingual immunotherapy and potentially occurring side effects. In order to provide a summary and feedback to the user, all entered data can be easily accessed within the app in summarized graphs showing the evolution of symptoms over time Via his/her back-office, the doctor is able to access a breakdown of all recorded data as well as individual patient reports accessible as different symptom (and medication) scores (Rhinoconjunctivitis Total Symptom Score (RTSS), average adjusted symptom score (AdSS), rescue medication score (RMS), average combined score (ACS)) and matched to local pollen monitoring data, which is retrieved using validated methodologies. More specifically: pollen is collected in pollen traps, analyzed by aerobiologists, and this data is incorporated in AllergyMonitor. The data import is done by email, weekly through an automatic system in Italy, and manually for other countries where AllergyMonitor is being used. A messaging system between doctor and patient based on e-mail, chat or SMS (short message service) facilitates direct communication. An automatic alert system points out missed days of recording to both, front end and back-office users. Keeping in line with an approach of blended care, the back-office enables the doctor to configure each patient's front end individually by entering for example symptomatic drugs or adding an immunotherapy intake and side effects monitoring (Fig. [2](#Fig2){ref-type="fig"})**.**Fig. 2Screenshots of the doctor's AllergyMonitor back-office. Via his/her back-office, the doctor is able to access a breakdown of all recorded data as well as individual patient reports accessible as different symptom (and medication) scores and matched to local pollen monitoring data. A messaging system between doctor and patient based on e-mail, chat or SMS (short message service) facilitates direct communication. The back-office enables the doctor to configure each patient's front end individually by entering for example symptomatic drugs or adding an immunotherapy intake and side effects monitoring Clinical report {#Sec6} --------------- On the basis of data registered via the front end (app), the software generates a printable report for the app user (Fig. [3](#Fig3){ref-type="fig"})**.** The report is divided into several sections: **Doctor's prescription --** recommended monitoring period, pharmacotherapy, allergen-specific immunotherapy;**Symptoms vs pollen counts -** Graphs illustrating the time-trends of selected symptom severity scores and pollen counts.**Medication diary --** A table illustrating the intake of drugs and/or SLIT during the monitoring period.**Statistical summary --** A series of indexes summarizing the patient's adherence to symptom recording, as well as drug and SLIT intake.**Space for the doctor's comments --** marked empty space for comments and notes from the treating physician.Fig. 3AllergyMonitor report: an example referring to a pediatric patient. The software generates a printable report for the user. The report is divided into several sections, as follows: **a**) doctor's prescription: recommended monitoring period, pharmacotherapy, allergen-specific immune-therapy; **b**) symptoms vs pollen counts: graphs illustrating the time-trends of selected symptom severity scores and pollen counts; **c**) medication diary: table illustrating the intake of drugs and/or SLIT during the monitoring period; **d**) statistical summary: a series of indexes summarizing the patient's adherence to symptom recording, as well as drug and SLIT intake; **e)** space for the doctor's comments: marked empty space for comments and notes from the treating physician The report produced by AllergyMonitor can be printed and given by the patient to the physician of his/her choice, but also directly sent by mail from the app to the doctor. The doctor can then base further clinical examinations and diagnostic or therapeutic prescriptions also on the data prospectively acquired by the patient during the monitoring period. The volume, reliability and precision of the information provided by the eDiary may represent a valuable and time-efficient add-on to the information retrospectively collected during an often short interview, frequently done months after the relevant clinical episodes and possibly influenced by a strong recall bias. Scientific studies {#Sec7} ------------------ Since 2010, our group has used AllergyMonitor in a series of clinical studies on allergic rhinitis. The results of these have illustrated how the system can be deployed to support the etiological diagnosis, symptom prediction, adherence to therapy, and decision on AIT prescription for patients presenting with seasonal allergic diseases. **Etiological diagnosis of seasonal allergic rhinitis (SAR) --** The analysis of the allergic rhinitis symptom severity scores during pollen exposure can be used to evaluate the clinical relevance of a patient's sensitization to a specific pollen. This statement has been exemplified by describing two patients suffering from SAR with similar diagnostic challenges \[[@CR12]\]. In both patients, no clear-cut decision could be reached based on a traditional allergological evaluation (clinical history, SPT,) plus molecular IgE assessment against relevant genuine and cross-reacting allergenic molecules (Ole e 1, Phl p1, Phl p 5). However, the prospective and consistent recording of nasal and conjunctival symptoms during the pollination period contributed fundamentally to the identification of the trigger-pollen (olive for patient one (Fig. [4](#Fig4){ref-type="fig"}a), grass pollen for patient two (Fig. [4](#Fig4){ref-type="fig"}b)). To our knowledge, this was the first report of an etiological diagnosis of pollen allergy substantiated by a smartphone app. The comparison of symptom severity scores (RTSS in this case) with pollen concentration data may therefore guide the doctor in the choice of the correct immunotherapy composition \[[@CR12]\].**Short-term prediction of allergic symptoms --** We used AllergyMonitor to test the efficiency of a model to forecast symptoms of pollen-related SAR at individual patient level. We analyzed prospectively recorded symptom and medication data (April to June 2010--2011) of 21 Italian children affected by allergic rhinoconjunctivitis. Using the average combined score (ACS) of symptoms and medication, we found that the short-term forecast of seasonal allergic rhinitis symptoms is possible even in highly poly-sensitized patients in geographic areas with complex pollen exposure. We further concluded that predictive models must be tailored to the individual patient's allergic susceptibility. This may lead to a better use of anti-symptomatic drugs, especially considering their targeted intake before the expected raise of symptoms \[[@CR13]\].**Adherence to eDiary compilation -** Several e-Diaries are available for pollen allergies in European countries, some of them also having been used in trials or observational studies \[[@CR10], [@CR14]--[@CR18]\]. In most of the study settings, the respective app was directly downloaded by patients, with no or only occasional intervention of the allergist \[[@CR18]--[@CR20]\]. Although the use of mobile technologies permits an unprecedentedly easy collection of big data sets independent from geographic location and social differences, some observational studies were characterized by a poor adherence of their users to data recording, sometimes even dropping below 10% after only 2 weeks \[[@CR10], [@CR19]\]. As the role of the attending physician has been shown to be of great importance for medication-compliance in patients \[[@CR21]\], we wondered whether this also holds true for the adherence to digital symptom diaries. In an Italian bi-center study involving 101 children and 93 adults, patients were instructed very clearly on the use of AllergyMonitor and received personal reminders via phone in addition to automated alert messages in case of missed recording \[[@CR22]\]. After completing the individualized monitoring periods, we could observe an overall adherence of ≥90% within the first week, with a decline to 80--90% between week 2 and 6 and then finally dropping to 70--80% after week 7 (Fig. [5](#Fig5){ref-type="fig"}). Interestingly, the individual adherence level in week 2 and 3 was able to predict a patient's overall adherence to monitoring with enough confidence (Spearman's *p* -0.55, *P* \< .001 in both centers). We concluded that adherence to daily recording of an eDiary, provided that it is prescribed and eagerly motivated by a physician in a blended care setting, is very high.**Adherence to drug therapy --** As an important cause for treatment failure in asthma and rhinitis is suboptimal adherence to local corticosteroids \[[@CR23]\], we hypothesized that the use of a monitoring app with a reminder system might be able to optimize also medication-compliance and by this the clinical management of respiratory allergic diseases. The need to take medications regularly to obtain maximum effect even when asymptomatic is a particular problem for chronic diseases with episodic symptom occurrence, such as seasonal allergic rhinitis (hay fever). The reasons for suboptimal adherence are complex, but the key to successful management is good education both in the rationale for treatment and inhaler technique. Telemedicine has found its way into most corners of health care, but there is relatively little published on its potential role in allergic disease. Therefore, we have undertaken an original study looking at the value of telemonitoring on adherence to daily treatment with topical corticosteroids in children with severe hay fever \[[@CR15]\]. The study demonstrated an improvement in both adherence to daily drug medication and disease knowledge. No improvement was seen in disease control, but pollen counts were low during the study period (Fig. [6](#Fig6){ref-type="fig"}).**Adherence to Sublingual Immunotherapy --** The only disease-modifying treatment option for allergic rhinoconjunctivitis and asthma so far is an allergen-specific immunotherapy \[[@CR24]\], which is mostly administered as repeated subcutaneous injections or the daily intake of sublingual tablets/drops. One of the most relevant problems linked to the long-term daily administration of sublingual immunotherapy (SLIT) is poor compliance and a high dropout rate. Only 50 and 20% of the patients starting the treatment with SLIT continue its daily administration in the second and third year of treatment, respectively \[[@CR25]\]. When comparing long-term adherence of a small group of patients undergoing SLIT with usual care support versus a group of patients receiving SLIT plus digital adherence monitoring via AllergyMonitor, we observed a clear reduction in the drop-out rate in the second year of therapy among 28 patients with digital support \[[@CR26]\]. (Fig. [7](#Fig7){ref-type="fig"})**Comparison of disease severity scores** -- To assess the impact of different methodological approaches on the interpretation of digitally and prospectively collected data, we used several different symptom severity scores to analyze the data sets of two pediatric cohorts. In brief, 76 children with SAR from Ascoli Piceno (Italy) and 29 grass pollen allergic participants from Berlin (Germany), were asked to monitor their daily symptoms via the app during a period of 2 months within the local grass pollen season. We then prospectively compared six different severity scores for allergic rhinitis (AR) against pollen counts at both population and individual level (Fig. [8](#Fig8){ref-type="fig"}) \[[@CR14]\], namely the Rhinoconjunctivitis Total Symptom Score (RTSS), the Adjusted Rhinoconjunctivitis Total Symptom Score (method: last observation carried forward) adjRTSS \[LOCF\], Adjusted Rhinoconjunctivitis Total Symptom Score (method: worst case) adjRTSS \[WC\] (rhinoconjunctivitis total symptom score \[worst case\]), the Rhino-conjunctivitis Allergy-Control-SCORE (RC-ACS©) the average combined score (ACS), and the average adjusted symptom score (AdSS). We found that the disease severity scores for SAR tend to provide similar results at population level but often produce heterogeneous slopes in individual patients. On this basis, we concluded that the choice of the disease severity score might have only a low impact on the outcome of a large clinical trial, but it may be crucial for the management of individual patients \[[@CR14]\].Fig. 4Trajectories of symptom severity vs pollen counts in two pediatric patients (**a**: patient 1; **b**: patient 2) from Ascoli Piceno with allergic rhinitis, and similar allergic profile, according to SPT and CRD. Data on severity of symptoms -- collected with AllergyMonitor -- have been reported as Rhinoconjunctivitis Total Symptom Score (RTSS). Pollen counts (grains/m3) were obtained from the local pollen trap. Reprinted with permission from \[[@CR12]\]Fig. 5Adherence (%) by reporting day and study center. It is possible to describe three phases (indicated by light background color): the 1st phase (**a**), lasting 6 days, during which adherence falls from 100 to 90%; the 2nd phase (**b**), lasting approximately 20 days, during which adherence fluctuates until reaching 88%; the 3rd phase (**c**) during which it declines to 80%. Reprinted with permission from \[[@CR22]\]Fig. 6Impact of a eDiary on (**a**) medication adherence and (**b**) knowledge on disease. **a**) Adherence to daily medication with nasal corticosteroid (Mometasone) in children with Seasonal Allergic Rhinitis following usual care or being monitored with AllergyMonitor. **b**) Frequency of correct answers to knowledge test taken before and after the recording of symptoms connected to bits of information on allergic rhinoconjunctivitis provided via AllergyMonitor after every registration. Reprinted with permission from \[[@CR15]\]Fig. 7Impact of a eDiary on adherence to SLIT. Adherence to SLIT medication in children with Seasonal Allergic Rhinitis following usual care or being monitored with AllergyMonitor. Reprinted with permission from \[[@CR26]\]Fig. 8Parallel evaluation of multiple disease severity scores. Trajectories of normalized mean daily values of six disease severity scores in (**a**) 76 Italian, and (**b**) 29 German children with grass pollen-related seasonal allergic rhinitis, during the grass pollen season. Reprinted with permission from \[[@CR14]\] Clinical routine and future perspectives {#Sec8} ---------------------------------------- The use of AllergyMonitor in routine clinical practice started in 2009 in the Pediatric Allergy Unit of the Pertini Hospital in Rome. During 10 years of activity, about 9500 patients seeking care for allergic rhinitis in this hospital have used the eDiary. On the other hand, about 130 allergists and pediatricians in 10 countries have prescribed the use of the app among their patients for clinical and/or research purposes. Individual user feedback from doctors shows, that the most appreciated benefits of prospectively collected clinical data plus pollen counts is the increased diagnostic precision especially for poly-sensitized patients but also the improved adherence to SLIT (Fig. [9](#Fig9){ref-type="fig"}). As one of the main benefits of AllergyMonitor is the interaction and feedback from the doctor, the initiative to introduce AllergyMonitor into the patients'routine comes predominantly from the medical teams. Fig. 9Symptom monitoring of a pediatric patient with SAR during grass pollen SLIT**.** RTSS and pollen trajectories before starting SLIT (**a**) and after 1 (**b**), 2 (**c**) and 3 years of SLIT (**d**) To evaluate the combined impact of molecular IgE results and mobile health technologies on the precision of SAR diagnosis, our group has recently integrated AllergyMonitor in a more complex, still experimental clinical decision support system (CDSS). This CDSS is based on several steps of the diagnostic workup: collection of clinical history, retrospective pollen calendar, determination of allergic sensitization with allergen extracts, component-resolved diagnostics (that already has a very important role for the allergic diagnostic precision), clinical monitoring via eDiary, and parallel pollen count data. Algorithms then visualize the clinical and diagnostic picture of a patient by interpreting all entered data according to international guidelines for every individual step. The impact of this CDSS on the physicians' diagnostic and therapeutic decisions has been evaluated in an Italian pilot study (\@IT.2020) as well as an international multicenter project (\@IT.2020MC) involving 815 patients and over 150 doctors from nine study centers in seven Southern European countries \[[@CR27]\]. Conclusions and perspectives {#Sec9} ============================ The studies and clinical practice based on the use of AllergyMonitor have proven the reliability of prospective digital data collection via eDiary as well as its impact on patient adherence to both, drug therapy and allergen immunotherapy. The role of the attending physician is fundamental, not only for an optimal adherence to digital technologies, but also in a collaborative setting of blended care. Over time, the interaction between doctors and patients will progressively change with the increasing use of digital opportunities. The possibility of expanding the use of eDiaries and other mHealth platforms into forecasting, through the translation of gathered data into a way of preventing individual patient exposure to unfavorable conditions such as high pollen counts, elevated air pollution levels, anti-symptomatic drug intake, is another important aspect to be taken into account. In order to implement these technologies responsibly in clinical practice to improve patient participation and care, studies and regulatory infrastructure are needed as acknowledged by international organizations such as the WHO. Given the current pandemic setting and unprecedent situation wordlwide, the impact and urgency of reliable and qualified mHealth systems is evident. In a time where human contact has been reduced, and health institutions and teams are overwelmed with critical patients, the benefits provided by digital platforms in patient care are substantial. It is, therefore, urgent to move forward with regulations and developments in this perspective. ACAAI : American College of Allergy, Asthma and Immunology ACS : Average combined score adjRTSS \[LOCF\] : Adjusted Rhinoconjunctivitis Total Symptom Score (method: last observation carried forward) adjRTSS \[WC\] : Adjusted Rhinoconjunctivitis Total Symptom Score (method: worst case) AdSS : Average adjusted symptom score AIT : Allergen immunotherapy AR : Allergic rhinitis CDSS : Clinical decision support system EAACI : European Academy of Allergy and Clinical Immunology eDiary : Electronic diary eHealth : Electronic health ICT : Information and communication technologies MASK : Mobile Airway Sentinel Network mHealth : Mobile health PDA : Personal digital assistant RC-ACS© : Rhino-conjunctivitis Allergy-control-score RMS : Rescue medication score RTSS : Rhinoconjunctivitis total symptom score SAR : Seasonal allergic rhinitis SCIT : Subcutaneous immunotherapy SLIT : Sublingual immunotherapy SMS : Short message service SPT : Skin prick test VAS : Visual analogue scale WHO : World Health Organization **Publisher's Note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Tripodi Salvatore and Giannone Andrea contributed equally to this work. Not applicable. ST and AG contributed equally in writing the manuscript. IS, SP, SD, AB, AP, FJ, VV, EP were involved in data collection and analysis. PM and ST conceived the studies. All authors edited, reviewed and approved the final manuscript. Not applicable. The datasets generated during and/or analyzed during the current study are not publicly available. This was a review article and not a study involving human subjects, so IRB approval was not required. Not applicable. Dr. Tripodi reports personal fees from TPS Production srl, during the conduct of the study; In addition, Dr. Tripodi has a patent 102,017,000,106,570 issued to TPS Production srl. Simone Pelosi reports personal fees from TPS Production srl. P.M. Matricardi is funded by the Deutsche Forschungsgemeinschaft (DFG; grant number MA 4740/2--1), is a consultant for HYCOR Biomedical, Euroimmun, Thermo Fisher Scientific (TFS), has received research funding from HYCOR Biomedical, Euroimmun, reagents for research from Thermofisher; and speaker's fees from Euroimmun, Thermo Fisher Scientific, Stallergenes-Greer, HAL Allergy. All other authors declare that they have no conflict of interest.

// MESSAGE SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST PACKING #define MAVLINK_MSG_ID_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST 63 typedef struct __mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t { int16_t roll[4]; ///< Desired roll angle in radians +-PI (+-32767) int16_t pitch[4]; ///< Desired pitch angle in radians +-PI (+-32767) int16_t yaw[4]; ///< Desired yaw angle in radians, scaled to int16 +-PI (+-32767) uint16_t thrust[4]; ///< Collective thrust, scaled to uint16 (0..65535) uint8_t group; ///< ID of the quadrotor group (0 - 255, up to 256 groups supported) uint8_t mode; ///< ID of the flight mode (0 - 255, up to 256 modes supported) uint8_t led_red[4]; ///< RGB red channel (0-255) uint8_t led_blue[4]; ///< RGB green channel (0-255) uint8_t led_green[4]; ///< RGB blue channel (0-255) } mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t; #define MAVLINK_MSG_ID_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_LEN 46 #define MAVLINK_MSG_ID_63_LEN 46 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_ROLL_LEN 4 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_PITCH_LEN 4 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_YAW_LEN 4 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_THRUST_LEN 4 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_LED_RED_LEN 4 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_LED_BLUE_LEN 4 #define MAVLINK_MSG_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST_FIELD_LED_GREEN_LEN 4 #define MAVLINK_MESSAGE_INFO_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST { \ "SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST", \ 9, \ { { "roll", NULL, MAVLINK_TYPE_INT16_T, 4, 0, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, roll) }, \ { "pitch", NULL, MAVLINK_TYPE_INT16_T, 4, 8, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, pitch) }, \ { "yaw", NULL, MAVLINK_TYPE_INT16_T, 4, 16, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, yaw) }, \ { "thrust", NULL, MAVLINK_TYPE_UINT16_T, 4, 24, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, thrust) }, \ { "group", NULL, MAVLINK_TYPE_UINT8_T, 0, 32, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, group) }, \ { "mode", NULL, MAVLINK_TYPE_UINT8_T, 0, 33, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, mode) }, \ { "led_red", NULL, MAVLINK_TYPE_UINT8_T, 4, 34, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, led_red) }, \ { "led_blue", NULL, MAVLINK_TYPE_UINT8_T, 4, 38, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, led_blue) }, \ { "led_green", NULL, MAVLINK_TYPE_UINT8_T, 4, 42, offsetof(mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t, led_green) }, \ } \ } /** * @brief Pack a set_quad_swarm_led_roll_pitch_yaw_thrust message * @param system_id ID of this system * @param component_id ID of this component (e.g. 200 for IMU) * @param msg The MAVLink message to compress the data into * * @param group ID of the quadrotor group (0 - 255, up to 256 groups supported) * @param mode ID of the flight mode (0 - 255, up to 256 modes supported) * @param led_red RGB red channel (0-255) * @param led_blue RGB green channel (0-255) * @param led_green RGB blue channel (0-255) * @param roll Desired roll angle in radians +-PI (+-32767) * @param pitch Desired pitch angle in radians +-PI (+-32767) * @param yaw Desired yaw angle in radians, scaled to int16 +-PI (+-32767) * @param thrust Collective thrust, scaled to uint16 (0..65535) * @return length of the message in bytes (excluding serial stream start sign) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_pack(uint8_t system_id, uint8_t component_id, mavlink_message_t* msg, uint8_t group, uint8_t mode, const uint8_t *led_red, const uint8_t *led_blue, const uint8_t *led_green, const int16_t *roll, const int16_t *pitch, const int16_t *yaw, const uint16_t *thrust) { #if MAVLINK_NEED_BYTE_SWAP || !MAVLINK_ALIGNED_FIELDS char buf[46]; _mav_put_uint8_t(buf, 32, group); _mav_put_uint8_t(buf, 33, mode); _mav_put_int16_t_array(buf, 0, roll, 4); _mav_put_int16_t_array(buf, 8, pitch, 4); _mav_put_int16_t_array(buf, 16, yaw, 4); _mav_put_uint16_t_array(buf, 24, thrust, 4); _mav_put_uint8_t_array(buf, 34, led_red, 4); _mav_put_uint8_t_array(buf, 38, led_blue, 4); _mav_put_uint8_t_array(buf, 42, led_green, 4); memcpy(_MAV_PAYLOAD_NON_CONST(msg), buf, 46); #else mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t packet; packet.group = group; packet.mode = mode; mav_array_memcpy(packet.roll, roll, sizeof(int16_t)*4); mav_array_memcpy(packet.pitch, pitch, sizeof(int16_t)*4); mav_array_memcpy(packet.yaw, yaw, sizeof(int16_t)*4); mav_array_memcpy(packet.thrust, thrust, sizeof(uint16_t)*4); mav_array_memcpy(packet.led_red, led_red, sizeof(uint8_t)*4); mav_array_memcpy(packet.led_blue, led_blue, sizeof(uint8_t)*4); mav_array_memcpy(packet.led_green, led_green, sizeof(uint8_t)*4); memcpy(_MAV_PAYLOAD_NON_CONST(msg), &packet, 46); #endif msg->msgid = MAVLINK_MSG_ID_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST; return mavlink_finalize_message(msg, system_id, component_id, 46, 130); } /** * @brief Pack a set_quad_swarm_led_roll_pitch_yaw_thrust message on a channel * @param system_id ID of this system * @param component_id ID of this component (e.g. 200 for IMU) * @param chan The MAVLink channel this message was sent over * @param msg The MAVLink message to compress the data into * @param group ID of the quadrotor group (0 - 255, up to 256 groups supported) * @param mode ID of the flight mode (0 - 255, up to 256 modes supported) * @param led_red RGB red channel (0-255) * @param led_blue RGB green channel (0-255) * @param led_green RGB blue channel (0-255) * @param roll Desired roll angle in radians +-PI (+-32767) * @param pitch Desired pitch angle in radians +-PI (+-32767) * @param yaw Desired yaw angle in radians, scaled to int16 +-PI (+-32767) * @param thrust Collective thrust, scaled to uint16 (0..65535) * @return length of the message in bytes (excluding serial stream start sign) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_pack_chan(uint8_t system_id, uint8_t component_id, uint8_t chan, mavlink_message_t* msg, uint8_t group,uint8_t mode,const uint8_t *led_red,const uint8_t *led_blue,const uint8_t *led_green,const int16_t *roll,const int16_t *pitch,const int16_t *yaw,const uint16_t *thrust) { #if MAVLINK_NEED_BYTE_SWAP || !MAVLINK_ALIGNED_FIELDS char buf[46]; _mav_put_uint8_t(buf, 32, group); _mav_put_uint8_t(buf, 33, mode); _mav_put_int16_t_array(buf, 0, roll, 4); _mav_put_int16_t_array(buf, 8, pitch, 4); _mav_put_int16_t_array(buf, 16, yaw, 4); _mav_put_uint16_t_array(buf, 24, thrust, 4); _mav_put_uint8_t_array(buf, 34, led_red, 4); _mav_put_uint8_t_array(buf, 38, led_blue, 4); _mav_put_uint8_t_array(buf, 42, led_green, 4); memcpy(_MAV_PAYLOAD_NON_CONST(msg), buf, 46); #else mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t packet; packet.group = group; packet.mode = mode; mav_array_memcpy(packet.roll, roll, sizeof(int16_t)*4); mav_array_memcpy(packet.pitch, pitch, sizeof(int16_t)*4); mav_array_memcpy(packet.yaw, yaw, sizeof(int16_t)*4); mav_array_memcpy(packet.thrust, thrust, sizeof(uint16_t)*4); mav_array_memcpy(packet.led_red, led_red, sizeof(uint8_t)*4); mav_array_memcpy(packet.led_blue, led_blue, sizeof(uint8_t)*4); mav_array_memcpy(packet.led_green, led_green, sizeof(uint8_t)*4); memcpy(_MAV_PAYLOAD_NON_CONST(msg), &packet, 46); #endif msg->msgid = MAVLINK_MSG_ID_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST; return mavlink_finalize_message_chan(msg, system_id, component_id, chan, 46, 130); } /** * @brief Encode a set_quad_swarm_led_roll_pitch_yaw_thrust struct into a message * * @param system_id ID of this system * @param component_id ID of this component (e.g. 200 for IMU) * @param msg The MAVLink message to compress the data into * @param set_quad_swarm_led_roll_pitch_yaw_thrust C-struct to read the message contents from */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_encode(uint8_t system_id, uint8_t component_id, mavlink_message_t* msg, const mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t* set_quad_swarm_led_roll_pitch_yaw_thrust) { return mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_pack(system_id, component_id, msg, set_quad_swarm_led_roll_pitch_yaw_thrust->group, set_quad_swarm_led_roll_pitch_yaw_thrust->mode, set_quad_swarm_led_roll_pitch_yaw_thrust->led_red, set_quad_swarm_led_roll_pitch_yaw_thrust->led_blue, set_quad_swarm_led_roll_pitch_yaw_thrust->led_green, set_quad_swarm_led_roll_pitch_yaw_thrust->roll, set_quad_swarm_led_roll_pitch_yaw_thrust->pitch, set_quad_swarm_led_roll_pitch_yaw_thrust->yaw, set_quad_swarm_led_roll_pitch_yaw_thrust->thrust); } /** * @brief Send a set_quad_swarm_led_roll_pitch_yaw_thrust message * @param chan MAVLink channel to send the message * * @param group ID of the quadrotor group (0 - 255, up to 256 groups supported) * @param mode ID of the flight mode (0 - 255, up to 256 modes supported) * @param led_red RGB red channel (0-255) * @param led_blue RGB green channel (0-255) * @param led_green RGB blue channel (0-255) * @param roll Desired roll angle in radians +-PI (+-32767) * @param pitch Desired pitch angle in radians +-PI (+-32767) * @param yaw Desired yaw angle in radians, scaled to int16 +-PI (+-32767) * @param thrust Collective thrust, scaled to uint16 (0..65535) */ #ifdef MAVLINK_USE_CONVENIENCE_FUNCTIONS static inline void mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_send(mavlink_channel_t chan, uint8_t group, uint8_t mode, const uint8_t *led_red, const uint8_t *led_blue, const uint8_t *led_green, const int16_t *roll, const int16_t *pitch, const int16_t *yaw, const uint16_t *thrust) { #if MAVLINK_NEED_BYTE_SWAP || !MAVLINK_ALIGNED_FIELDS char buf[46]; _mav_put_uint8_t(buf, 32, group); _mav_put_uint8_t(buf, 33, mode); _mav_put_int16_t_array(buf, 0, roll, 4); _mav_put_int16_t_array(buf, 8, pitch, 4); _mav_put_int16_t_array(buf, 16, yaw, 4); _mav_put_uint16_t_array(buf, 24, thrust, 4); _mav_put_uint8_t_array(buf, 34, led_red, 4); _mav_put_uint8_t_array(buf, 38, led_blue, 4); _mav_put_uint8_t_array(buf, 42, led_green, 4); _mav_finalize_message_chan_send(chan, MAVLINK_MSG_ID_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST, buf, 46, 130); #else mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t packet; packet.group = group; packet.mode = mode; mav_array_memcpy(packet.roll, roll, sizeof(int16_t)*4); mav_array_memcpy(packet.pitch, pitch, sizeof(int16_t)*4); mav_array_memcpy(packet.yaw, yaw, sizeof(int16_t)*4); mav_array_memcpy(packet.thrust, thrust, sizeof(uint16_t)*4); mav_array_memcpy(packet.led_red, led_red, sizeof(uint8_t)*4); mav_array_memcpy(packet.led_blue, led_blue, sizeof(uint8_t)*4); mav_array_memcpy(packet.led_green, led_green, sizeof(uint8_t)*4); _mav_finalize_message_chan_send(chan, MAVLINK_MSG_ID_SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST, (const char *)&packet, 46, 130); #endif } #endif // MESSAGE SET_QUAD_SWARM_LED_ROLL_PITCH_YAW_THRUST UNPACKING /** * @brief Get field group from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return ID of the quadrotor group (0 - 255, up to 256 groups supported) */ static inline uint8_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_group(const mavlink_message_t* msg) { return _MAV_RETURN_uint8_t(msg, 32); } /** * @brief Get field mode from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return ID of the flight mode (0 - 255, up to 256 modes supported) */ static inline uint8_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_mode(const mavlink_message_t* msg) { return _MAV_RETURN_uint8_t(msg, 33); } /** * @brief Get field led_red from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return RGB red channel (0-255) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_led_red(const mavlink_message_t* msg, uint8_t *led_red) { return _MAV_RETURN_uint8_t_array(msg, led_red, 4, 34); } /** * @brief Get field led_blue from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return RGB green channel (0-255) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_led_blue(const mavlink_message_t* msg, uint8_t *led_blue) { return _MAV_RETURN_uint8_t_array(msg, led_blue, 4, 38); } /** * @brief Get field led_green from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return RGB blue channel (0-255) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_led_green(const mavlink_message_t* msg, uint8_t *led_green) { return _MAV_RETURN_uint8_t_array(msg, led_green, 4, 42); } /** * @brief Get field roll from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return Desired roll angle in radians +-PI (+-32767) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_roll(const mavlink_message_t* msg, int16_t *roll) { return _MAV_RETURN_int16_t_array(msg, roll, 4, 0); } /** * @brief Get field pitch from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return Desired pitch angle in radians +-PI (+-32767) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_pitch(const mavlink_message_t* msg, int16_t *pitch) { return _MAV_RETURN_int16_t_array(msg, pitch, 4, 8); } /** * @brief Get field yaw from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return Desired yaw angle in radians, scaled to int16 +-PI (+-32767) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_yaw(const mavlink_message_t* msg, int16_t *yaw) { return _MAV_RETURN_int16_t_array(msg, yaw, 4, 16); } /** * @brief Get field thrust from set_quad_swarm_led_roll_pitch_yaw_thrust message * * @return Collective thrust, scaled to uint16 (0..65535) */ static inline uint16_t mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_thrust(const mavlink_message_t* msg, uint16_t *thrust) { return _MAV_RETURN_uint16_t_array(msg, thrust, 4, 24); } /** * @brief Decode a set_quad_swarm_led_roll_pitch_yaw_thrust message into a struct * * @param msg The message to decode * @param set_quad_swarm_led_roll_pitch_yaw_thrust C-struct to decode the message contents into */ static inline void mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_decode(const mavlink_message_t* msg, mavlink_set_quad_swarm_led_roll_pitch_yaw_thrust_t* set_quad_swarm_led_roll_pitch_yaw_thrust) { #if MAVLINK_NEED_BYTE_SWAP mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_roll(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->roll); mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_pitch(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->pitch); mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_yaw(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->yaw); mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_thrust(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->thrust); set_quad_swarm_led_roll_pitch_yaw_thrust->group = mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_group(msg); set_quad_swarm_led_roll_pitch_yaw_thrust->mode = mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_mode(msg); mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_led_red(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->led_red); mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_led_blue(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->led_blue); mavlink_msg_set_quad_swarm_led_roll_pitch_yaw_thrust_get_led_green(msg, set_quad_swarm_led_roll_pitch_yaw_thrust->led_green); #else memcpy(set_quad_swarm_led_roll_pitch_yaw_thrust, _MAV_PAYLOAD(msg), 46); #endif }

Q: What is the .bashrc equivalent of $MYVIMRC? I can get the path of .vimrc file by echo $MYVIMRC, then is their a $MYBASHRC-like approach for .bashrc? I have tried $MYBASHRC, $BASHRC and $BASH, but all failed. If there is one, what is it? If not, how can I define one myself? A: Look in the Bash manual under startup files. BASH_ENV seems to be closest to what you're looking for, but read the description very carefully — and compare and contrast with the other subsections under 'startup files'.

Callia azurea Callia azurea is a species of beetle in the family Cerambycidae. It was described by Audinet-Serville in 1835. It is known from Brazil. References Category:Calliini Category:Beetles described in 1835

Discovery and characterization of NVP-QAV680, a potent and selective CRTh2 receptor antagonist suitable for clinical testing in allergic diseases. Optimization of a 7-azaindole-3-acetic acid CRTh2 receptor antagonist chemotype derived from high throughput screening furnished a highly selective compound NVP-QAV680 with low nM functional potency for inhibition of CRTh2 driven human eosinophil and Th2 lymphocyte activation in vitro. The molecule exhibited good oral bioavailability in the rat, combined with efficacy in rodent CRTh2-dependent mechanistic and allergic disease models and was suitable for clinical development.

Opinion divided on Southport homes plan PLANS to build 168 homes on the site of a former Virginia Street sweet factory will be ruled on by councillors tonight. If proposals by Bellway Homes get the go-ahead, the empty Chewits (Leaf UK) factory will be torn down and replaced by a development including 106 apartments, 62 family homes and commercial space. A green light to the scheme could also lead to a range of changes to the surrounding environment, including measures to keep passing traffic to 20mph and the renovation of Victoria footbridge. Ward councillors have signalled their support for Bellway’s scheme, citing a much-needed boost for affordable housing. But opinions among existing nearby residents appear mixed. The announcement in early summer of initial plans for the four-acre plot saw a host of concerns voiced by residents, including fears of heavily increased traffic congestion. A report to go before Sefton’s planning committee lists ways in which Bellway has adjusted its original plans after a round of community consultation. To counter accusations the development will cause traffic chaos, there will now only be one main access point for cars, on the first bend on the approach from Scarisbrick New Road. There has also been an increase in the overall number of off-street parking spaces to 171. The report to councillors cites traffic surveys in support of the view the area’s roads network will be able to cope with the increased burden, but it states that Virginia Street (between Scarisbrick New Road and Ash Street), Hodson Street and Mill Street will all need to see traffic calming measures. Mark Richardson, who lives in Virginia Street with his wife Mary, said: “I am concerned about the aesthetics. “We are looking at very modern town houses in what is very much a Victorian street.” Mr Richardson, a 38-year-old area manager for a pub chain, said he was already concerned about speeding in Virginia Street. Yet he added: “I would love to see the site developed into housing.” Four nearby residents have written to the council opposing the plans. Carl Brown, a 27-year-old IT worker who lives in Hargreaves Street, said: “I would like to see it rejected but I do not think it will happen. “The main reason is still the amount of properties on-site.” Cllr Mike Booth, a Kew ward representative, stressed that concessions to the concerns of residents had followed Bellway’s initial consultation. “If there are any further concerns about the plans they will be picked up at the planning meeting,” he added. “The development will help to provide homes for families that are struggling to get onto the housing ladder.”

@startuml sprite $panorama_horizontal [48x48/16] { 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 0000BE940000000000000000000000000000000049EB0000 0000FFFFFA5200000000000000000000000025AFFFFF0000 0000FFFFFFFFEA74200000000000000247AEFFFFFFFF0000 0000FFFFFFFFFFFFFFECBAA99AABCEFFFFFFFFFFFFFF0000 0000FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0000 0000FFFF48CFFFFFFFFFFFFFFFFFFFFFFFFFFC84FFFF0000 0000FFFF0000369BEFFFFFFFFFFFFFFEC9640000FFFF0000 0000FFFF00000000001344555544310000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000000000000000000000000000FFFF0000 0000FFFF00000000001344555544310000000000FFFF0000 0000FFFF0000369BEFFFFFFFFFFFFFFEB9630000FFFF0000 0000FFFF48CFFFFFFFFFFFFFFFFFFFFFFFFFFC84FFFF0000 0000FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF0000 0000FFFFFFFFFFFFFFECBAA99AABCEFFFFFFFFFFFFFF0000 0000FFFFFFFFEA74200000000000000247AEFFFFFFFF0000 0000FFFFFA5200000000000000000000000025AFFFFF0000 0000AE940000000000000000000000000000000049EB0000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 } !define MATERIAL_PANORAMA_HORIZONTAL(_alias) ENTITY(rectangle,black,panorama_horizontal,_alias,MATERIAL PANORAMA_HORIZONTAL) !define MATERIAL_PANORAMA_HORIZONTAL(_alias, _label) ENTITY(rectangle,black,panorama_horizontal,_label, _alias,MATERIAL PANORAMA_HORIZONTAL) !define MATERIAL_PANORAMA_HORIZONTAL(_alias, _label, _shape) ENTITY(_shape,black,panorama_horizontal,_label, _alias,MATERIAL PANORAMA_HORIZONTAL) !define MATERIAL_PANORAMA_HORIZONTAL(_alias, _label, _shape, _color) ENTITY(_shape,_color,panorama_horizontal,_label, _alias,MATERIAL PANORAMA_HORIZONTAL) skinparam folderBackgroundColor<<MATERIAL PANORAMA_HORIZONTAL>> White @enduml

This is some pretty funny stuff. Prominent Clinton backer and Dem donor to endorse McCain Posted: 10:45 AM ET WASHINGTON (CNN) — Lynn Forester de Rothschild, a prominent Hillary Clinton supporter and member of the Democratic National Committee’s Platform Committee, will endorse John McCain for president on Wednesday, her spokesman tells CNN. But that’s not the good part. Check this: In an interview with CNN this summer, Forester did not hide her distaste for eventual Democratic presidential nominee Barack Obama. “This is a hard decision for me personally because frankly I don’t like him,” she said of Obama in an interview with CNN’s Joe Johns. “I feel like he is an elitist. I feel like he has not given me reason to trust him.” [emphasis added] The half-Kenyan kid whose father deserted him, leaving him to be raised by mom and grandparents in Kansas, he’s elitist. Check. And de Rothschild? She’s the wife of this guy – Sir Evelyn de Rothschild, knighted financier and descendant of the – excuse me, the – insanely wealthy Rothschild banking dynasty. Sweet fancy ballroom dancing Jesus – is this the Supreme High Queen of the Mystical Land of Douchebagistan or what? Let’s review her pedigree résumé, shall we? Here’s her Forbes profile. It’s like she’s a walking homage to the common man. Now this piece is something of a journalistic marvel. It attempts to paint a portrait of a hard-working, self-made woman. I have no doubt that she worked hard when young and she seems to be a woman with a good measure of business acumen. But note what the story omits. At various points along the way she makes some smart decisions, but … where did the money come from? She made “a small fortune” reselling jeans she’d bought for $10 a pair in Europe, but in order to make a “fortune” of any size, that means she needed a certain amount of cash in her pocket. Quite a bit of cash, in fact. Then she studied law at Columbia – on need-based scholarships, no doubt – then she “got a job” in telecom and persuaded Motorola to buy a stake, yadda yadda yadda. This is a woman that fortune seems to seek out, wouldn’t you say? Now, ask yourself, what kind of person does money come looking for? Here we at least get the words “dazzingly well connected,” and that may go a ways toward explaining some of the missing pieces in the bullet above. I’ll wait here while you wander though the stories linked here. Take your time and savor the richness of it all. No hurry.What were we talking about again? Oh, right – Barack Obama is an elitist. Got it. Up next: Fifty Cent disses Pat Boone for being black. Film at 11. But I digress. Surely, surely, this is the most ambitious episode of Punk’d yet. At any moment Ashton Kutcher is going to jump out from behind a plant and yell GOTCHA at America. Right? Or maybe Christopher Guest is doing another movie, this one about political campaigns? (Although I’m a little confused, because Lady Die has clearly poached the Jennifer Coolidge role.) Or even better – maybe this is something that Barack Obama and Hillary Clinton (one of Rothschild’s buds) cooked up. Seriously, once this story breaks, no Republican apologist will ever be able to use the word “elitist” in public again. It’s brilliant – BRILLIANT, I say. Because nobody – nobody – on the face of the Earth could be this lacking in self-awareness. You couldn’t even build a good stand-up routine around this because in order for something to be funny it has to be at least mildly grounded in plausibility. But – apparently it’s actually really truly happening and not a joke or a campaign ploy. This hyper-privileged barking loon is serious. You may have noticed the repeated references to “Lady” Rothschild. That’s apparently what she likes being called (and if you believe the rumors, insists on being called). Lady Rothschild. Not Lynn, but LADY. Motive? Well, she was a big Hillary supporter and raised six figures for the campaign. I’ll let you do your own speculation here. Then there’s this: “I think if history is our guide, we’ve had stronger economies, more wealth creation, under Democratic presidents than we have under Republican presidents.” Hey, you make it fit. I’ve given up. In a stupid world gone silly, we have now braved the final frontier. Braved it, paved it and built a Chuck E. Cheese on every corner. Because this is not only the dumbest fucking thing any human being has ever said – in a political campaign or otherwise – it is the dumbest fucking thing it would be possible to stay. How much blacker could this album be, ponders Nigel in Spinal Tap. “None. None more black.” How much stupider could a statement be? None. None more stupider. You have reached the end of the journey, America. Ashton Kutcher or no, you been punk’d.

The extracellular matrix (ECM) provides a scaffold for cell attachment and binding sites for membrane receptors, such as integrins, making it essential for the development of all metazoans ^[@R1],[@R2]^. When engaged with the ECM, integrins trigger signaling cascades that regulate cell morphology and division, yet in the absence of a functional ECM, integrins are removed from the plasma membrane by endocytosis ^[@R3]^. The proper interplay between integrins and the ECM is particularly important during early development ^[@R4]^, as stem cells depend on integrin-dependent signaling for division and survival ^[@R5]^. The establishment of the ECM requires secretion of several proteins, including its major constituent collagen. Following its synthesis in the ER, the export of collagen from cells depends on COPII-vesicles ^[@R6]-[@R9]^, and mutations in genes encoding COPII-proteins lead to collagen deposition defects, skeletal aberrations, and developmental diseases, such as cranio-lenticulo-sutural dysplasia ^[@R10],[@R11]^. COPII-vesicles are surrounded by a coat consisting of the Sar1 GTPase, Sec23-Sec24 adaptors, and an outer layer of Sec13-Sec31 heterotetramers ^[@R12]^. These coat proteins self-assemble into cuboctahedral structures with a diameter of \~60-80nm, which are too small to accommodate a procollagen fiber with a length of 300-400nm ^[@R13]-[@R15]^. Thus, collagen transport in cells must involve factors that are absent from *in vitro* self-assembly reactions. Indeed, TANGO1 and its partner cTAGE5 interact with collagen and Sec23/24, thereby recruiting collagen to nascent COPII coats ^[@R16],[@R17]^. The deletion of *TANGO1* in mice resulted in collagen deposition defects similar to those caused by loss of COPII ^[@R18]^, and mutations in human TANGO1 are associated with premature myocardial infarction ^[@R19]^. However, TANGO1 is not known to regulate the size of COPII-coats and mechanisms that permit the COPII coat to accommodate a large cargo remain poorly understood. By analyzing mouse embryonic stem cell (mESC) division, we have identified Cul3^Klhl12^ as a regulator of COPII coat formation. Cul3^Klhl12^ monoubiquitinates Sec31 and drives assembly of large COPII-coats. As a result, ubiquitination by Cul3^Klhl12^ is essential for collagen export, a step that is required for integrin-dependent mESC division. We conclude that monoubiquitination determines the size and function of a vesicle coat. Cul3 regulates mESC morphology {#S1} ============================== To provide insight into stem cell-specific division networks, we depleted ubiquitination enzymes from mESCs and scored for effects on proliferation and morphology. We found that loss of the ubiquitin ligase Cul3 caused mESCs to form tightly packed cell clusters with prominent actin cables and aberrant adhesions, as seen by confocal microscopy analysis of actin and vinculin localization ([Fig. 1a](#F1){ref-type="fig"}). A similar phenotype was observed upon depletion of UBA3, a component of the Nedd8-pathway that activates Cul3 ([Fig. S1a](#SD2){ref-type="supplementary-material"}). Cul3-depleted mESCs were delayed in proliferation ([Fig. S1b, d](#SD2){ref-type="supplementary-material"}), yet retained their pluripotency, as seen by Oct4- and alkaline phosphatase-staining and the absence of differentiation markers in expression analyses ([Fig. S1c, e, f; Fig. S2b](#SD2){ref-type="supplementary-material"}). In contrast to mESCs, depletion of Cul3 had weaker consequences in fibroblasts ([Fig. 1a](#F1){ref-type="fig"}), although a previously reported increase in multinucleation was observed ([Fig. S1g](#SD2){ref-type="supplementary-material"}; ^[@R20]^). Several observations show that the mESC-phenotypes were caused by specific depletion of Cul3. First, multiple siRNAs targeting distinct regions of the Cul3-mRNA had the same effects on mESCs, with a close correlation between knockdown efficiency and strength of phenotype ([Fig. S2a](#SD2){ref-type="supplementary-material"}). Second, microarray analysis showed a strong reduction in Cul3-mRNA upon siRNA-treatment, whereas no other gene was significantly and reproducibly affected ([Fig. S2b](#SD2){ref-type="supplementary-material"}). Third, siRNAs that target closely related proteins, such as other cullins, did not disturb the morphology of mESCs ([Fig. S2c](#SD2){ref-type="supplementary-material"}). The aberrant morphology of Cul3-depleted mESCs was reminiscent of increased RhoA GTPase-activity, which triggers actin filament bundling ^[@R21]^. Accordingly, a reduction in RhoA-levels or inhibition of the RhoA-effector kinase ROCK1 rescued Cul3-depleted mESCs from compaction ([Fig. S3a](#SD2){ref-type="supplementary-material"}). Among several possibilities, higher RhoA-activity in the absence of Cul3 could result from RhoA stabilization or defective integrin-signaling. Stabilization of RhoA by co-depletion of all RhoA-specific Cul3-adaptors, the Bacurds ^[@R22]^, did not affect mESC morphology (data not shown). By contrast, depletion of components of integrin-signaling pathways phenocopied the loss of Cul3 in mESCs ([Fig. S3b](#SD2){ref-type="supplementary-material"}); partial reduction in Cul3-levels showed synthetic lethality with dasatinib, an inhibitor of the Src kinase that acts downstream of integrin-activation ([Fig. S3c](#SD2){ref-type="supplementary-material"}); and β1-integrin was absent from the plasma membrane of Cul3-depleted mESCs ([Fig. 1b](#F1){ref-type="fig"}). Cul3 could regulate integrin-synthesis and trafficking, or it could allow for efficient deposition of ECM proteins to prevent integrin internalization ^[@R3]^. To distinguish between these possibilities, we grew mESCs on growth factor-depleted matrigel to provide an exogenous ECM. Strikingly, under these conditions, β1-integrin was found at the plasma membrane of Cul3-depleted mESCs and no cell clustering was observed ([Fig. 1b](#F1){ref-type="fig"}). Thus, Cul3 controls integrin-signaling in mESCs, most likely by supporting the establishment of a functional ECM. Klhl12 is a key Cul3-adaptor in mESCs {#S2} ===================================== Cul3 recruits substrates through adaptors with BTB-domains ^[@R23]-[@R26]^, yet siRNA-approaches did not yield roles for BTB-proteins in ESCs. As an alternative strategy to isolate Cul3-adaptors, we made use of the observation that stem cell regulators are highly expressed in ESCs, but downregulated upon differentiation ^[@R27]^. Using affinity purification and mass spectrometry, we identified 31 BTB-proteins that interact with Cul3 in mESCs ([Fig. S4a; Table S1](#SD2){ref-type="supplementary-material"}). When analyzed by qRT-PCR and immunoblot, we found that three adaptors, Klhl12, KBTBD8 and IBTK, were highly expressed in mESCs, but downregulated upon differentiation ([Fig. 2a, b](#F2){ref-type="fig"}; [Fig. S3d](#SD2){ref-type="supplementary-material"}). Next, we depleted these adaptors from mESCs that were sensitized for changes in integrin-signaling by treatment with dasatinib. Importantly, depletion of Klhl12, but no other BTB-protein, resulted in mESC compaction, as seen with loss of Cul3 ([Fig. 2c](#F2){ref-type="fig"}). Accordingly, endogenous Klhl12 effectively binds Cul3 in mESCs ([Fig. S4b](#SD2){ref-type="supplementary-material"}). These experiments, therefore, identify Klhl12 as a key substrate-adaptor for Cul3 in mESCs and the Cul3^Klhl12^ ubiquitin ligase as an important regulator of mESC morphology. Cul3 monoubiquitinates Sec31 {#S3} ============================ To isolate the substrates of Cul3^Klhl12^, we constructed 293T cell lines that allowed for the inducible expression of ^FLAG^Klhl12. By affinity chromatography and mass spectrometry, we identified the COPII-proteins Sec13 and Sec31 as specific binding partners of Klhl12 ([Fig. 3a](#F3){ref-type="fig"}; [Table S2](#SD2){ref-type="supplementary-material"}). Immunoblotting confirmed retention of endogenous Sec13 and Sec31 in Klhl12-purifications, but not in precipitates of other BTB-proteins ([Fig. S5a](#SD2){ref-type="supplementary-material"}). As seen in pulldown assays, Klhl12 directly bound Sec31, but not Sec13 ([Fig. S5c, d](#SD2){ref-type="supplementary-material"}), and this interaction was mediated the N-terminus of Sec31 ([Fig. S6a](#SD2){ref-type="supplementary-material"}) and the Kelch-domain of Klhl12 ([Fig. S6b](#SD2){ref-type="supplementary-material"}). In cells, \~30% of endogenous Klhl12 was associated with Sec13/31 ([Fig. 3b](#F3){ref-type="fig"}; [Fig. S5b](#SD2){ref-type="supplementary-material"}). Consistent with such a prominent interaction, Sec13/31 and Klhl12 co-localized in punctae, which likely represent ER-exit sites of COPII-vesicles ([Fig. 3c](#F3){ref-type="fig"}; ^[@R28]^). Importantly, siRNAs that compromise COPII resulted in mESC compaction ([Fig. 3d](#F3){ref-type="fig"}), suggesting that Cul3^Klhl12^ and the COPII-coat act in the same pathway. *In vitro*, Cul3^Klhl12^ catalyzed the monoubiquitination of Sec31 ([Fig. 3e](#F3){ref-type="fig"}), which was not observed if a Klhl12-mutant with a defective Sec31-binding interface was employed ([Fig. 3f](#F3){ref-type="fig"}). Sec31 was also monoubiquitinated in cells, which was strongly increased upon expression of Klhl12 ([Fig. 3g](#F3){ref-type="fig"}). Klhl12-mutants unable to bind Sec31 abolished its monoubiquitination ([Fig. 3h](#F3){ref-type="fig"}), which is likely due to dimerization with and inactivation of endogenous Klhl12 ([Fig. 3a](#F3){ref-type="fig"}, [Fig. S6c](#SD2){ref-type="supplementary-material"}). Sec31-monoubiquitination was also strongly diminished upon expression of dominant-negative Cul3 ([Fig. 3g](#F3){ref-type="fig"}) or depletion of Cul3^Klhl12^ by siRNA ([Fig. 3i](#F3){ref-type="fig"}). As seen upon expression of lysine-free ubiquitin, Sec31 was monoubiquitinated at one preferred and an alternative, less prominently used lysine ([Fig. 3g](#F3){ref-type="fig"}), consistent with proteomic analyses that identified Lys647 and Lys1217 in Sec31A as ubiquitination sites ^[@R29],[@R30]^. However, neither mutation of these residues nor any other of the 65 lysine residues of Sec31 blocked ubiquitination by Cul3^Klhl12^ (data not shown), revealing flexibility in the actual modification site. Co-expression of Klhl12 and Cul3 triggered Sec31-multiubiquitination and degradation ([Fig. 3g](#F3){ref-type="fig"}, [4e](#F4){ref-type="fig"}; [Fig. S6d](#SD2){ref-type="supplementary-material"}), which was not observed with lysine-free ubiquitin ([Fig. 3g](#F3){ref-type="fig"}). However, whereas Sec31 was monoubiquitinated by endogenous Cul3^Klhl12^, its multiubiquitination was only seen when Cul3 and Klhl12 were overexpressed. Depletion of Cul3^Klhl12^ or proteasome inhibition did not change Sec31-levels in untransfected cells ([Fig. 3i](#F3){ref-type="fig"}, [Fig. S6e](#SD2){ref-type="supplementary-material"}), and blockade of ubiquitin chain formation or proteasome inhibition did not impair Cul3^Klhl12^-function (see [Fig. 5](#F5){ref-type="fig"}). Thus, multiubiquitination of Sec31 is unlikely a key outcome of Cul3^Klhl12^-activity in mESCs. Instead, it appears that Cul3^Klhl12^ acts by catalyzing monoubiquitination, with the COPII-protein Sec31 as a major substrate. Cul3 regulates the size of COPII coats {#S4} ====================================== To identify a role for monoubiquitination by Cul3^Klhl12^, we induced Klhl12-expression in cells and followed the fate of Sec31 by microscopy. Shortly after Klhl12-induction, the majority of Klhl12 and Sec31 co-localized in small punctae ([Fig. 4a](#F4){ref-type="fig"}). Over time, these punctae grew into much larger structures that contained most of Sec31, as well as other COPII-components, such as Sec13 or Sec24C ([Fig. 4a, b](#F4){ref-type="fig"}). As seen by high-resolution confocal imaging, the large structures were hollow and spherical with a diameter of 200-500nm, and they were decorated with the proteins of the COPII-coat and with Klhl12 ([Fig. 4c](#F4){ref-type="fig"}). Accordingly, thin-section electron microscopy revealed large, crescent-shaped tubules, possibly of ER origin, in cells transfected with Klhl12 ([Fig. 4d](#F4){ref-type="fig"}). Immunogold-labeling EM showed comparable structures of 200-500nm that were decorated with Klhl12 ([Fig. 4d](#F4){ref-type="fig"}). The Klhl12-dependent structures neither contained a *cis*-Golgi protein; Ergic-53, which is absent from procollagen transport vesicles ^[@R31]^; ER-membrane markers that do not accumulate at ER-exit sites ^[@R32]^; nor endosomal or autophagosomal markers ([Fig. S7a-c](#SD2){ref-type="supplementary-material"}). Importantly, Sec31-binding deficient mutants, including Klhl12^FG289/290AA^, neither co-localized with Sec31 nor induced formation of large structures ([Fig. 4e](#F4){ref-type="fig"}; [Fig. S7d](#SD2){ref-type="supplementary-material"}), and depletion of Sec31 blocked formation of large structures by Klhl12 ([Fig. 4b](#F4){ref-type="fig"}). Thus, binding of Klhl12 to Sec31 triggers formation of large COPII-containing structures. When Klhl12 was expressed with a Cul3-mutant that blocks Sec31-ubiquitination (Cul3^1-250^), COPII-structures were not enlarged ([Fig. 4e](#F4){ref-type="fig"}). In addition, depletion of Cul3 by siRNAs, which also abolishes Sec31-monoubiquitination, prevented formation of large COPII-structures by Klhl12 ([Fig. 4a, c](#F4){ref-type="fig"}). By contrast, if Klhl12 was expressed with lysine-free ubiquitin to allow mono-, but not multiubiquitination, large COPII-structures were readily detected ([Fig. 4c, e](#F4){ref-type="fig"}), and these structures were enriched for ubiquitin, consistent with monoubiquitination being non-proteolytic ([Fig. S7e](#SD2){ref-type="supplementary-material"}). Thus, monoubiquitination by Cul^Klhl12^ promotes formation of large COPII-structures, which likely represent a mixture of nascent coats at ER-exit sites and budded coats on large COPII-vesicles or tubules. Cul3 is required for collagen export {#S5} ==================================== Our screen linked Cul3^Klhl12^ to the establishment of the stem cell ECM, which requires collagen secretion. Thus, the Cul3^Klhl12^-dependent increase in COPII-size might function to promote collagen export from the ER. To test this hypothesis, we expressed Klhl12 in IMR90 cells, which at steady state accumulate collagen in the ER due to inefficient export. Strikingly, Klhl12, but not Klhl12^FG289/290AA^ or unrelated BTB-proteins, triggered depletion of procollagen I from intracellular ER-pools ([Fig. 5a](#F5){ref-type="fig"}). As a result, increased collagen levels were detected in the supernatant of cells expressing Klhl12, but not Klhl12^FG289/290AA^ ([Fig. 5b](#F5){ref-type="fig"}). When secretion was inhibited with brefeldin A, or if collagen folding in the ER was impaired by removal of ascorbate from the medium, procollagen remained within Klhl12-expressing cells ([Fig. 5a](#F5){ref-type="fig"}). Time-resolved experiments showed that Klhl12 strongly accelerated collagen export from IMR90 cells ([Fig. 5c](#F5){ref-type="fig"}). Shortly after inducing secretion, Klhl12 and collagen were detected at overlapping locations ([Fig. S7f](#SD2){ref-type="supplementary-material"}), all of which indicates that Cul3^Klhl12^ facilitates collagen traffic from the ER. Blockade of Sec31-ubiquitination by dominant-negative Cul3 interfered with the Klhl12-dependent export of collagen from IMR90 cells ([Fig. S8a](#SD2){ref-type="supplementary-material"}). Similarly, depletion of Cul3^Klhl12^ from engineered HT1080 fibrosarcoma cells severely impaired collagen export, and most cells retained high levels of collagen in their ER ([Fig. 5d](#F5){ref-type="fig"}; [Fig. S8b](#SD2){ref-type="supplementary-material"}). In contrast, smaller COPII-cargoes, such as fibronectin or EGF receptor, were properly localized in the absence of Cul3 ([Fig. S8c, d](#SD2){ref-type="supplementary-material"}). Similar observations were made in mESCs, where depletion of Cul3 led to a strong intracellular accumulation of collagen IV, comparable to the effects observed upon loss of Sec13 ([Fig. 5e](#F5){ref-type="fig"}; [Fig. S8e](#SD2){ref-type="supplementary-material"}). Thus, Cul3^Klhl12^ is required for collagen-export, while it is less important for the trafficking of smaller COPII-cargo. If promoting collagen export were the key role of Cul3 in mESCs, the phenotypes of Cul3-depletion might be mitigated by addition of collagen *in trans*. Indeed, this was the case: when mESCs were plated on purified collagen-IV, depletion of Cul3 did not cause cell clustering, and β1-integrin was detected at the plasma membrane ([Fig. 1c](#F1){ref-type="fig"}). We conclude that promoting collagen secretion is a key a function of Cul3, in agreement with its role in driving the assembly of large COPII-coats. Discussion {#S6} ========== In this study, we have identified Cul3^Klhl12^ as an essential regulator of collagen export, which is required for mESC division. Deletion of Cul3 in mice results in early embryonic lethality with completely disorganized extraembryonic tissues ^[@R33]^, a phenotype that can in part be attributed to its role in collagen secretion. Moreover, Klhl12 has been identified as an autoantigen in the connective tissue disorder Sjogren's syndrome ^[@R34]^, raising the possibility that aberrant function of Cul3^Klhl12^ might be related to disease. Cul3^Klhl12^ monoubiquitinates Sec31 and promotes formation of large COPII-coats that can accommodate unusually shaped cargo. As a result, Cul3 is essential for the secretion of procollagen fibers, while it is not required for the transport of smaller or more flexible molecules, such as fibronectin, EGF receptor or β1-integrin. Thus, Cul3^Klhl12^ appears to be specifically required for the COPII-dependent transport of large cargo. How ubiquitination affects COPII-size or structure coats is not known. None of the 65 lysine residues of Sec31 was essential for ubiquitination by Cul3^Klhl12^, showing that Cul3 can target alternative lysine residues if the primary site is blocked. Despite this flexibility, Cul3^Klhl12^ does not stoichiometrically ubiquitinate Sec31. Thus, if Sec31-ubiquitination performs a structural role, then few ubiquitinated molecules must suffice to produce large COPII-coats, and these vesicles must tolerate considerable variation in the modification site. Alternatively, as often seen with monoubiquitinated proteins, modified Sec31 might recruit an effector that delays COPII-budding or promotes coat polymerization. As Cul3^Klhl12^ ubiquitinates other proteins ^[@R35]^, Sec31 may not be its only substrate in the secretory pathway. Identification of the complete set of Cul3^Klhl12^-substrates and potential effector molecules should reveal the mechanism underlying the ubiquitin-dependent regulation of vesicle size. Our findings have the potential to be translated into therapeutic strategies. We envision that agonists of Cul3^Klhl12^-function mitigate consequences of Sec23A-mutations in cranio-lenticulo-sutural dysplasia or Sar1-mutations in chylomicron retention disease ^[@R10],[@R11]^. By contrast, interfering with Cul3-activity may counteract increased collagen deposition during fibrosis or keloid formation ^[@R36]^. Given the strong clustering phenotypes observed in Cul3-depleted mESCs, inhibition of Cul3^Klhl12^ might impair the proliferation of metastatic cells, which display features of undifferentiated cells ^[@R37],[@R38]^. Thus, our identification of Cul3^Klhl12^ as a regulator of COPII size and function provides an exciting starting point to understand and therapeutically exploit key events in protein trafficking. Methods summary {#S7} =============== For stem cell culture, mouse D3 ESCs were maintained in GIBCO Dulbecco's Modified Eagle ESC medium containing 15% FBS, 1x sodium pyruvate, 1x NEAA, 1mM β-ME and 1000u/ml LIF (Millipore), and grown on gelatin-coated culture plates. Doxycycline-inducible 293T Trex ^FLAG^BTB stable cell lines were made with Flp-In™ T-REx™ 293 Cell Line system (Invitrogen) and maintained with blasticidin and hydromycin B. For screening, two siRNA oligos were designed against 40 mouse ubiquitin ligases (Qiagen). 10pmol of siRNA oligo and Lipofectamine 2000 were pre-incubated in a gelatin-coated 96-well plate. D3 mESCs were seeded at 15000 cells/well on top of the siRNA mixture, and the morphology of ESC colonies was examined by bright-field microscopy 48h post transfection. To identify Cul3^Klhl12^ substrates, doxycycline-inducible 239T cell lines expressing ^FLAG^Klhl12 or ^FLAG^Klhl9 were induced for 48h. Cleared lysate was subjected to anti-FLAG M2 affinity gel (Sigma), and precipitations were eluted with 3xFLAG peptide (Sigma). Concentrated eluates were analyzed by SDS-PAGE, and specific bands were identified by mass spectrometry analysis by the Vincent J. Coates Proteomics/Mass Spectrometry Laboratory. For *in vitro* ubiquitination reactions, Cul3/Rbx1 purified from Sf9 cells was conjugated to NEDD8 using recombinant APPBP1-UBA3, Ubc12, and NEDD8. Klhl12 purified from *E. coli* and Sec31A/Sec13 complexes from Sf9 cells were added together with energy mix, E1, UbcH5c, and ubiquitin and incubated at 30°C for 1hr. For confocal microscopy, cells fixed in paraformaldehyde and permeabilized with TritonX-100 were incubated with primary antibodies for 2h and Alexa-labeled secondary antibodies (Invitrogen) for 1h. Pictures were taken on Zeiss LSM 510 and 710 confocal microscopes and analyzed with LSM image browser and Imaris 3D imaging processing software. Images were processed for contrast enhancement to remove noise. Supplementary Methods {#S8} ===================== Plasmids, protein, antibodies {#S9} ----------------------------- Human Cul3 and Klhl12 were cloned into pcDNA4 and pcDNA5 vectors for expression in mammalian cells. Cul3, Sec31A and Sec13 were also cloned into pCS2 vector for IVT/T and expression in mammalian cells. pcDNA4-Cul3^N250^ contains the first cullin repeat of the N-terminal Cul3 (1-250aa) which is sufficient for binding BTB proteins, but not Rbx1 and serves as a dominant negative for Cul3/BTB-mediated ubiquitination. The Klhl12 mutants FG289AA, RL342AA, RGL369AAA, RE416AA, YDG434AAA and RCY510AAA were made by site-directed mutagenesis. Cul3 and Rbx1 were cloned into pFastBac, co-expressed in Sf9 ES insect cells using the Bac-to-Bac baculovirus expression system (Invitrogen) and purified as a complex by Ni-NTA agarose (Qiagen). Similarly, the Sec31A/Sec13 heterodimer and UBA1 were purified from Sf9 ES insect cells. UbcH5c and Ubc12 were cloned into pQE vector and purified from BL21(DE3) bacterial cells. Ubiquitin was cloned into pET and pCS2 vector with a N-terminal 6xHis tag. The pET-His-ubiquitin was used for bacterial purification whereas pCS2-His-ubiquitin was expressed in mammalian cells. Wildtype ubiquitin, APPBP1-UBA3 and NEDD8 were purchased from Boston Biochem. To purify recombinant Klhl12 for ubiquitination assays, we expressed pMAL-TEV-Klhl12-his and pMAL-TEV-Klhl12^FG289AA^-his in BL21(DE3) cells, purified the proteins on amylose resin, cleaved them by TEV protease, and re-purified them on Ni-NTA agarose. WT-Klhl12 and mutants were also cloned into pMAL vector and purified as MBP-tagged proteins for in-vitro protein binding assays. All shRNAs were cloned in pSuper-GFP neo vector (from Oligoengine) into BglII and XhoI sites. The GFP-Bcl2-Cb5 construct, a fusion between Bcl2 and cytochrome b5, was purchased from Clontech. We raised mouse monoclonal antibodies against human Klhl12 and human Klhl13. Both antibodies are available at Promab Biotechnologies (cat. \# 30058 and \# 30067). We also raised antibodies against Sec13, Sec24C, and Sec24D. Other antibodies used in this study are: Cul3 (Bethyl Laboratories, cat. \# A301-109A), Sec31A (BD Biosciences, cat. \# 612350), Collagen IV (Abcam, cat. \# ab19808), anti-FLAG (Sigma, cat. \#F3165, \#F7425), Ubiquitin (Santa Cruz, cat. \# sc-8017, P4D1), Rhodomine phalloidin (Invitrogen, cat. \# R415), PDI (1D3) (Assay Designs, cat. \#SPA-891), anti LC-3 (Sigma, Cat \# L-7543), anti-alpha tubulin (DM1A, Abcam, Cat \# ab7291), anti-fibronectin (Abcam, ab2413), anti-GM130 (BD Biosciences, cat. \# 610822), and anti-EGFR (Ab12, Neomarkers, MS-400P1). LF-67 (Anti sera for Type I procollagen) was obtained as a generous gift from Dr. Larry Fisher. Cell culture {#S10} ------------ The D3 mouse embryonic stem cells (mESC) were maintained in ESC medium containing 15% FBS, 1x sodium pyruvate, 1x NEAA, 1mM β-ME and 1000u/ml LIF (Millipore, cat. \# ESG1107) in GIBCO Dulbecco's Modified Eagle Medium, and grown on 0.1% gelatin-coated tissue culture plates. Hela cells, 293T cells, 3T3 cells and IMR90 cells were maintained in DMEM plus 10% FBS. Dialyzed FBS was bought from Hyclone. The doxycycline-inducible 293T Trex Klhl12-3xFLAG stable cell line was made with Flp-In™ T-REx™ 293 Cell Line system from Invitrogen. Stable cell lines expressing other BTB-proteins were generated accordingly. These cell lines were maintained with 10% TET(-) FBS, blasticidin and hydromycin B as instructed and expression was induced by 1ug/ml doxycycline. Human lung fibroblasts IMR-90 cells were obtained from the Corielle Institute: NIA (National Institute on Aging) Aging Cell Repository. For generating procollagen stable HT-1080cell lines, we cloned proalpha(1) into a pRMc/CMV-vector and selected for neomycin resistance ^[@R39]^. This vector was provided as a generous gift by Neil Bulleid. Cells were kept in a 37°C incubator at 5%CO~2~. siRNA screen in mouse ES cells {#S11} ------------------------------ siRNA oligos against 40 mouse ubiquitin E3 enzymes were pre-designed by Qiagen and handled as instructed. Two different siRNA oligos against each gene were included in the initial screen. 10pmol of siRNA oligos and 0.25ul of Lipofectamine2000 were pre-incubated in a 0.1% gelatin-coated 96-well plate in 20ul of OPTIMEM for 15min at room temperature. The D3 mESCs were trypsinized and seeded at 15000 cells/well in 80ul of ESC medium on top of the siRNA mixture. Fresh medium was added to the cells the next day and the morphology of ES cell colonies were examined using bright-field microscopy at 48h post transfection. Hit validation was performed with additional siRNAs that were purchased from two distinct vendors (Qiagen, Dharmacon) and that target different sites of the Cul3 mRNA. Knockdown efficiency was tested by qRT-PCR and immunoblot. Rescue of Cul3-siRNA phenotype in mESCs by matrigel and collagen-IV {#S12} ------------------------------------------------------------------- D3 mESCs were cultured on tissue culture dishes coated with gelatin (negative control), growth-factor depleted matrigel (BD Biosciences, cat\# 356231), or purified collagen-IV (BD Biosciences, cat\# 354233). Matrigel and collagen-IV were applied at 10μg/cm^2^. Cul3 was depleted 24h later using our standard siRNA transfection protocol, and mESC morphology was analyzed by confocal microscopy against β1-integrin, actin, and DNA. Drug treatments of Cul3-depleted cells {#S13} -------------------------------------- To study the synthetic lethal effect of Src-inhibition with Cul3 knockdown, we treated wildtype and Cul3-depleted D3 mESCs with 0, 25, 50, 100nM of dasatinib for 18h before the phenotypes were analyzed by light microscopy. To study the effect of Rho-inhibition on Cul3 knockdown, Cul3-depleted D3 mESCs were treated with ROCK inhibitor Y27632 at 10uM for 24h before phenotype analysis. Alternatively, RhoA was co-depleted using specific siRNAs. Cell cycle analysis {#S14} ------------------- To assess the division rate of Cul3-depleted mESCs, we treated cells with control, Cul3-, or Ube2C/Ube2S-siRNA and seeded at 3×10^5^ cells/well in gelatin-coated 6-well plates. The specificity of Ube2S- and Ube2C-siRNAs was tested before ^[@R40]^. The cells were trypsinized at 2, 3 and 4d post transfection and counted by hemocytometer. ES cell differentiation analysis {#S15} -------------------------------- To differentiate mouse ES cells into embryoid bodies (EBs), we trypsinized undifferentiated D3 mouse ES cells, washed once with LIF-free ESC media, and seeded the cells at 2×10^6^ cells/dish onto 10-cm Corning Ultra-Low-Attachment Dishes (Corning cat. \# 3262) containing 10 ml of ESC medium without LIF. After 24h, the cells were dissociated from the plate by gentle pipetting of the medium and collected in a 15ml Falcon tube by centrifugation. The supernatant was aspirated off and the cells were re-seeded onto 10-cm Corning Ultra-Low-Attachment Dishes containing fresh ESC medium without LIF. Medium was changed every other day for a total of 6 or 9d. Total RNA of ESCs and EB samples was extracted using TRIzol (Invitrogen, cat. \# 15596-026) and chloroform. The expression of pluripotent markers and BTB genes at various time points during differentiation was analyzed using quantitative real-time PCR. As a complementary experiment, D3 mESCs were treated with control or Oct4 siRNA. 48h after transfection, cells were collected and total RNA was extracted using TRIzol as above. The expression of pluripotent markers, tissue specific genes and BTB genes in control and Oct4-depleted cells were analyzed using qRT-PCR. Quantitative real-time PCR analysis {#S16} ----------------------------------- We used TRIzol (Invitrogen, cat. \# 15596-026) and chloroform to extract total RNA from cells. The first-strand cDNAs were synthesized by using Revertaid first strand cDNA synthesis kit (Fermentas, cat. \# K1621). Gene-specific primers for qRT-PCR were designed by using NCBI Primer-Blast. The quantitative RT-PCR reaction was done with the Maxima SYBR Green/Rox qPCR system (Fermentas, cat. \# K0221). Identification of Cul3^Klhl12^-substrates {#S17} ----------------------------------------- To identify Cul3^Klhl12^ substrates, we generated a doxycycline-inducible hKlhl12-3xFLAG stable cell line using the Flp-In™ T-REx™ 293 Cell Line system (Invitrogen). As controls, we generated stable cell lines expressing other BTB proteins including Klhl9. Klhl12-3xFLAG and Klhl9-3xFLAG expression was induced in 30×15cm-plates by 1ug/ml of doxycycline for 48h, and cells were collected by centrifugation and lysed by douncing 40 times in PBS+0.1%NP40. The cell lysate was cleared by centrifugation and then subjected to anti-FLAG M2 affinity gel (Sigma, cat. \# A2220-5mL) at 4C for 4h on a rotator. Immunoprecipitations were eluted by 300ul of 200ug/ml 3xFLAG peptide (Sigma, cat. \# F4799-4MG) in PBS. The elution was repeated three times for 1h at room temperature. Eluates were pooled, concentrated to 100ul using Amicon Ultra-0.5, Ultracel-10 Membrane (Millipore, cat. \# UFC501008) and run on a SDS-PAGE gel. The gel was stained by SimplyBlue™ SafeStain (Invitrogen, cat. \# LC6060), and specific gel bands were cut out and sent for mass spectrometry analysis by the Vincent J. Coates Proteomics/Mass Spectrometry Laboratory at UC Berkeley. Immunoprecipitation of endogenous protein complexes {#S18} --------------------------------------------------- To confirm the interaction of endogenous proteins, we lysed Hela cells or D3 mESCs by freeze-thaw twice in 20mM HEPES buffer pH7.5, 5mM KCl, 1.5mM MgCl2, 1x protease inhibitor cocktail (Roche). Specific antibodies against Cul3, Sec13 or Sec31 conjugated to protein G agarose beads were added to the cleared cell lysate and incubated at 4C for 4h. Protein complexes were eluted with gel-loading buffer at 95°C. Endogenous proteins in complexes were detected by immunoblot using specific antibodies against Cul3, Sec13, Sec31, or Klhl12. To detect ubiquitination of endogenous COPII components, we incubated Hela cell extract with pre-immune serum or antibody against Sec13 conjugated to protein G agarose beads at 4C for 4h. Protein complexes were eluted with SDS gel-loading buffer at 95°C. Ubiquitinated proteins in the complex were detected by immunoblot against ubiquitin. In-vitro protein interaction assays {#S19} ----------------------------------- To dissect the Klhl12 and Sec31A interaction, we coupled 20ug recombinant ^MBP^Klhl12, various mutants or MBP as a control to 15ul amylose resin by incubating at 4C for 1h. Cul3, Sec31A and mutants were expressed from pCS2 and labeled with ^35^S-Met using TnT Sp6 Quick Coupled Trsnc/trans Syst (Promega, cat. \# L2080). The labeled Cul3 or Sec31A were incubated with MBP-Klhl12 or mutants at 4C for 3h. Beads were washed 4x with TBST and 2x with TBS, and incubated in SDS loading buffer at 95°C. Samples were run on SDS-PAGE and results were visualized by autoradiography. In vitro ubiquitination assays with Cul3^Klhl12^ {#S20} ------------------------------------------------ Cul3/Rbx1 was conjugated to NEDD8 at 30C for 1h with the following conditions: 2.5 mM Tris/HCl pH 7.5, 5 mM NaCl, 1 mM MgCl2, 1 mM DTT, 1x energy mix ^[@R40]^, 1uM APPBP1-UBA3, 1.2 uM Ubc12, 4 uM Cul3/Rbx1, and 60 uM NEDD8. For in-vitro ubiquitination of Sec31A, we set up a 10ul reaction as follows: 2.5 mM Tris/HCl pH 7.5, 5 mM NaCl, 1 mM MgCl2, 1 mM DTT, 1x energy mix, 100nM UBA1, 1uM UbcH5c, 1uM Cul3\~Nedd8/Rbx1, 1uM Klhl12, 150uM ubiquitin, 0.05ug Sec13/31A. The reaction was carried out at 30C for 1hr and stopped by adding SDS gel loading buffer. In vivo ubiquitination assays with Cul3^Klhl12^ {#S21} ----------------------------------------------- 293T cells grown in 10cm dishes were transfected with pCS2-HA-Sec13/31A, pCS2-His-ubiquitin, pcDNA5-Klhl12-FLAG, pcDNA4-Cul3-FLAG, or pcDNA4-Cul3^N250^-FLAG, as indicated, using calcium phosphate. 24h later, 1μM MG132 was added and cells were incubated overnight. Cells were harvested with gentle scraping and resuspended in 1ml buffer A (6M guanidine chloride, 0.1 M Na~2~HPO~4~/NaH~2~PO~4~ and 10mM immidazole,pH 8.0). Cells were lysed by sonication for 10s and incubated with 25ul Ni-NTA agarose at room temperature for 3h. The beads were washed 2x with buffer A, 2x with buffer A/TI (1 volume buffer A and 3 volumes buffer TI), 1x with buffer TI (25mM Tris-Cl, 20mM imidazole, pH6.8), and incubated in 60ul SDS gel loading buffer containing 300mM imidazole and 50mM βME at 95°C. Samples were separated by SDS-PAGE and ubiquitinated Sec31A was detected by immunoblot using antibody against Sec31A. To detect Sec31A ubiquitination upon Cul3/Klhl12 depletion, we co-transfected 100nM siRNAs against Cul3 or Klhl12 with pCS2-HA-Sec13/31A and pCS2-His-ubiquitin using calcium phosphate. The Ni-NTA purification was performed 48h post transfection and Sec31A ubiquitination was detected as described above. Confocal microscopy {#S22} ------------------- Cells were fixed in 4% paraformaldehyde and permeabilized with 0.5% TritonX-100 in 1X TBS, 2% BSA. Cells were incubated with primary antibodies against Sec31A, Sec13, Sec24C, ERGIC53, CD63, BiP, or ubiquitin for 2h and secondary antibodies (Invitrogen, Alexa Fluor® 546 goat anti-rabbit IgG (H+L); Alexa Fluor 488 goat anti-mouse IgG (H+L); HOECHST 33342,) for 1h at room temperature followed by extensive washing. Pictures were taken on Zeiss LSM 510 and 710 Confocal Microscope systems and analyzed with LSM image browser and Imaris 3D imaging processing software. Transmission Electron Microscopy {#S23} -------------------------------- Mock- and Klhl12-transfected HeLa cells were grown to 70% confluence as a monolayer on an Aclar ® sheet (Electron Microscopy Sciences, Hartfield, PA). The cells were fixed for 30min in 0.1M cacodylate buffer, pH 7.2, containing 2% glutaraldehyde, and subsequently washed with buffer prior to post-fixation with 1% Osmium tetroxide on ice. This was followed by staining with 1 % aqueous Uranyl Acetate for 30 min at room temperature. For dehydration with progressive lowering of temperature, each incubation period was 10 min, with exposure to 35% ethanol at 4°C, to 50% ethanol and 70% ethanol at −20°C, and 95%, and 100% ethanol at −35°C. Cells were restored to room temperature in 100% ethanol before flat embedding in an Epon resin. Thin (70-100nm) sections were collected on Formvar-coated 200-mesh copper grids and post-stained with 2% aqueous uranyl acetate and 2% tannic acid. The sections were imaged at 120 kV using a Tecnai 12 Transmission Electron Microscope (FEI, Eindhoven, Netherlands). For the purpose of immunolabeling, HeLa cells expressing ^FLAG^Klhl12 or doxycycline-inducible 293T Trex ^FLAG^Klhl12 stable cell lines were fixed in 2% paraformaldehyde and 0.5% glutaraldehyde and embedded in LR white resin. Fixation and infiltration were performed in a microwave oven (Pelco model 3450, Ted Pella, Inc., Redding, CA). 70 nm thick sections were picked on 100-mesh nickel grids coated with Formvar film and carbon, incubated in blocking buffer (5% BSA, 0.1% fish gelatin, 0.05% Tween20 in PBS) for 30 min, and followed by incubation with αFLAG antibody at a dilution of 1/40 for 1h. Goat anti-mouse IgG conjugated with 10 nm gold (BD Biosciences) was used as the secondary antibody at a diltuion of 1/40 for 1 h. Sections were poststained in 2% uranyl acetate for 5 min. Gene expression analysis by microarray {#S24} -------------------------------------- To compare gene expression profiles of WT-mESCs versus Cul3-depleted mESCs, we transfected D3 mESCs with control or Cul3-siRNA, followed by growth on gelatin-coated 6-well plates. 48h later, total RNA was extracted by TRIzol and chloroform, and further purified using RNeasy Mini Kit (Qiagen, cat. \# 74104). Microarray analysis was performed by the Functional Genomics Laboratory (UC Berkeley) using Affymetrix Mouse 430A 2.0 chip. Analysis of collagen export from cells {#S25} -------------------------------------- IMR-90 human lung fibroblasts grown on 100mm dishes in DMEM/10% FBS were transfected with ^FLAG^Klhl12, ^FLAG^Klhl12^FG289AA^, ^FLAG^Keap1 and pcDNA5-flag using nucleofection kit R (bought from Lonza) as described in the manufacturer's protocol and plated on 6 well plate with 25mm coverslips. When indicated, co-transfections with 2μg each of ^FLAG^Klhl12 and dominant-negative Cul3 were performed. Dialyzed 10% FBS media was used for ascorbate free transfections. Brefeldin A (Sigma) was used at a concentration of 2.5mg/ml and cells were incubated for 30min. MG132 was used at 20μM for 2h, choloroquine was used at 200μM for 1h. Media was collected the next day and cells on coverslips were fixed with 3% paraformaldehyde for 30min and remaining cells on a plate were used to prepare lysates. Cells on coverslips were permebealized with 0.1% Triton for 15min at room temperature followed by blocking with 1%BSA for 30min. Primary antibodies used were polyclonal anti Procollagen (LF-67,diluted 1:1000) and anti-flag (diluted 1:200). Secondary antibodies were Alexa fluor 546 donkey anti-rabbit IgG and Alexa Fluor 488 goat ant-rabbit IgG (diluted 1:200). After staining cells with appropriate primary and secondary antibodies, we fixed coverslips on slides using mounting reagent containing DAPI. Images were analyzed with a Zeiss LSM710 confocal microscope and captured with Zen10 software. Merges of images were performed with ImageJ and LSM image Browser. Media collected from 6-well plates was normalized with respect to lysate protein concentration estimated using BCA method. Media and lysates of each reaction were checked by immunoblot analysis. Tubulin was used as loading control for lysates. Ascorbate chase experiments were done by adding ascorbate (0.25mM ascorbic acid and 1mM asc-2-phosphate) to Klhl12-transfected cells, followed by incubation for 5, 10, 30 and 60min. A human fibrosarcoma cell line (HT1080) stably transfected with proalpha1(1) was used for Cul3 knockdowns. Cul3- and Klh12-shRNAs targeting two different regions in both genes were cloned into pSuperGFP and transfected using Lipofectamine 2000. pSuper GFP was used as negative control. Cells were grown on 25 mm coverslips in 6-well plates and fixed 2d post transfection. Collagen staining was done using LF-67 (1:1000) and ER was stained with anti-PDI (1:1000) antibody. Fibronectin and EGFR were stained in parallel experiments. Fibronectin expression was induced in HT1080 using 1uM dexamethasone before Cul3 knockdowns. ER retention or secretion was scored in cells expressing GFP shRNAs. Cells without GFP shRNAs and transfected with pSUPER GFP were quantified as well. Images were taken on a Zeiss LSM 710 confocal microscope and visualized with LSM image browser. Lysates were prepared from remaining cells on 6 well and checked for knockdown efficiency. siRNA oligos used in this study {#S26} ------------------------------- RNAi oligos Targeted sequence (5' -- 3') mCul3 \#1 GAAGGAATGTTTAGGGATA mCul3 \#2 GGAAGAAGATGCAGCACAA mCul3 \#3 GGTGATGATTAGAGACATA mCul3 \#4 CAACTTTCTTCAAACACTA mCul3 \#5 CATTATTTATTGATGATAA mUBA3 CGTTTGAAGCAGAGAGAAA mKlhl12 CCTTGAGAGTGGAGCAGAA hKlhl12 CCAAAGACATAATGACAAA mKBTBD8 GAACATGAGCAGAGTGAAA mOct4 AGGCAAGGGAGGTAGACAA hSec31 CCTGAAGTATTCTGATAAA mSec13 (pool of 4 oligos) CCATGTGTTTAGTAATTTA GGCAATATGTGGTCACCTA GCTGAAAGTATTCATGTAA GGAACAAATGACTATTATT mCdc42 (pool of 4 oligos) GATCTAATTTGAAATATTA GGATTGAGTTCCTAATTAA AGAGGATTATGACAGACTA AAATCAAACTAAAGATTAA mBcar1/CAS (pool of 4 oligos) GACTAATAGTCTACATTTA GGAGGTGTCTCGTCCAATA CTATGACAATGTTGCTGAA GGGCGTCCATGCTCCGGTA mSrc (pool of 4 oligos) CCCTTGTGTCCATATTTAA CCACGAGGGTTGCCATCAA CAGACTTGTTGTACATATT GCAACAAGAGCAAGCCCAA mRhoG (pool of 4 oligos) GGTTTACCTAAGAGGCCAA GCTGTGCCTTAAGGACTAA GCACAATGCAGAGCATCAA GGCGCACCGTGAACCTAAA mRhoA (pool of 4 oligos) GGATTTCCTAATACTGATA GAAAGTGTATTTGGAAATA AGCCCTATATATCATTCTA CGTCTGCCATGATTGGTTA mRac1 (pool of 4 oligos) GGTTAATTTCTGTCAAACA GCGTTGAGTCCATATTTAA GCTTGATCTTAGGGATGAT GGAGTAATTCAACTGAATA mCdh1/E-cadherin (pool of 4 oligos) GGAGGAGAACGGTGGTCAA CGCGGATAACCAGAACAAA CCATGTTTGCTGTATTCTA GGGACAATGTGTATTACTA mIqgap1 (pool of 4 oligos) ACATGATGATGATAAACAA GGTTGATTTCACAGAAGAA GTATAAATTTATTTCTTAA GGTGGATCAGATTCAAGAA mCul1 (pool of 2 oligos) GCATGATCTCCAAGTTAAA CGTGTAATCTGCTATGAAA mCul2 (pool of 2 oligos) GCGCTGATTTGAACAATAA CCAGAGTATTTATATCTAA mCul4a (pool of 2 oligos) GTGTGATTACCATAATAAA CCAGGAAGCTGGTCATCAA mCul5 (pool of 2 oligos) CCCTCATATTTACAGCAAA ACATGAAGTTTATAATGAA mCul7 (pool of 2 oligos) GCATCAAGTCCGTTAATAA GGATGTGATTGATATTGAA Supplementary Material {#S27} ====================== We thank Brenda Schulman for advice and gifts of cDNAs and proteins. We are grateful to Julia Schaletzky for critically reading the manuscript and many discussions. We thank the members of the Rape and Schekman labs for advice and suggestions, Lillian Lim for providing Cul3-shRNAs, Christina Glazier for contributions on BTB-protein cloning, and Ann Fischer and Michelle Richner for tissue culture support. This work was funded by grants from the Pew Foundation (MR), the NIH (NIGMS-RO1, MR; NIH Director's New Innovator Award, MR), and the Howard Hughes Medical Institute (RS). LJ was funded by a CIRM predoctoral fellowship; she is Tang fellow. KBP is HFSP long term post-doctoral fellow. **Author Contributions** Experiments were designed by LJ, KRB, RS, and MR. LJ performed the mESC screen, identified Klhl12 and Sec31, and analyzed the role of Cul3 in COPII formation in cells and in collagen export in mESCs; KRB analyzed collagen export in fibroblasts; KEW analyzed COPII formation in cells; CB identified inactive Klhl12; AG performed EM; LJ, KRB, and MR prepared the manuscript. The authors declare no competing financial interests. {#F1} {#F2} {#F3} {#F4} {#F5} [^1]: these authors contributed equally

#include <vector> #include "hdf5.h" #include "hdf5_hl.h" #include "caffe/layers/hdf5_output_layer.hpp" namespace caffe { template <typename Dtype> void HDF5OutputLayer<Dtype>::Forward_gpu(const vector<Blob<Dtype>*>& bottom, const vector<Blob<Dtype>*>& top) { CHECK_GE(bottom.size(), 2); CHECK_EQ(bottom[0]->num(), bottom[1]->num()); data_blob_.Reshape(bottom[0]->num(), bottom[0]->channels(), bottom[0]->height(), bottom[0]->width()); label_blob_.Reshape(bottom[1]->num(), bottom[1]->channels(), bottom[1]->height(), bottom[1]->width()); const int data_datum_dim = bottom[0]->count() / bottom[0]->num(); const int label_datum_dim = bottom[1]->count() / bottom[1]->num(); for (int i = 0; i < bottom[0]->num(); ++i) { caffe_copy(data_datum_dim, &bottom[0]->gpu_data()[i * data_datum_dim], &data_blob_.mutable_cpu_data()[i * data_datum_dim]); caffe_copy(label_datum_dim, &bottom[1]->gpu_data()[i * label_datum_dim], &label_blob_.mutable_cpu_data()[i * label_datum_dim]); } SaveBlobs(); } template <typename Dtype> void HDF5OutputLayer<Dtype>::Backward_gpu(const vector<Blob<Dtype>*>& top, const vector<bool>& propagate_down, const vector<Blob<Dtype>*>& bottom) { return; } INSTANTIATE_LAYER_GPU_FUNCS(HDF5OutputLayer); } // namespace caffe

Jabez Carter Hornblower Jabez Carter Hornblower (21 May 1744 – 14 July 1814) was an English pioneer of steam power, and the son of Jonathan Hornblower. Jabez Carter Hornblower was born in Broseley, Shropshire, England on 21 May 1744 and was the eldest child of steam engineer Jonathan and Ann Carter Hornblower. He gained his engineering skills working for his father building Newcomen steam engines in Cornwall. He later worked for Boulton and Watt building the new Watt steam engines designed and patented by James Watt. By 1790, he had set up a business in London with financial backing from well-to-do currier John Maberly, where he designed a new steam engine based on the patented designs of Isaac Mainwaring. However, in 1796, Hornblower and Maberly were sued by Boulton and Watt, who claimed one of Watt's patents – concerning the condenser, had been infringed. After a long trial, judgement in 1799 was in favour of Boulton and Watt and brought about the collapse of Hornblower and Maberly's business. In 1803, Hornblower was imprisoned in the King's Bench debtors prison but on his release in 1805 he managed to secure some work in mainland Europe building engines until his return to England in 1813. He died on 11 July 1814 and was buried in the Bunhill Fields burial ground in London. He had married twice, once in Cornwall to Mary John, with whom he had four children and, on her death, to Ann Hanbury of Bridgnorth, Shropshire with whom he had another four children. External links Jabez Carter Hornblower Category:1744 births Category:1814 deaths Category:English engineers Category:Steam engine engineers Category:Burials at Bunhill Fields Category:People from Broseley

[Postoperative syndromes after portacaval shunt in patients with cirrhosis of the liver (author's transl)]. Postoperative care of patients with a portacaval shunt is identical with the perioperative care performed to avoid the dangerous complications of cirrhosis of the liver. Clinical symptoms (edema, ascites, skin changes) and clinical chemistry (prothrombin time, bilirubin, albumin) will allow, to survey liver function appropriately. Neurological examination and simple psychosomatic tests (test of writing, trail making test) will allow to recognize early the occurrence of hepatoportal encephalopathy. EEG examinations done every 4 to 6 months are helpful in diagnosis. X-ray or endoscopic examinations should be done, if gastric ulcers are suspected. A definite warning must be pronounced against using high ceiling diuretics of unnecessarily; diuretics should be given only for short periods of time and in low dosage. Regular measurements of serum electrolytes are mandatory. The patient must be informed about the rationale of the diet restricted in proteins and abstinence from alcohol.

Q: How can I render a SCNScene to a texture I need to render a secondary SCNScene into a texture (NSImage) in the background to have that scene available as texture in the "main" SCNScene. I tried to use a new SCNView (which is not added to a superview) in conjunction with the secondary scene and its snapshot() method but it either draws the scene only partially or not at all. It actually seems to have a "timing issue". If I add a sleep between assigning the scene to the SCNView and the snapshot() call, it renders completely. If I have them directly executed after each other, the scene is only rendered partially. I tried the various other proposals that I found here in similar articles (i.e renderToImage as extension of SCNRenderer) but they all show the same timing issue. What would be the right way to render a secondary scene into a NSImage (while the primary scene is displayed)? A: I don't see links to the other proposals you're talking about, but SCNRenderer should be able to help you here — the renderAtTime: method lets you choose the scene timestamp at which to render, so you should be able to make that use the same timestamp as the current frame. You might also be able to improve performance by skipping the NSImage step — which requires reading back data from the GPU to create an image in CPU memory, then feeding it back to the GPU. Possibly you can have your SCNRenderer target an NSOpenGLLayer or MTLTexture, which you can then set as your material's diffuse content to reuse the rendering surface directly. Finally, you can use SK3DNode to display SceneKit (3D) content in a SpriteKit (2D) scene... and you can texture map an SKScene onto a SceneKit 3D object by setting it as a material property's contents. I'm not sure how that'll work for your animation sync issues, but it should at least keep everything in the same render surface.

Anticonvulsant effect of wogonin isolated from Scutellaria baicalensis. In previous studies, we identified sedative effects of Scutellaria baicalensis extracts and found that these extracts or their constituents may also have anticonvulsive effects. Wogonin is a natural product isolated from S. baicalensis, which possesses central nervous system effects such as anxiolytic and neuroprotective activities. In this study, we investigated the effects of wogonin on convulsion related behaviors, such as myorelaxation, motor coordination, and anticonvulsant effects of wogonin on chemical induced seizure and electroshock seizure in mice or rats. The effect of wogonin on membrane potential was also observed. Wogonin was intraperitoneally injected into mice or rats 30 min prior to testing. Animals treated with wogonin did not change locomotor activities as well as endurance times on the rota-rod, which indicates that wogonin did not cause a sedative and myorelaxation effect. Wogonin significantly blocked convulsion induced by pentylenetetrazole and electroshock but not convulsion induced by strychnine. Wogonin also significantly reduced the electrogenic response score, but flumazenil treatment reversed this decrease to the level of the control group. The wogonin treatment increased Cl(-)influx into the intracellular area as dose increased. Flumazenil and bicuculline treatment, however, inhibited the Cl(-) influx induced by wogonin. These results indicate that the anticonvulsive effects produced by wogonin were mediated by the GABAergic neuron.

Highly regioselective palladium-catalyzed direct arylation of oxazole at C-2 or C-5 with aryl bromides, chlorides, and triflates. Complementary palladium-catalyzed methods for direct arylation of oxazole with high regioselectivity (>100:1) at both C-5 and C-2 have been developed for a wide range of aryl and heteroaryl bromides, chlorides, iodides, and triflates. C-5 arylation is preferred in polar solvents with phosphines 5 or 6, whereas C-2 arylation is preferred by nonpolar solvents and phosphine 3. This represents the first general method for C-5 selective arylation of oxazole and should see broad applicability in the synthesis of biologically active molecules. Additionally, potential mechanisms for these two competing arylation processes are proposed on the basis of mechanistic observations.

I Knew a Programmer Who Went Completely Insane - null_ptr http://startingdotneprogramming.blogspot.com/2013/04/i-knew-programmer-that-went-completely.html ====== edw519 Although this is an extreme example, I sympathize and often have feelings like this. But it's not about the amount of work; it's about the constant internal struggle. Let me explain. I have _never_ had a problem about the volume or difficulty of work in any job I've ever had. In fact, some of my favorite memories of work have been sprints to finish something, whether in software, retail/distribution, or food service. I take great pride in _delivering_ , sometimes with compromised quality, but always on time and budget. I imagine many here feel the same way. My internal struggle is the constant questioning of _whether or not I should even put up with illogical bullshit_. I have no doubt that hard work, long hours, complex work, and difficult customers are occasionally part of my world. But every day, in my morning exercise when I would prefer focusing on the work of the day, I always find my mind drifting into anger over unnecessary bullshit like: - working for unethical people - watching others line their pockets while I work - choosing what's best for the company vs. the customer - busting my ass while others sit and watch - endless meetings about nothing - watching great stuff I built being scrapped by idiots - watching horrible decisions made by those for their own benefit - witnessing the functional taking back seat to the political - dealing with managers who don't understand technology (and don't care to learn) - dealing with people who don't understand the business/industry and (don't care to learn) - horrible working conditions for workers while managers get luxury - constant work-prevention structure imposed by people who have never accomplished anything Some days I'm on top of the world, rejoicing when something I built provides great value to others. Other days, I feel like I'm digging holes on the beach only to see them filled up by the overnight tide of idiotic others. My struggle continues. I only hope I have the foresight to take intervention before I ever become like OP. ~~~ michaelochurch You have fought the hydra bravely, and I commend you for that. May the road rise up to meet you. May the wind be always at your back. What do you suppose we do? For the long-term, here's the financial structure for the solution that I see: [http://michaelochurch.wordpress.com/2013/03/26/gervais- macle...](http://michaelochurch.wordpress.com/2013/03/26/gervais- macleod-17-building-the-future-and-financing-lifestyle-businesses/) . Essentially, I think VC-istan and MegaCorps are both dead ends when it comes to genuine technical excellence (which weird people like us care about). I think it's time to have a serious conversation about financing a fleet of mid- growth K-strategist startups instead of these red-ocean, r-strategist, get- big-or-die marketing gambits. Here's an insane thought that I had that just might work. Find a Midwestern city that has $25 million to blow on becoming a top technology hub and set up an Autonomy Fund. (I'll do the "grunt work" of screening for talent; if this idea has legs I'd drop everything to implement it.) 100 top-notch programmers, $125k per year (out of which their resource/AWS costs come, so no one's living high on the hog), and 2 years. First, these companies are designed to become profitable, not to _exit_ , so compensation is profit-sharing, not the joke equity offered by VC-istan. The city that funds this takes a 37.5% profit- share of whatever they build (it's valuating their work at $333k per year, which is lower than a VC valuation, but the terms are better.) If it works, then add time to the schedule (i.e. more years of life and more startups) and possibly more engineers. This is like Y Combinator, but without the feeder- into-VC dynamic; it's to build real businesses that generating lasting value both to a geographical area and to technology itself. I seriously think that Autonomy Funds are going to be big in the next 10 years-- VC-istan is essentially a shitty implementation of an Autonomy Fund, except with selection based on connections rather than technical ability-- but there are some obvious problems (moral hazard, principal-agent issues) that need to be solved. ~~~ illsorted I submit Fargo, ND for your consideration. We have oil money, cheap cost of living, and a decent tech community. ~~~ michaelochurch Do you think that: (a) Fargo's local government would be supportive of a technology Autonomy Fund, and... (b) it would be possible to get a critical mass of engineers to live there? Also, what's the gender balance? I'm married so I don't care, but I think we'd have the best odds in a town where it's at least 53:47 women. ~~~ mahyarm How about Las Vegas? I've never been there but: 1) Cheap airfare, international destination 2) A Party Town, probably helps the gender balance in one aspect, people would like to visit you. 3) No Income Tax 4) Still close to the SF Bay Area 5) Never cold, barely rains (good or bad depending on your preferences) 6) Really cheap real estate. Buy a townhouse for under $100k! 7) Many tech conventions are hosted there 8) Driving from one corner to another takes only 30 minutes according to google maps. ~~~ michaelochurch Here's where I'm attempting to continue the discussion: <https://news.ycombinator.com/item?id=5578195> If we could set up Autonomy Funds we could reshape this industry. ------ DigitalSea This is sadly a lot more common than people think. I have a similar story from a prior employer, a system administrator who was often asked to fix problems usually caused by bad managerial decisions of which he always flagged initially as being problematic but nobody listened to him, even after it turned out he was right from the start, he was one of those guys who knew their shit. He was a really nice, quiet and reserved guy but I noticed over the space of 3 or so months his attitude towards work and the manager at the time started changing. Not many people knew of his Twitter account, but I did. He would post crude remarks about the manager not listening to him and how he should be the manager, often using the initials of the manager when he insulted him to be careful and not be accused of slander I guess. I would often hear him in the office talking to himself, swearing under his breath and mashing his keyboard. You could tell it was getting to him. He was on-call 24/7 but apparently wasn't adequately paid the amount he should have been for someone who was expected to fix something at the drop of a hat. One day he came in and sat at his desk refusing to do any work. He just sat there and then the manager confronted him and asked why he wasn't addressing his list of high priority tickets that he had and then the guy lost it. He didn't get violent, but he started yelling at the guy and the manager was a well-built guy (sorted of sounded and looked like Arnold Schwarzenegger) who I wouldn't even dare cross. After yelling he just walked out and never came back. Of course my manager reported the incident to some higher-ups and then it was revealed a couple of days later he was in a mental hospital as he had a complete breakdown (he apparently drove himself there). I didn't know him that well, but I went and visited him after finding out where he was. He told me that it all built up; he was being blamed when things went wrong and weren't done on time and not being praised when things went right and were delivered within unrealistic time-frames. His girlfriend had also left him the day prior to the meltdown, he said she was unhappy because he was never home and when he was, he was always fixing something remotely or had to come in to fix something. I have a feeling this kind of thing is a lot more common than we can imagine. ~~~ Zenst Sadly it is more common than people even think. Oddly enough it is always the ones that are most productive and I know from personal experience you can clear 200 tickets in a week and somebody doing the same job and paid more gets thru that in a year and you are the one being shafted as you spend your time doing the work instead of office politics. ~~~ derefr Perhaps, instead of seeing your job as "what the job description says", you should see it as "whatever actually gets me rewarded." Which is to say, at some companies, playing office politics _is_ your real job. "Work" is just a signal you can emit to show that you are willing to submit enough to not get fired. ~~~ Swizec Perhaps doing more office politics than productive work is your job's signal it's time to leave. Do _you_ want to work at a company where more resources are wasted on keeping the lights on so to speak than providing value to users? I sure don't. If you can't talk to the CEO or CTO, if you're technical, on your first day physically at the company, that's a Bad Signal (tm). ~~~ derefr I was assuming a context of "you become aware that your company has this problem, and yet you persist in wanting (or _needing_ ) to work there." For example, you might you need the money, live somewhere crap for jobs, and your mortgage is underwater so you can't move somewhere better. If that's the case, _then_ you should, in all pragmatic cynicism, think about your "real job" at the company. Actually, perhaps I need to preface _all_ my advice with "in all due pragmatic cynicism." I've added it to four posts so far and people seem to react much better to them when I do. ~~~ Swizec Ah, pragmatic cynicism. Never was a fan of that, always more of a fan of unpragmatically changing things for the better. Especially these days when the global unemployment rate for programmers is ~3%, you _will_ get a different job and you _will_ get it quickly. I'm told life looks very different if you have done anything resembling settling down. But I haven't been there yet and my glasses have rose coloured lenses. ~~~ vonmoltke I was in a highly political and highly toxic situation prior to my current engagement. It took me over two _years_ to get out of it. If you are not already in one of a handful of major tech hubs, it can be extremely difficult to get out such a situation. Granted, the pragmatic cynicism doesn't help, but if you can stomach it you can stay in a somewhat better frame of mind than I let myself devolve into. ~~~ bostonvaulter2 Out of curiosity, what was it that was keeping you at that job? Lack of money? Family? Moving options? ------ kevingadd Employers, even the good ones, will put as much work on your plate as you can handle and then keep going. Systematically a workplace just isn't set up to help an employee handle stress, or even pay attention to an employee's stress level. They'll ask you to work overtime even if it is obviously killing you because that's just how the typical work environment is structured. Even moving higher up in the food chain, to be a producer or manager, doesn't change this. You need only observe how many workplaces will let employees who are obviously sick with a cold/flu come in and work to understand how poorly most workplaces respond to an employee in trouble: They will not send someone home who is _actively_ exposing coworkers to infectious diseases, so do you think they're going to notice if you're risking your health with stress? Sadly not. So, as an employee, it's up to you: Pay attention to your stress level. If you aren't sleeping well, do something about it. If the stress is making you gain weight, do something about it. If you're having serious, serious problems, do something about it. You can't count on your employer to support you if shit hits the fan - even if it's their fault - because 99% of them won't. You have to be proactive. You won't get promotions or raises for managing your own stress level and working reasonable hours, but you won't get promotions or raises for literally killing yourself either. So play it safe. ~~~ cmdkeen No they won't. Plenty of good employers understand work life balance, they understand that output doesn't linearly increase with time, especially in development. Good employers push their employees in terms of not letting them coast, giving them meaningful work and challenging them to be their best. That is not the same as piling on work and ignoring stress levels. There is an optimum amount of stress at which humans are at their most productive. If your employer isn't like that then they aren't a good employer. ~~~ kevingadd Do you even have any anecdotes to support this? I have literally never encountered an example of an employer proactively managing an employee's stress level. To suggest that an employer can somehow put employees at 'an optimum amount of stress' suggests a lot more understanding of employees than I think is possible in most scenarios. I mean, yeah, we can spout platitudes all we want here. I agree that if you aspire to be a good employer, you should treat your employees well. But that's not the problem here: The example employee in the OP was a top performer who helped solve tough problems, and nobody seemed to suspect that anything was wrong until he snapped. The problem is that workplaces are not designed to be able to identify an employee having problems with stress, let alone to actively manage it. I have never encountered a workplace that can do so effectively - some employers are better than others about things like work/life balance, etc. But the level of stress in your life is variable, and the level of stress being generated by your work is variable, even in the best of circumstances. It is difficult, if not impossible, for an employer to even understand how much stress you might be under outside of work. For example, a lead artist at a previous employer got let go for getting into too many arguments at work. It was only at that point that we learned that he was having a really tough time because he was a single parent and his son was suffering from a severe, life-threatening condition. It's nice to think that if his supervisors had known they could have done something about it - maybe they would have - but from the outside it merely made him look like a bad employee. Maybe he wanted to keep his personal life private, maybe he thought he had it under control, or maybe they decided they had to set an example regardless of his reasons - but the point stands: Ultimately, it is up to you, not your employer, to manage your stress. ~~~ NegativeK I've a friend who was told that he needed to take a vacation. Not in the "You're out of line" sense at all, but in the "We expect our employees to use their vacation time, and you've been working hard lately." He's also been told to cut back on the his hours, as his bosses didn't want him to sacrifice his personal life. Usually when you hear stories like this, it's because the employee is screwing up. In this case, it's because the higher ups realize that proactively preventing employees from becoming overstressed is a good way to keep employees. ~~~ brokenparser That's just what they told him, they really rather not pay the overtime. ~~~ NegativeK Per federal law (and company practice,) he's overtime exempt. ------ mduerksen (Generalisation Warning) This is the dark side of the (otherwise desirable) trait of "getting things done" as employee. I you don't actively manage your working hours _and hold yourself back_ , somebody else will suck you out until you have nothing left. At the end, you will be very unsatisfied for some obscure reason: You did everything you was asked for, yet somehow noone appreciates you and you still earn entry-level. In my opinion, you should only use 80% of your working hours doing the "real stuff". Devote 20% of your working hours to non-technical work, active career development and image management. 1) talk with your boss about clients 2) show interest in the business side of your project 3) ask challenging non-technical questions 4) have a nice chat with your manager about non-work stuff 5) make sure everyone knows who had the interesting feature idea last week 6) make sure that the decision which overruled your recommendation is in the meeting report. ... This is good for you _and_ the company in the long run. Some of your tickets will have to wait, then. Maybe the deadline won't be met perfectly. That's fine. ~~~ philbarr Some of the best advice I've ever had was, "when you start at a company, it's tempting to try and work your arse off to prove how worthy you are. Don't - you're not proving anything, you're just establishing precedent. Instead, quickly determine what the absolute minimum you can get away with is and do slightly above that. Then work harder for the month before review time so you can justify a raise. The extra effort will be noticed now, but if you'd worked your arse off then that would just be normal behaviour." ~~~ obviouslygreen That may be good advice in the sense of being effective, but encouraging people to actively deceive their employers and intentionally do as little as possible is disingenuous and dishonest. If you don't think that reflects on your integrity, or if you don't consider your integrity worth maintaining, then this really is advice that you could consider good. But telling this to impressionable people who are inexperienced and new to Real Life in general would do them and everyone they'll ever work for a huge disservice. ~~~ peterkelly I think a better version of the parent comment's advice would be figure out what is a reasonable, healthy, sustainable level of productivity and try to work as close to that as possible - and no more. ~~~ obviouslygreen Yes, _this_ is good advice. It centers on the person and advocates a work/life balance. It doesn't center on the employer and how they can be manipulated and cheated for the employee's benefit. ------ auctiontheory Mental illness is very common. This story has nothing to do with programming, except that technically strong people are given a lot of leeway for strange behavior, meaning that folks who need treatment often do not get it soon enough. The other point, and I think by now all of us should know this, is that we are each responsible for our health and our careers - we cannot look forward to a lifetime with a paternalistic employer. [Update: this was downvoted. I'm not at all harshing on programmers or on mentally ill people. But we need to face reality; doing otherwise serves no one.] ~~~ tgflynn I don't like labeling this type of situation mental illness. That suggests that it's only the individual who is ill. It seems to me that situations like this result from a sick system as much or more than from individual sickness. ~~~ crusso Are you saying that the system is broken because some jobs ask you to be a hard worker? The article indicated nothing specific that the company had done wrong. It even admitted that the guy was "well treated and well paid" for his hard work - he just didn't like how he was "respected". It's astonishing me that getting paid and treated well to work hard triggers a comment that the "system is sick". ~~~ tgflynn It's a matter of human beings being treated like cogs in a machine (which is in fact what they are in today's world). The potential of highly intelligent people is wasted by those who are better at extracting value than creating it. This leads to ever growing frustration which eventually explodes leading to the destruction of peoples lives. These are seen as individual problems but if these trends continue I believe they will lead to the failure of human civilization and possibly of the human species itself. _hard worker_ \- exactly the type of concept that the machine uses to exploit the naive. ~~~ crusso _human beings being treated like cogs in a machine_ You realize that Hacker News is focused on people starting businesses, right? Why are you here? _hard worker - exactly the type of concept that the machine uses to exploit the naive._ When you get your car worked on, do you expect that the mechanic should fix your car because you're paying him to or because you give him a hug and tell him that he's a useful human being? When you get a cup of coffee, do you expect the barista to want not only for you to pay for your double whip latte, but to also feel that you're validating her as a human being? The guy was "well paid and well treated". Without an iota of evidence that the business was doing anything wrong besides expecting that its employees do a good job - you indite the system and ignore the probable fact that this guy had mental stability issues that were going to come out either at work, his personal life, wherever. ~~~ tgflynn _Why are you here ?_ This is absolutely typical of the problem with society. Judge me, exclude me, push me under a bridge. It doesn't matter what you do to me, the day will come when man will be judged by those he has judged. ~~~ crusso I'm not pushing you anywhere. Be here if you like. I was just trying to understand it. Your comments here are about as appropriate as if I'd go to the golf course and go on melodramatically about how awful a sport golf is. At some point, people would ask me, "Why are you here if you don't like golf?" ------ codewright Your job is to produce surplus value for your employer in exchange for reduced risk and possibly to specialize into work you find interesting. (Machine Learning doesn't happen without division of labor.) You do not owe your employer your sanity or anything above and beyond what's reasonable. (As decided by your personal satisfaction and the standards/mores of your culture.) If you're seeking to put more into the pot so you can extract more later, save money and stash it in a mutual fund or start hustling for yourself. Employers are perfectly happy to ignore you for decades on end, if they even keep you around that long. Don't pretend value will present itself to you just because you're putting in the hours. Like thinking you'll get a date just because you're a good person. Edit: Don't let employers/management guilt you into working more hours than they deserve from you. ~~~ derefr I don't think the guy in the story felt _guilted_ into doing more work. He was trying to "climb the corporate ladder" by doing the only thing he knew how to do--working harder. He didn't understand the effort thermocline[1]. [1] [http://michaelochurch.wordpress.com/2013/02/28/gervais- macle...](http://michaelochurch.wordpress.com/2013/02/28/gervais- macleod-5-interfaces-meritocracy-and-the-effort-thermocline/) ~~~ codewright I was giving advice to the general audience. I have to admit, I find the jargon of this particular sub-culture of analyzing corporate politics somewhat annoying despite being a fan of Church. ------ eip The trick to avoiding complete burnout is easy. First - don't care at all about your job. Remember that all corporations are by definition psychopaths and they will treat you accordingly. Second - never do more then 35% of the work you are capable of doing in a day. Third - if you find yourself getting stressed out tell yourself repeatedly "It's only a stupid job. There is no point in stressing about it." ~~~ dnc > First - don't care at all about your job. Maybe it is counter intuitive but I think healthy dose of this keeps me more productive and more focused on the job. While at work I always try to keep somewhere in the back of my mind Bertrand Russell's quote: "One of the symptoms of an approaching nervous breakdown is the belief that one's work is terribly important". It helps. ~~~ svachalek Early in my career a more senior developer told me you can't do a good job unless you're willing to get fired for it. Coming from a nouveau middle class background, that was pretty shocking to me but over the years I have seen so many situations that have confirmed it to me. ~~~ cpeterso Saving up a few months of living expenses in a bank account, so called "fuck you" money (or "take this job and shove it" money in polite company), can give you peace of mind about losing your job. ------ goatforce5 Years ago I knew of a pair of sysadmins who were extremely overworked, often staying back late and working weekends, etc. Eventually they got a meeting with a higher-up and the opportunity to make their case that they should probably get raises and hiring another person or two would be a great help. They didn't get more people to help, but they were told they only had to work 4 days a week instead of 5, so, you know... That's a raise, right? Problem solved! More money for less hours in the office! Except for the fact they still had the same amount of work that kept them back at night on the weekends. Sysadmin #1 left the meeting, went to his office and wrote his resignation letter. Sysadmin #2 went back to his office. He was found a short time later with slashed wrists and not in a very healthy state. He was taken to hospital, patched up, and put in to a psych ward for a while. After a few months he returned to his job in a very medicated state, and just wandered around having hard to follow conversations with people. He couldn't really do his job any more, but the employer either felt guilty about letting him go, or wasn't legally able to. I'm not sure. Sysadmin #1 successfully resigned, and was hired back as a contractor, setting his own hours and getting paid at a greatly inflated rate. ------ mentalthrowaway This is only tangentially related, but since I'm posting under a throwaway (I've been on HN for many years under my main nick) and can't really ask anyone to upvote this, I feel that this is my best chance for someone to see it. For the last few months I've been growing more depressed, more anxious, and more stressed. I love my job, but it requires a good deal of interaction with clients, which never fails to stress me out. Combine that with relationship nonsense and a general vicious cycle of pain (due to an injury causing chronic pain) and depression, and it's led to a situation where I'm spiraling out of control. After many years of being fairly stable, I started self-harming again and ending up in these obsessive thought loops, culminating in thoughts of death and (occasionally) suicide. Now, I know myself well enough to know that I'm not going to commit suicide (I've been _far_ worse than I am right now, and I've managed to pull myself away from that; I enjoy life entirely too much for suicide, even if things suck right now. I still have hope for the future, and that's not something I see changing.), but this is obviously not healthy. I know I need help, but I have a few problems: Problem #1: I can't find a therapist I can actually trust and connect with. I have serious problems talking to people in real life, so I attempted online therapy; every one I tried was a complete and utter waste of hundreds of dollars. I don't know that I'd go so far as to call them scams, but I wouldn't feel bad about doing so. Regardless, text-based therapy would make a _huge_ difference for me, and I just can't find anything that Doesn't Suck (TM). Problem #2: I've been looking at treatment facilities to just go there, disconnect from the world, and focus on getting better. But I have a job, bills to pay (that can be dealt with by savings, assuming I have a job when I'm out), and responsibilities. I know about FMLA leaves of absence, but that requires you (!) to disclose your illness to your employee; given the massive stigma around mental illness, I really, really dislike that option. All of this, of course, means I feel even more pressure; even in treatment I would feel that pressure. So, HN, what do I do? Problem #2 would be awesome to solve, but problem #1 is the big one; without ongoing therapy, any help I get isn't going to be sustained. I know there's a solution here, and I know I can get better. I'm optimistic about the future for many reasons, and I want to stop feeling like the sky is falling every 15 minutes. Sorry for threadjacking, and thank you all. ~~~ eatitraw I can't comment on the whole situation, since I live outside of the USA, but I can give you some advice about Problem #1. There are great books by David Burns: "Feeling Good: The New Mood Therapy" and "When Panic Attacks". Both are available at amazon kindle: <http://amzn.com/0380810336> and <http://amzn.com/076792083X> The "Feeling Good" book is focused primarily on depression issues and "When Panic Attacs" (as its name suggest) on various anxiety disorder. I suggest to read them both. They are really helpful, but not just because of their content(which is good), but because they present of number techniques from Cognitive- Behavioural Therapy, which you can apply on yourself. But please note that reading the book and using these methodics is order of magnitude more effective than just reading the book and internalizing its contents. Also, can you please elaborate on your issue with finding a therapist? Can you just go to a therapy session? Or you can't because you have to overcome strong anxiety first? If you are able to come and see a therapist(being able to manage your anxiety if you have any), then find a good CBT therapist and do come see her of him. Therapists are trained to deal with people who have all sorts of issues, even such serious as yours. ~~~ mentalthrowaway Thanks for the references; I'll give them a read ASAP. > Also, can you please elaborate on your issue with finding a therapist? Can > you just go to a therapy session? Or you can't because you have to overcome > strong anxiety first? I've attempted to find a therapist I can communicate well with online (complete failure there -- every service I tried was less than worthless, simply because it didn't give me what I really wanted, which was a judgement- free, confidential way to talk through things) and in person. In person, it's very difficult for me to talk about personal matters (business/tech stuff isn't a problem) so finding someone I can trust is incredibly difficult. ~~~ ZoFreX Not all therapy is talk therapy - I thought I needed that, but had similar reservations about how open I could be face to face. When I finally bit the bullet I ended up in most-self-directed CBT, with none of that recounting- childhood-trauma or what have you. It was very pragmatic, more about giving me processes to deal with things, than me telling the psych things and them telling me how to deal with them. ------ danielna I think part of the problem here is that many devs often don't understand how much power they yield over their own situation. If you're good enough to be depended upon in every panic situation, that means you have more say than you think in the circumstances surrounding your work -- specifically regarding pay, scope creep, working environment, etc. If you don't assert yourself nobody will coddle you, because that's how capitalism works. The goal of the company is to maximize profits, but the cost (both time and $) in finding a talented, hard-working employee is huge and employers know that. So you have to stand up for yourself because you hold more cards than you think. If you have a passive personality where you never push back and don't stand up for yourself you will get completely rolled over. I've met devs who only consider one side of the employee-employer agreement -- "don't get fired, don't get fired, don't get fired." What about the other side? "If ___ quits, we are screwed." This is the reason why we invest in our skills, this is why we read things like HN, this is why we make ourselves indispensable. Because a higher level of skill, both technically, socially and in business, not only makes you a greater employee, but it gives you more autonomy over your own circumstances. I don't agree with the comments here that encourage people to half-ass their 9-5 because "you owe the company nothing." I encourage you to do the opposite -- become so good at what you do that they can't ignore you. Be such a valuable perspective/contributor/asset that they shudder at the thought of losing you. Be great and the power will follow. And if they still treat you like shit, leave. If this doesn't apply to your industry, leave the industry. Good, smart devs are hard to find and someone else will pay good money for you. ~~~ UK-AL Managers will actively try to stop you gaining power. In most cases authority will play a game of chicken with developers if they know they are considering leaving, rather conceding. ------ angersock Work-life balance is really important, and having a safety net outside of your workplace and project is key to not going completely batshit. What's really bad is to find yourself in a position where you see your cofounder/coworker the vast majority of the time, and your work/project gets tangled up in the normal ebb and flow of the relationship. You really, really don't want to get into a loop where you need to decompress with your best friends, but you can't because you avoid them because your shared work is going poorly, and the work is going poorly because you can't decompress. Yeah, being in that position sucks. Make sure you've got something positive in your life beyond your current project. ~~~ psionski “If you want to live a happy life, tie it to a goal, not to people or things.” ― Albert Einstein Find a hobby :) ~~~ j-kidd All football fans in the world agree with Albert Einstein :) ------ oyvindeh This is sad, but it's also plain old human psychology. If you help someone out, you put yourself in an inferior position. If you're always the one sacrificing yourself, people around you will feel more and more superior to you. At some point, they will start expecting that you sacrifice yourself whenever shit hits the fan. This doesn't mean it's bad to help out, or to sacrifice yourself once in a while. But in order to keep sanity and self dignity, it's extremely important to learn to say no as well. ~~~ yen223 > If you help someone out, you put yourself in an inferior position. What? This doesn't make sense. When you help someone out, you are putting that person in an inferior position. Does a beggar feel superior to you because you tossed him a quarter? ~~~ zer0gravity And this is precisely how the guy from the story thought, that's why he was saying he should be CEO, but the reality was different, because he was treated more like a slave.. ------ noptic It is far to easy to fall into this trap. At my last job my boss always tryed to finish all my tickets until a friend in managment told me about a conversation he had with our boss. It boils down to: "Does he gt his work done?" "Yes, sometimes he has to stay in late but he gets the job done" "Then we are not giving him enough work. If there are days where he gets the job done and leave on time, there must be times when he finishes his tickets before office hours are over." At my new job things are a lot better. When I started I screwed up a couple of times because I tryed to make things work by putting in over time and fighting until the last minute when things went south, where all I had to do was tell the mangment why I need more time / manpower like anyone else in my company. ------ agentultra Mental health is, unfortunately, not taken very seriously by many companies. I've never seen a benefits package that included therapy or coaching of any kind. We're put under a lot of stress at times (which can be exacerbated by existing mental conditions) and that can seriously affect our health. I suspect mental breakdowns happen more often than they are reported. It's not taken seriously and it's also something people prefer to sweep under the rug. Bad managers don't care how much you work. A friend of mine works in tele- completions for the health insurance industry. He has the highest rate of completions per day than anyone else in his unit _for nearly four years running_. He has been overlooked for every promotion and opportunity to move to a better position. The managers don't want him to leave the unit because their numbers will go significantly down if he does. I've worked an incredible amount of overtime for employers early on in my career. I wanted to show them that I could play the game, get things done, and save the day. I thought that it would pay off. It never did. So I stopped doing it. I knew that the calls would just keep coming. I knew that there was no incentive to let me have time off. I knew that I would never be compensated in any way for all that effort if someone higher up could help it. As long as I was convinced that was the way the world worked, they were getting cheap labour and profiting while I was being driven into the ground and made miserable. You have to make the life that you want. Never let anyone else be in control of you. They have no authority to make you come into work in the middle of the night or stay at work for thirty-six hours straight. I think it's a terrible shame that some people think they have some sort of power to compel others to do this for them. And it often leads to tragedies like the one the OP described. ~~~ infinite8s As you and a friend found out, the problem with putting that much extra effort (especially in 'concave' work) is that a promotion would usually just remove you from the work pool, leading to the ironic effect that the harder you work, the more likely you will limit your chances of moving up. ------ ww520 It is important to build up your fuck-you fund. Once you have a large cushion to weather over a long period of non-working time, your attitude to work will change. Having the fuck-you option to walk away on your side will help you tremendously in dealing with pressure from work. ------ mcclung I know a guy that started cutting himself once with a small pocket knife. He just went back to his office and lost it. He was obviously asked to leave, as he was upsetting the rest of the employees. I saw him a couple of years later and he didn't mention it so I didn't either. How do you ask someone if they are still crazy? Stress is a killer. I try not to let it get to me; I have responsibilities. ------ cynusx Since nobody here said it, if you ever happen in this situation were management dodges accountability for their actions or doesn't understand they are accountable. then there are two options. 1\. Stay: dissociate yourself from the work and the outcome of your work 2\. Quit: start looking for companies that are a better fit for your professional pride and when you've found one, jump ship. Technical skills are still rare, you're not working in a supermarket here. you've got options. ------ pritianka Its so unfortunate to hear things like this. I knew of a person who was so stressed out by programming in similar situations that he went through a complete career revamp. He changed to law school and went on to work in government. He seems happier. ~~~ mailshanx This makes me wonder if the kind of burnout described by OP has anything particular to do with the profession of programming. We periodically have posts on HN by lawyers who got so burned out by their day jobs that they did a career revamp to become developers... ~~~ pritianka yeah, I wonder too. I think most people need change and its not uncommon to see people with two careers. But perhaps jobs that are highly specific in the way you get to your output are more so that way. For eg. engineers work on beautiful problems and come up with awesome solutions. But when they are forced to churn out code, its shitty and tough and repetitive process. Same for lawyers who do corp law vs. litigation. I do Product Marketing and because its such a varied job (particularly at a startup) I don't really feel a burn out. Then again, I am only 3 years into working... ------ pgsandstrom Is it an american thing that workers do free overtime? I live in Sweden and I know NO ONE that stays late without being compensated either with money or shorter days later in the month. ~~~ gnoway It depends on the type of work you're doing. Most jobs in the US fall under the 'Fair Labor Standards Act' and are classified as 'exempt' or 'non-exempt'. 'Exempt' jobs do not require payment for overtime work. The classification of a job as exempt or non-exempt is not arbitrary but I don't know all the rules governing that. I would wager that the majority of people reading this page who live and work in the US would have an 'exempt' job, though. ~~~ TheCoelacanth All "Computer Professionals" are exempt, so that would cover many of the people on this site. The other exemptions are rather broad and would probably cover most of the rest. ~~~ fibbery Not sure if it's Federal or CA law but you have to be making over a certain amount, though, to be exempt. In my last company that way everyone in the engeering dept. making under 70K (so, all of QA and tech support) ~~~ TheCoelacanth For the Federal law, it's $455 per week, so a vast majority of people make enough. I wouldn't be surprised if CA had a higher minimum, since their laws are tend to be more worker friendly than the rest of the US. ------ cplat I can't make out what he was paid for "rushing things out." If it's the same as other programmers, then that reflects badly on the managers. I've seen managers citing low profits for low salaries, but never want to give out the lion's share when the company turns huge profits. Then, programmers become cheap commodities who can be replaced. Cost is always the bare minimum you can get away with, regardless of the profits. This is more prevalent more in the local corporate companies of my country than start ups. I can't stress the importance of how some corporate managers hardly know anything about the technicalities, and end up agreeing to outrageous changes in the requirements. This is the problem in IT companies that engage purely in "pricing wars." And the thing is, most of these mangers don't even have the necessary communication skills, for that's all they have to do, right? ------ mathattack Is the issue really work-life balance, or mental health? They are actually two separate things. I had a roommate lose it. He was very disciplined, but had a chemical imbalance in his head. He was a hard worker, but did this really have any impact on his losing it? I am not an expert, but I doubt it. The end lesson of "Don't kill yourself for a company if they don't respect you" may be true, but that seems a little disconnected from taking care of your mental health. ~~~ peterkelly _Is the issue really work-life balance, or mental health? They are actually two separate things._ Perhaps, but I believe there's a close relationship between the two. Getting the balance wrong can definitely lead to mental health problems. ~~~ mathattack Maybe overwork exacerbates things, but sometimes it's just chemicals wrong in the head. It can be dangerous to treat major mental illness without addressing the biochemistry. In general I am not pro medication, but breakdowns can be deeper than work. Of course an 80 hour work week won't help an already unstable person. ~~~ peterkelly Agreed. I think anyone in this situation should definitely consult a mental health professional. Depending on the factors though it can be a variety of things, and it may be a case of someone who does have a chemical imbalance but is normally fine if working at normal levels, but the overwork can push them over the edge. ------ smrtinsert "It has been my experience that good producers are more likely to be asked to continue to produce. If they moved you to a higher position and better pay then who would produce the software?" This has been my experience as well. No company ever uses that time to great benefit either, they just use it to change their minds seven times before release instead of two. Killing yourself for someone else is not worth it. ------ iSnow >the extra effort and hours that you put into your job as a software developer does not usually amount to someone higher up thinking you should run the company. It has been my experience that good producers are more likely to be asked to continue to produce. In principle this is not even a bad thing. A great software engineer might not be that great as a manager or CEO. It would be better to have a technical career track where you advance in pay, in status items (car, single office) or other perks (conference visits payed by the company). And of course a truely great company would send you on extra holiday for all-nighters and weekend-rush jobs. ~~~ TheCoelacanth It's also not necessary to move someone to management to give them more authority. Most software engineers don't want to deal with hiring/firing people or any of the other stuff that comes with being a manager, but they would be interested in having more say in technical decisions. ------ nicholassmith I worked with a guy who was an incredibly talented developer, and it was his first 'proper' development job. He was smart and good at what he did, and made a good impression, however as time progressed and the reality of ever shifting goal posts and getting half the time you really need to do something took it's toll. Eventually he went to the doctor, who diagnosed a stress related condition and he was prescribed meds which helped for a while. But, it's that melting pot and eventually he snapped, smashed a keyboard and then threw a monitor onto the floor. I took the time to try and help and he realised whilst he loved dev work, he just couldn't deal with the stress of working inside a business and decided to give up. It's a _hard_ industry, I'm personally surprised there's not a much higher rate of stress related illness and depression. We've all probably skirted the burnout zone on a regular basis, long term that's not going to be great for anyone. I'd say the increase in startups being lead by technically gifted people who've done development should help, but there still seems to be an acceptance of push and push until you break or the job is done. ------ abc_lisper This is my biggest fear for myself. ~~~ Zenst Secret I ofund out myself is do not mix what you like to do with what you are paid to do. If you like your job fine, but remember you are paid the same. Many many companies will not reward that extra mile and many performance reviews are completely insulting as everybody gets the same % in so many companies and the variation between poor peope and good is probably an extra .5% pay rise. So unless you are working for yourself, then work to rule will keep you sane. Use your hindsight to plan holidays, if managment don't listern in a timely manner about a potentual problem then just plan that week off down the line and let them suffer - sadly it is the only way you can stay sane and they can pay for there mistakes. Its hard out there, don't make it harder on yourself. ~~~ notimetorelax > let them suffer I agree to that. If management doesn't feel pain of its mistakes it does not have an incentive to improve. ~~~ corwinstephen This is going to sound insulting and I don't mean it that way, but does anyone ever wonder about the fact that managers are frequently considerably less intelligent than the people they manage? I think that's what drives the frustration a lot of the time. The thing is, just because they're less intelligent doesn't mean they're not good managers, but it think it certainly makes it a lot harder for programmers, who are usually very bright, to accept the choices their managers make when they don't particularly agree with them. Having said that, I think a good compromise would be to make sure that the people who get assigned to managerial positions have formerly had the job of the people they manage. That way they're likely to understand the pinpoints and the frustrations and be motivated to eliminate them. Obviously not all programmers will qualify for this job, but some certainly will. ~~~ JanezStupar I guess that you are still a novice. Usually managers did the work of their underlings. However seldomly a competent person gets promoted - as you need someone to do the work. And since the less competent person will be relatively better manager than producer in comparison to the competent person, the less competent guy gets the promotion. I strongly advise everyone to read the Putt's Law, where this phenomena is broken down in great depth. ~~~ UK-AL "managers did the work of their underlings." - only in very traditional companies that promote on seniority. Its not uncommon for someone straight out of college, working as an "ideas" man to manage programmers. ~~~ JanezStupar I apologize. My comment refers to the managers ascended from the developer ranks. People without technical knowledge in the roles of technical managers are in a league of their own when it comes to suck. ------ fabriceleal I hope he gets better soon. I can relate to him. The pressure one might feel is overwhelming: you're expected to work extra- hours because you have a salary greater than the region's average (not only company's average!...); you're expected to work extra-hours, otherwise you're not motivated; you're expected to work extra-hours willingly, not because you're asked or it's needed, and be happy about it; you're expected to work extra-hours because someone gave a deadline to a costumer that's technically and humanly unfeasible, and now there's no going back. All this stress and a mental illness in a parent of mine are scaring me. The thing is, if I had a mental breakdown and ended up in a mental institution, I would probably repeat the "pen and paper to write a program" episode. My brain is so wired to program, either for work or for leisure, that I can't stop thinking about it. If I'm not doing "something" (reading, watching a movie, ...) I'm thinking of something lisp-y. Its exhausting. ------ Ind007 Quite a relevant quote from other blog post today Life is too short to spend every minute of it making somebody else rich. —ardit ------ keeptrying It's not only programmers. Its managers as well. Its anyone who subsumes their job to be their identity! At my old company (big corporation) management shuffles happen every 9 months to a year. One manager went from having 45 people working under him to 0. The guy had a nervous breakdown as well. I heard he swam in one of our large number of fish tanks. That could be a bad rumor though. Anyway he was admitted and all that. The company did pay for everything till he made it back about 4-5 months later after which he quit. I remember him looking at me down the escalator and saying "its not worth it man - its not worth it." So don't let your paycheck or your job be your identity. Also understand that programmers at tech companies (except google/facebook) are at the bottom of the totem pole. So political shit and pressure all end up on the programmer. So try to not be a bottom level programmer for long - either become a tech lead or a manager asap. ~~~ ZoFreX > So try to not be a bottom level programmer for long - either become a tech > lead or a manager asap. What if I want to escape the stress, but want my colleagues to escape it too? We can't all be managers. ~~~ lgieron There are is a (well-backed by arguments) viewpoint that, in order for the capitalism in its current form to work, some portion of the population just needs to get screwed. ------ at-fates-hands I've seen a lot of this over the past two years. I personally have witnessed five guys completely break down. Hell, we just had a manager who was under a lot of pressure last summer for a huge release. He had a complete breakdown and after four months off, he came back, took a demotion, but he's not the same guy anymore. He used to have a really outgoing personality and loved to talk about his band and music. Now he just nods when you say "hi" to him and keeps to himself. While I applaud management for working with him and being patient during his recovery, I'm still wondering why other managers didn't raise flags before he went off the cliff. For me, the larger problem is how do we stop this from happening? How can we stop these situations before people get to a dead end? For some of these people, it's really serious and something you don't ever come back from, which is really, really scary to me. ~~~ neilk _Five_? Is there some connection - the same industry, or the same company? ~~~ at-fates-hands Same industry (web development) different companies. The one thing which connects them all is a developer just like in the article. Driven to perfection, willing to do whatever is asked of him, and burns the candle at three ends until he finally goes over the edge. I'm talking averaging 70 hours a week for two year straight kind of candle burning. The kind of narcissistic pursuit which is simply impossible to achieve. I have stories of all five if you want to hear them. Let me know and I'll elaborate. ~~~ ZoFreX I would like to hear your stories :) ~~~ at-fates-hands Here you go - didn't want to keep it short: <http://pastebin.com/EmM6sZnR> ~~~ neilk Thanks - I posted it back to HN <https://news.ycombinator.com/item?id=5586350> ------ yason Learn to say "no" before it becomes your only choice. ------ lsdafjklsd As a person who struggles with panic / anxiety, the thought of just flipping out and going mad is a huge anxious fear of mine. I often think about the great chess players who just go mad later in life, and now this, happening to a fellow programmer. The great thing about the work we do is the constant problem solving, and a lot of times I bring those problems home with me, it's nagging 'why wont it work', and I can't stop until it's fixed. It's that kind of 'always on the brain' activity that makes me nervous :). It's too bad this happened to him, but nervous breakdowns happen and hopefully time away will help. ------ onemorepassword > _It has been my experience that good producers are more likely to be asked > to continue to produce._ It's my experience that good producers prefer to keep producing, maybe with a little more freedom and a bigger paycheck. Anybody who wants anything else but is incapable of expressing that through actions and words (other than going apeshit) is unlikely to be capable of actually doing whatever else they want to do. Leaders stand up even if their job description is "producing", they don't simmer in a corner and then explode. Given how this person handled the situation I would say the company was absolutely right. ------ TeeWEE The employeer is for a big part at fault here. Off course the employee should make its boundary clear, but the employer just didnt really care for his position. Otherwise they would have noticed much earlier. ------ qompiler Here is my advice, if you think you are really that good, start your own company. Proof it, let the market test you. ~~~ Synthpixel Capital doesn't grow on trees. ~~~ psionski If we're talking about software development, I bet you can piece together a computer from the trash (where do you think my home servers come from :)) that will be good enough to run a company. After that, your only issue is food and rent (which can be either a small or big issue depending on where you live). ------ peterkelly This is a very timely article personally for me and I think this is a really important issue that companies of all shapes and sizes need to be aware of. I've had a couple of times in the past where I've come _very_ close to being this guy. I'm a very hard worker and take my job really seriously (probably too seriously), and have had management that either doesn't appreciate my contributions, or is driving the company in the wrong direction that you can just see it's going to fail. In this situation, the best thing to do (for both parties) is to simply quit. And now I'm my own boss, and putting just as much pressure on myself as the management mentioned in the article. I've come to realise very recently (and after some wise advice from a very good friend of mine) how dumb this is, and that there's a certain point you reach where doing _more_ work actually produces _less_ value. In fact you could draw a graph of working hours vs. output, and it would rise steadily up to something like 40-50 hours, and then drop pretty rapidly after that. I'm learning that not treating everything as urgent, and getting priorities right and accepting that some things just have to wait ultimately ends up being the best thing for everyone involved, including customers. ------ motters This sounds like the final destination of burnout. Probably there should be more education about the effects of overworking on mental/physical health so that people can recognise bad situations when they're getting into them and pull out before it leads to self-destruction. Also the fault is partly on the management side. A good manager should notice if a particular person seems to be working a lot longer than anyone else under relentless deadlines and intervene. While I've never seen anything as bad as in this article I have seen situations where the mild-mannered and earnest tech guy tries to be accommodating to help the company (and sometimes also in the expectation that their efforts will be recognised or rewarded) but really just ends up getting taken advantage of. On odd occasions (especially in the early part of my career) I have even been that guy. ------ jroseattle This is remarkably common, although this scenario appears to have played out at a more extreme level. One statement in this post struck me: "I was the one that the company sent to visit him in the hospital to check on him after his breakdown." Unless this article was written by the CEO...wow, what a shitty company. It's obvious they didn't value this individual for the person, but for the output. Having run my own operation, I can say without a doubt that I value an employee's output, but the only way I can really protect that long-term is by taking interest in the person. It's entirely obvious the company didn't do that. In the end, we're all responsible for our own careers and our own mental health. Don't let your expectations get trampled and remain in an environment that forces you to find happiness. We are in a burgeoning industry, just get out there and find what works for you. ------ charlieflowers I can definitely see this happening. I've never gone insane (thankfully), but when I was younger I have at times gone overboard in trying to please the higher-ups. It becomes a negative cycle, because you think you're going to blow them away so much with your effectiveness, that they are going to bring you into the boardroom and make you a co-executive of the company. And when they don't, you just work harder and bring even smarter ideas to the table. And they still don't (they say "thanks", but they don't rearrange their whole world view and make you a key player in the company). The fallacy is this -- you are waiting for other people to recognize your brillance and "crown" you. You may indeed be brilliant -- I'm not disputing that. But you can't wait for someone to "crown" you. If you have what it takes to be a key player in a company, then _start one_ (or at least, apply for jobs at that level). Whatever field you want to get in, go do stuff in it. This waiting for external validation is the flaw. When the higher-ups start benefitting from the work of someone like this, the temptation is way too strong to simply keep the machine cranking as long as possible. And they know how they got into the positions of power they have -- they "went out and seized it", they didn't wait for someone to hand it to the because they deserved it. So they wouldn't know how to "crown" someone even if they wanted to. The world just doesn't work that way (granted, with some few exceptions). There's no "process" for promoting someone 10 levels because you discovered they are brilliant. Instead, those at the top took it upon themselves to say, "Hey, I belong at the top, and I'm going to insist on it." Some of them over-estimated themselves, and some didn't. But even the ones who really _do_ belong at the top did not wait to be "crowned", but decided for themselves they belonged there. At the heart of it is an irrational need for external validation before you pursue the rightful level for yourself. ------ anonymfus There are at least 3 posts from hellbanned users there, defending sanity of that programmer. Stigmatisation at work. :-( ~~~ gordaco I especially like lucian303's one, which I'll reproduce for those who don't have the appropriate setting: > The 8 hour workday was fought for and won for a reason. To expect more, an > employer would be unprofessional. To accept more, except when compensated or > in extreme circumstances, makes the engineer unprofessional. One comes to > soon realize this. (See The Clean Coder: A Code of Conduct for Professional > Programmers (Robert C. Martin.)) Most companies, especially startups, don't. > It's sad to think that the culture values high stress, long work hours with > the inevitable diminishing return, and literally anything, no matter how > unhealthy, to get workers to be slaves. At the same time, a lot of these > companies have mediocre health and dental benefits with high cost to the > employee. > Yeah, companies don't give a shit about you. And why should they? > Corporations exist to make money. That's all. Your health, while in the > long-term helps this goal, in the short-term it doesn't. The shorter the > lifespan of the company, the less they care. This is easily observed. > The question is, why do you give a shit about your company? ------ minopret I think this story shows a rather low degree of insight into, or observation of, the programmer's abnormal behavior and health. Come on, tell us a little about adjustment disorder, how it builds up and plays out. Or was it acute depression? Phobia? Paranoia? Was the programmer's family involved? Did he voluntarily seek inpatient treatment? Was he placed in psychiatric detention on judge's orders? Tell us how helpful or unhelpful the employer's health insurance was. Maybe the purpose of the story is to illustrate a point, probably a good point, about workplaces. Maybe although the purpose appears to be to report a difficult event that occurred to an acquaintance, it just isn't. In other words, I think it's possible that the story is made up. ------ ianstallings This is insanely depressing and a wake up call to all of us who work every weekend trying to get ahead. You know what gets you ahead in this world? Ownership. Anything less is just spinning your wheels. They'll only give you enough to keep coming in. ------ zer0gravity It is important to learn to use your skills to create what you feel, not what some other person tells you to. Developing a skill is the easy part, learning to use it is harder, because you need to find out who you are. ------ dspeyer > It may be hard to swallow but the extra effort and hours that you put into > your job as a software developer does not usually amount to someone higher > up thinking you should run the company. It has been my experience that good > producers are more likely to be asked to continue to produce. If they moved > you to a higher position and better pay then who would produce the software? This is why it's important to have a way to move "up" (greater reward, prestige and technical authority) that doesn't involve becoming management. ------ ux-app If you're feeling similarly, or have in the past, and are looking for an alternative then you might want to consider teaching. I used to do cubicle work at a couple of tech companies and fucking hated it. I simply cannot stomach office politics, and I can't tolerate others that do the whole ladder climbing, brown nosing thing around me. The straw that broke the camel's back was when my line manager took credit for my work right in front of me without even batting an eyelid. I observed this type of sociopathic behaviour many times from many people. I literally couldn't believe how many fuck heads there are out there. Here are some benefits that I'm enjoying as a teacher at the moment: 1\. Great salary. 90k/year in Australia. I've heard that in other parts of the world it can be a low paying job. 2\. Great working hours. 8:30am - 4pm. 30 mins recess, 50 mins lunch. 7 "free" (non teaching) lessons per week (this is equivalent to one day per week) There are lots of teachers that like to play the "poor me" card and tell you how they spend every night till midnight grading work. They're either liars, or are terrible at time management. I consider myself a perfectly OK teacher, and I never go past 4pm and very rarely do school work on a weekend. 3\. _14 weeks of paid vacation_ \- I just spent the last 2 weeks doing a garden renovation and got paid to do it. 4\. No boss. Technically the principal is my boss, but in 3 years I have barely said more than hello to him and, I sometimes go months without seeing him. No line manager either. What I do in my class is my business. I choose the manner in which I deliver content as well as the interesting tangents that we explore. 5\. No office politics bullshit. Schools have a very flat org structure. If you're not looking at advancing to the admin side of things (deputy/principal) then there is effectively no career path (I consider this a good thing). 6\. Heaps of time for side projects. 7\. Varied work. No two kids are the same, no two semester are ever the same. There are always interesting things happening. Sports days, senior formal, camp etc. I recently spend a week visiting work experience kids and got to visit an army base and defence research facility. 8\. Over the years it's inevitable that you _will_ make a difference in some kid's life. Whether it's helping them through a tough emotional period or helping them make informed life and career goals. There is no way in a million years I could go back to the regular working world. I simply could not give away the _complete_ autonomy and excellent vacation time. In Australia there is a post-grad degree that you can do which will give you a full teacher qualification in just 18 months. Worth seeing if your district offers similar programs. Caveat: 1\. The school you're at matters. I am at a middle class private school with great kids. I've worked at very tough schools and life sucked, however, some thrive in these conditions. 2\. The subject(s) you teach matter. Language rich will entail far more reading and giving written feedback which obviously impacts on hours worked. If you stick to Maths and IT grading is far easier. ~~~ neilparikh I'm a high school student, who is considering teaching as a future career path, and I have a few questions. 1\. What subjects do you teach? Would you recommend teaching them? 2\. Did you find any value in working at a non teaching job first, then going into the teaching career? Put another way, if you were doing this all over again, would you go straight to being a teacher, or would you have a non- teaching job for a little while, and then teach? Thanks. ~~~ ux-app Hi Neil. 1\. I teach Computing/IT and a few AU specific subjects (Research Project and Personal Learning Plan). In the past I have taught Maths up to year 8 level also. Both IT and Maths are great subjects. Personally I'm very happy teaching either of them. One thing to note is that as a teacher you do have to be willing to take on a subject you may not be entirely qualified for. For example I'm currently teaching a year 8 media studies course without having any media training. It's really all about having an open mind. 2\. Having worked outside of teaching first, even though it was only for 3 years, was invaluable. Career teachers who have only ever taught are a strange bunch. They have a totally distorted picture of reality. They don't realise that in the "real world" people: a) have line managers, b) have to keep time sheets which require that _literally_ every hour of time is billed to a client, c) have a boss working across from you or continuously looking over your shoulder, d) have only 4 weeks of paid vacation, e) have a requirement to justify every sick day and produce a doctor's certificate for each absence etc. f) The list goes on and on. So in answer to your question: Having a "real" job outside of teaching has been the single best thing I ever did for my "career". It means that even after almost 10 years of teaching I still appreciate all of the great things this job has to offer. Having said that, teaching is not for everyone. It isn't rocket surgery, but not everyone has what it takes. You have to really love the act of teaching, as well as liking being around kids most of the time. I'm glad you're considering teaching as a career. I hope, whatever path you choose, things work out in your favour. If you have any further questions then I'm happy to pass on my email address. All the best. ~~~ neilparikh Hey, thanks for answering my questions. I appreciate the help. I do have a few other questions. Could I get your email? If you don't want to post it here, my email is in my profile. ------ peterwwillis _It has been my experience that good producers are more likely to be asked to continue to produce. If they moved you to a higher position and better pay then who would produce the software?_ My experience has been the opposite, and more akin to the Peter Principle[1]. The best engineers become team leads, and then managers, and then... [1] <http://en.wikipedia.org/wiki/Peter_Principle> ------ mac1175 Has anyone read The Bug ([http://www.amazon.com/The-Bug-Ellen- Ullman/dp/B000HWYPSE/ref...](http://www.amazon.com/The-Bug-Ellen- Ullman/dp/B000HWYPSE/ref=sr_1_2?ie=UTF8&qid=1366364712&sr=8-2&keywords=the+bug))? After reading it and experiencing all kinds of work environments, I can see how a person's sanity is tested. ~~~ leakybucket Yes - I came in just to mention this. A great combination of a glance into the dotcom startup days + a feel of the classic gothic horror novel. ~~~ mac1175 I also saw it as a cautionary tale to people in our line of work. ------ itsbits Yea...i do feel depression sometimes with my work...Also to add to few points mentioned here, I am also end up doing others work when they just stuck the team work...its frustating when u end up doing others work... But I am always in control..used to play FIFA to control my emotions until my fingers having pain issues...now i watch some movies daily... ------ whiddershins Most mental illness is an illness. Just exactly that. Yes, we want to blame it on working long hours or exposure to unethical bosses, but that myth just makes us feel better. We like to think that we can avoid mental illness by avoiding mean bosses, like we could avoid cancer if we eat plenty of vegetables. Unfortunately, that just isn't true. ------ revskill Maybe he didn't know the best way to do something vs the hardest way to do it. Just relax your mind, think the best in you to produce the best thought and we have the best product as we can. It's the boss's job to decide if we do the good job or not. Please, the boss is not our enemy, ourself is our enemy. ------ pea Completely and utterly irrelevant, but for some reason I assumed it was this guy: [http://groups.csail.mit.edu/mac/classes/6.001/abelson- sussma...](http://groups.csail.mit.edu/mac/classes/6.001/abelson-sussman- lectures/) ------ taytus All this time I felt I was alone, I'm so tired of my bosses' BS. I've being working so long without feeling I'm working for the right company/boss, I need a break. ------ aaronsnoswell Did anyone else laugh when they saw the url 'startingdotnetprogramming.blogspot.com'? I think there's a correlation here with the post title... ~~~ ataylor32 It's actually "dotne", not "dotnet". Strange. ------ stretchwithme Sustainability dictates that you don't keep going above and beyond without corresponding rest and relaxation. ------ bschiett The guy who wrote this should go back to school and learn how to spell. ------ gdonelli sad ------ michaelochurch It's the worst week in 11.5 years to joke about what a part of me _wishes_ he had done, for the good of society, so I won't. Seriously, though, we need to fucking take this industry back. (I am so fucking serious about this issue that I am willing to fucking split infinitives with "fucking".) These executive assholes are destroying _trillions_ in value ( [http://michaelochurch.wordpress.com/2012/11/25/programmer- au...](http://michaelochurch.wordpress.com/2012/11/25/programmer-autonomy- is-a-1-trillion-issue/) ) and we have no fucking need for them. Do we need people who understand business, economics, relationships, and sales? Absolutely. And more than anything, we need genuine _teachers_ to step up and provide leadership. What we don't need are the short-sighted extortionist fuckheads who pass for management in most companies. ------ yoster Sad story, but he needs to set aside time for himself to recuperate and recover from a work week. The old saying that many people have said time and again, that they will go crazy from working, literally happened to him. Why work yourself to the brink of insanity when the people you work for do not honestly care. ------ ttrreeww Company paid health insurance is one of the stupidest thing ever, the moment you most needed it, they fire you. ------ orokusaki Poor guy, this is sad. I did have to laugh at, "He asked for a pencil and a piece of paper so he could write a program down.", however. ------ ttrreeww Wow, there are some great hidden comments here, goto your settings page, turn showdead to yes. ------ ludoo I knew a .* that went completely insane. Ok, so what? ~~~ crusso That's what I thought as well. I expected some dire circumstance that the guy was put in, or some special lesson besides the weekly slacker "don't work to hard for the man" meme. ------ m12k I know it's prejudiced, but I have a hard time taking someone seriously when they have a typo in the url of their site...

Q: Unable to connect Spark to Cassandra DB in RStudio I've spent the last week trying to figure out how to use sparlyr to get spark to connect to cassandra on our local cluster, and I've hit a wall - any help would be greatly appreciated. I'm the only one trying to use R/Rstudio to make this connection (everyone else uses Java on NetBeans and Maven), and am not sure what I need to do to make this work. The stack I'm using is: Ubuntu 16.04 (in a VM) sparklyr: 0.5.3 Spark: 2.0.0 Scala: 2.11 Cassandra: 3.7 relevant config.yml file settings: # cassandra settings spark.cassandra.connection.host: <cluster_address> spark.cassandra.auth.username: <user_name> spark.cassandra.auth.password: <password> sparklyr.defaultPackages: - com.databricks:spark-csv_2.11:1.3.0 - com.datastax.spark:spark-cassandra-connector_2.11:2.0.0-M1 - com.datastax.cassandra:cassandra-driver-core:3.0.2 Sys.setnev setting set for local install of Java and spark, config set to use yml file. Spark connection initiated with: sc <- spark_connect(master = "spark://<cluster_address>", config = spark_config(file = "config.yml")) Spark session initiated with: sparkSession <- sparklyr::invoke_static(sc, org.apache.spark.sql.SparkSession", "builder") %>% sparklyr::invoke("config", "spark.cassandra.connection.host", "<cluster_address>") %>% sparklyr::invoke("getOrCreate") It all seems fine up to here, (sc connection and sparkSession), but now attempting to access a cassandra table (table_1 in in keyspace_1), which I know exists: cass_df <- invoke(sparkSession, "read") %>% invoke("format", "org.apache.spark.sql.cassandra") %>% invoke("option", "keyspace", "keyspace_1") %>% invoke("option", "table", "table_1") %>% invoke("load") throws up the following error: Error: java.lang.IllegalArgumentException: Cannot build a cluster without contact points at com.datastax.driver.core.Cluster.checkNotEmpty(Cluster.java:123) at com.datastax.driver.core.Cluster.(Cluster.java:116) at com.datastax.driver.core.Cluster.buildFrom(Cluster.java:182) at com.datastax.driver.core.Cluster$Builder.build(Cluster.java:1274) at com.datastax.spark.connector.cql.DefaultConnectionFactory$.createCluster(CassandraConnectionFactory.scala:92) . . . A: finally solved it, thanks to a useful tip.I was using the SPARK (with port number) to initialise the SparkSession rather than just the cluster address (where cassandra was located). it works! thanks @user7337271.

Distributed crossbar interconnects with vertical-cavity surface-emitting laser-angle multiplexing and fiber image guides. We report on the implementation of an optical crossbar interconnectconsisting of a centralized free-space beam-steering subsystem, adistributed array of vertical-cavity surface-emitting lasers andphotoreceivers, a fiber image guide, and a large-core polymer fiberarray. The interconnect can in principle handle more than 350cross-bar channels, but our implementation demonstrated only 240channels. Transmissions of 500-Mbit/s per channel weredemonstrated. Approximately 12.7-dB end-to-end optical channelattenuation was measured. Details of component design, packaging, system integration, and testing are presented and discussed.

--- abstract: 'In the context of the massless Nelson model, we prove that two non-relativistic nucleons interacting with a massless meson field do not bind when a sufficiently strong Coulomb repulsion between the nucleons is added to the Hamiltonian. The result holds for both the renormalized and unrenormalized theories, and can also be applied to the so-called piezoelectric polaron model, which describes an electron interacting with the acoustical vibrational modes of a crystal through the piezoelectric interaction. The result can then be interpreted as well as a no-binding statement about piezoelectric bipolarons. The methods used allow also for a significant reduction of about 30% over previously known no-binding conditions for the optical bipolaron model of H. Fröhlich.' author: - 'Gonzalo A. Bley' title: | Absence of Binding in the Nelson and\ Piezoelectric Polaron Models --- [Introduction]{} The intent of this article is to provide a simple proof that two particles attracting each other via an effective massless Nelson-model interaction do not bind when they repel one another through a strong enough Coulomb repulsion. Even though in the Nelson model the particles involved are nucleons (and so need not repel each other), there is a model of two electrons interacting with the acoustical vibrational modes of a piezoelectric crystal, the so-called piezoelectric bipolaron, that has exactly the same Hamiltonian as the massless Nelson model for two particles, with the addition of a Coulomb repulsion term. For this reason our result is of direct physical significance. In the following subsection we shall describe the models involved, while providing references for them. [The Models Involved]{} \[subsection.models.involved\] [The Massless Nelson Model]{} The massless Nelson model describes the interaction of a system of $N$ non-relativistic nucleons with a quantized, massless meson field. Its Hamiltonian reads as $$\begin{gathered} H = -\sum_{n = 1}^N\frac{\Delta_n}{2} + \int_{\mathbb{R}^3}\chi_{\Lambda}(k)|k|a_k^{\dagger}a_k\,dk + \sqrt{\alpha}\sum_{n = 1}^N\int_{\mathbb{R}^3}\frac{\chi_{\Lambda}(k)}{\sqrt{|k|}}\left(e^{ikx_n}a_k + e^{-ikx_n}a_k^{\dagger}\right)\,dk, \label{equation.hamiltonian.nelson.model}\end{gathered}$$ acting on $L^2(\mathbb{R}^{3N})\otimes\mathcal{F}$, where $\mathcal{F}$ is the Fock space on $L^2\left(\mathbb{R}^3\right)$. $a_k$ and $a_k^{\dagger}$ denote the annihiliation and creation operators for the $k$-th mode of the field, respectively, and satisfy the relations $[a_k, a_{k'}^{\dagger}] = \delta\left(k - k'\right)$ and $\left[a_k, a_{k'}\right] = [a_k^{\dagger}, a_{k'}^{\dagger}] = 0$. $\alpha$ is a non-negative number, the coupling constant of the interaction between the nucleons and the meson field; $\Lambda$ is also a non-negative number, and it acts as an ultraviolet cutoff; and $\chi_{\Lambda}$ is the indicator function of the ball of radius $\Lambda$ centered at the origin. $\Delta_n$ is simply the part of the full $3N$-Laplacian corresponding to the particle $n$, namely if $X = (x_1, x_2, \ldots, x_N)$ is the position vector of the particles (a $3N$-dimensional vector), and if $x_n = (x_n^1, x_n^2, x_n^3)$, then $\Delta_n = \partial^2/\partial^2 x_n^1 + \partial^2/\partial^2 x_n^2 + \partial^2/\partial^2 x_n^3$. The model is due to Edward Nelson, who presented it for the first time in 1964 in [@N1], and subsequently in [@N2]. The most noteworthy property of the Hamiltonian is that it requires renormalization if one is to make sense of it when $\Lambda = \infty$: even though $H$ is self-adjoint and bounded-below when $\Lambda$ is finite, the ground-state energy of $H$ goes to negative infinity as $\Lambda \to \infty$. However, if one adds a term, that we denote by $Q$ and define as $$\begin{gathered} \alpha N\int_{\mathbb{R}^3}\frac{\chi_{\Lambda}(k)}{|k|^2\left(|k|/2 + 1\right)}\,dk = 8\pi\alpha N\log\left(1 + \Lambda/2\right), \label{equation.renormalizing.term}\end{gathered}$$ then one obtains a self-adjoint, bounded below operator $\widehat{H}$ in the limit; more precisely, for every real $t$, $e^{it(H_{\Lambda} + Q_{\Lambda})}$ goes to $e^{it\widehat{H}}$ strongly as $\Lambda$ goes to infinity. The aforementioned properties of were observed by Nelson [@N2]. We would like to mention as well that an additional infrared cutoff $\left\{ k \in \mathbb{R}^3 : |k| \geq \mu\right\}$, on top of $\chi_{\Lambda}(k)$, is required for $H$ to have a ground state [@LMS], even though this fact will not be relevant for us in the present article. We are interested here in the case $N = 2$. [The Piezoelectric Polaron]{} The piezoelectric polaron describes the interaction of an electron with the acoustical vibrational modes of a piezoelectric crystal. It is usually attributed to R.A. Hutson [@H], and to G.D. Mahan and J.J. Hopfield [@MH]. Its Hamiltonian is the same as that of the massless Nelson model, $$\begin{gathered} H^1 \equiv -\frac{\Delta}{2} + \int_{\mathbb{R}^3}\chi_{\Lambda}(k)|k|a_k^{\dagger}a_k\,dk + \sqrt{\alpha}\int_{\mathbb{R}^3}\frac{\chi_{\Lambda}(k)}{\sqrt{|k|}}\left(e^{ikx}a_k + e^{-ikx}a_k^{\dagger}\right)\,dk, \label{equation.piezoelectric.polaron}\end{gathered}$$ where now $\Lambda$ is kept fixed at a positive value, the so-called Debye wave number [@L Page 430, Footnote 6]. $\alpha$ is defined in terms of quantities that depend on the crystal in question (such as the speed of sound); see [@TW; @WGT] for a precise definition of this constant, and also [@RW; @WP] to gain a better understanding of the model. We will study here the case of two electrons in a piezoelectric crystal, whose Hamiltonian follows directly from , $$\begin{gathered} H_A^2 \equiv -\sum_{n = 1}^2\frac{\Delta_n}{2} + \int_{\mathbb{R}^3}\chi_{\Lambda}(k)|k|a_k^{\dagger}a_k\,dk + \sqrt{\alpha}\sum_{n = 1}^2\int_{\mathbb{R}^3}\frac{\chi_{\Lambda}(k)}{\sqrt{|k|}}\left(e^{ikx_n}a_k + e^{-ikx_n}a_k^{\dagger}\right)\,dk + \frac{A}{|x_1 - x_2|}. \label{equation.piezoelectric.bipolaron}\end{gathered}$$ Physically $A$ is, after fully restoring units, $e^2/(4\pi\varepsilon)$, where $e$ is the electron charge and $\varepsilon$ is the permittivity of the medium the electrons are in (not the vacuum, but a crystal), but it will be more transparent for us to simply treat $A$ as a fixed constant that can take any non-negative value. Here one may treat the two electrons as fermions or simply not impose any symmetry on them – our final result will be valid in both cases. [The Optical Polaron]{} The last model we will have the opportunity to discuss is that of the optical polaron of H. Fröhlich [@Fr2; @Fr]. It describes the interaction of a single non-relativistic electron with the optical vibrational modes of a crystal lattice. Its Hamiltonian is similar to the ones just described, the main difference being that there is no ultraviolet cutoff, $$\begin{gathered} -\frac{\Delta}{2} + \int_{\mathbb{R}^3}a_k^{\dagger}a_k\,dk + \frac{\sqrt{\alpha}}{2^{3/4}\pi}\int_{\mathbb{R}^3}\frac{1}{|k|}\left(a_k e^{ikx} + a_k^{\dagger}e^{-ikx}\right)\,dk. \label{equation.polaron.hamiltonian}\end{gathered}$$ Even though the model was first devised by H. Fröhlich, many people after him provided critical contributions to its understanding. One of them was R. Feynman, who in 1955 [@F] provided a new interpretation of the interaction of the electron with the lattice through the use of functional integrals. In particular, the functional integral analysis reveals a fact that is not visible at the level of the operator , which is that the electron, roughly speaking, is attracted to its own past history via a Coulomb interaction with coupling constant $\alpha$. Relevant here as well are works by T.D. Lee, F.E. Low, D. Pines [@LLP; @LP], and M. Gurari [@G], where a variational principle due to S. Tomonaga [@T] was used to obtain a power series expansion of the ground-state energy of the polaron in terms of the total momentum of the system. (In reality they obtained an upper bound, since they used a trial state in their analysis.) We would like also to mention perturbation-theoretic calculations for the polaron due to E. Haga [@Ha], and a work by E.H. Lieb and K. Yamazaki, where a rigorous lower bound to the polaron energy was found [@LY]. These are all early works from the 50’s. Important for us in the present article is a more recent work from R.L. Frank, E.H. Lieb, R. Seiringer, and L.E. Thomas [@FLST] where, in particular, a no-binding condition for the optical bipolaron was found. We will refer to this last work repeatedly during the rest of the paper. It provides, in particular, good references on more recent works on the model. The Hamiltonian is to be interpreted as the norm-resolvent limit of the corresponding operator with an ultraviolet cutoff in the interaction [@GM Discussion immediately above (1.2)], and is the form used in the aforementioned work of Frank et al. [@FLST]. [Methods of Proof]{} In the following discussion, we shall refer to the piezoelectric polaron model. A simple argument involving functional integrals, which we will elaborate on later, shows that the interaction of the two electrons with each other when the repulsion parameter $A$ is equal to $0$, mediated through their coupling with the acoustic phonon field, is attractive and “retarded Coulomb-like” (the precise meaning of which we shall see later on) with strength $\alpha$ – up to constants. If $A$ is big enough (or, equivalently, if $\alpha$ is small enough), one would expect that in the minimum energy configuration the electrons would be pushed very far apart by the mutual Coulomb repulsion (which would overcome, by virtue of its strength, the attraction created by the interaction of the particles with the field), and that the electrons would be left interacting by themselves with their own local cloud of excitations of the phonon field. In particular, one would expect that there would be no binding between the two polarons, meaning that the ground-state energy of the entire system of two electrons immersed in the crystal would be equal to twice the ground-state energy of the Hamiltonian above for one piezoelectric polaron, Equation . Exactly how much bigger $A$ would have to be in relation to $\alpha$ for there not to be binding would depend on the intricate and exact nature of the attraction between the two electrons; and since this is by no means a simple attraction, we were merely able to prove that if $A \geq C(\Lambda)\alpha$, where $C(\Lambda)$ is an explicit but diverging function of $\Lambda$, then the ground-state energy of the full Hamiltonian is twice the ground-state energy of the corresponding single-particle Hamiltonian . We certainly do not endeavor into making any statements as to the sharpness of this relation, $A \geq C(\Lambda)\alpha$, since we simply do not know what happens if $A$ is smaller than $C(\Lambda)\alpha$. Even though our function $C(\Lambda)$ goes to $\infty$ as $\Lambda \to \infty$, this is not a problem for the piezoelectric polaron, since one keeps $\Lambda$ finite, but it is an issue for the Nelson model, as in that case one does take $\Lambda$ to $\infty$ in order to renormalize it. We relegate a no-binding result for the Nelson model to the last section of this article, and the reason why we leave it for last is that we do not get what one would like, or expect – we obtain a non-linear relationship between $A$ and $\alpha$. This is most likely an artifact; see Section \[section.polaron.nelson\]. The method of proof of the results above involves three ingredients: First, a partition of unity of the configuration space $\mathbb{R}^6$ of the position of the two electrons, which allows local estimates to be made. The partition is an adaptation to the piezolectric bipolaron of an argument of Frank, Lieb, Seiringer, and Thomas [@FLST]. Second, a refined lower bound for the ground-state energy of two particles interacting with each other and with a quantum field through the Nelson interaction (without repelling each other), given in a recent paper of the author [@B], as well as an upper bound for the corresponding 1-particle model, provided in the present article; and third, the observation that the massless Nelson interaction is essentially Coulomb when the interparticle distance is localized, which becomes apparent at the functional integral level – see Section \[section.second.localization\]. Regarding the first ingredient, a double partition of unity was performed in [@FLST], where the interparticle distance was first split using a single length scale that is then raised to ever higher powers for large distances, in order to control the localization error; a second partition for the entire space $\mathbb{R}^6$ was then made using two movable balls of fixed radius, in order to localize the electrons even further in their own boxes. In total, they localize, so to speak, 7 degrees of freedom (the interparticle distance, which is a one-dimensional object, plus the center of each ball, gives a total of 7), which is obviously an “overlocalization” (there being only 6 spatial degrees of freedom), and one would expect to be able to solve the problem without localizing so much. Indeed, we show how one can make do with just localizing one of the balls, and not the two of them. Thus, in total, we localize just 4 degrees of freedom. All the partitions are then completely optimized using a reduction of the resulting infinite dimensional minimization problem to a low-dimensional one, as in [@BB]. When our methods are applied to the optical bipolaron model of H. Fröhlich – the obvious extension of to 2 electrons – we obtain a significant improvement over previous results on the no-binding of electrons in this model, namely the passage from $A \geq 36.9\alpha$ [@BB] to $A \geq 25.9\alpha$. (In [@FLST] the condition was $A \geq 37.7\alpha$.) See Section \[section.polaron.nelson\]. (In [@BB] and [@FLST] the no-binding conditions appear with different numbers because $p^2$ was used for the kinetic energy instead of $p^2/2$.) We would like to finish this subsection by pointing out a result known as the subadditivity of the energy. For our purposes here, it merely states that $\text{inf spec }H_A^2 \leq 2 \text{ inf spec }H^1$, where $H^1$ and $H_A^2$ have been defined in the previous subsection. This result holds even if one treats the electrons as fermions (meaning that the infimum on the left is on anti-symmetric functions). The proof is a careful execution of what we explained in the first paragraph of this subsection; the idea is to separate the two electrons as much as possible, so that they essentially interact just with their own phonon cloud. See [@LS Section 14.2] and the references in [@GM Theorem 1.4 and its proof] for more information. What is missing to prove absence of binding is then the other inequality $\text{inf spec }H_A^2 \geq 2 \text{ inf spec }H^1$, and that is what this article provides. One then gets that the binding energy, $2\text{ inf spec }H^1 - \text{inf spec } H_A^2$, is zero. The same arguments hold for the optical polaron model (and the Nelson model). [Main Results]{} Even though the results in the article have been already hinted at in the previous subsection, we shall state them now precisely, for the convenience of the reader. We shall start by formally defining a concept we have been alluding to repeatedly. Let $E_1$ be the ground-state energy of any of the 3 models mentioned in Subsection \[subsection.models.involved\] when only one particle is present, and $E_2(A)$ be the corresponding ground-state energy when there are 2 particles and an additional Coulomb-repulsion term $A/|x_2 - x_1|$ is considered. We say that there is no binding if the binding energy $2E_1 - E_2(A)$ of the two-particle system is zero. Intuitively, this concept means that the minimum energy configuration of the two-particle system is that of two particles infinitely separated from one another, interacting with their own local cloud of excitations of the quantum field. In the case of the piezoelectric bipolaron model, Hamiltonian , there is an explicit positive function of the cutoff $\Lambda$, $C$, such that there is no binding if $A \geq C(\Lambda)\alpha$. \[theorem.main.result.piezoelectric.bipolaron\] See Sections \[section.partition\] and \[section.second.localization\]. The function $C$ appears in Equation . There is no binding in the 2-body massless Nelson model, Equation with $N = 2$, if a repulsion term $A/|x_1 - x_2|$ is added to the Hamiltonian, with $A \geq B_1\alpha + B_2\alpha^7$, for some explicit positive constants $B_1$ and $B_2$, which are independent of the cutoff $\Lambda$. The result holds for both the unrenormalized and renormalized theories. See Section \[section.polaron.nelson\]. The constants $B_1$ and $B_2$ can be derived from . The explanation of the meaning that the result is true for both the renormalized and unrenormalized theories is found in the paragraph containing Equation . For the optical bipolaron model of H. Fröhlich (see Equation and consider two particles, in the spirit of Hamiltonian ), one has no binding as soon as $A \geq 25.9\alpha$. See Section \[section.polaron.nelson\]. As already mentioned, the bound $A \geq 25.9\alpha$ is an improvement of about $30\%$ over previous results on the no-binding of bipolarons [@FLST; @BB]. [Remark on Some Functional Integrals]{} \[subsection.remark.functional.integrals\] Our proofs below will rely heavily on the use of functional integrals for the estimation of ground-state energies. In particular, for the two-electron piezoelectric polaron (or two-nucleon massless Nelson model with repulsion) we have that the ground-state energy is bounded from below by $$\begin{aligned} -\limsup_{T \to \infty}\frac{1}{T}&\log\left\{\sup_{(x, y) \in \mathbb{R}^6}E^{(x, y)}\left[\exp\left(\alpha\sum_{m, n = 1}^2\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}e^{-ik(X_t^m - X_s^n)}|k|^{-1}\,ds\,dt\,dk\right.\right.\right.\nonumber\\ & \left.\left.\left. \qquad\qquad\qquad\qquad - A\int_0^T\frac{dt}{|X_t^1 - X_t^2|}\right)\right]\right\}, \label{equation.feynman.kac.piezoelectric.polaron}\end{aligned}$$ where $X = (X^1, X^2)$ is $6 = 3 + 3$-dimensional Brownian motion starting at $(x, y)$, and $E^{(x, y)}$ denotes expectation with respect to that process. As for the optical bipolaron model, the corresponding lower bound is $$\begin{gathered} -\limsup_{T \to \infty}\frac{1}{T}\log\left\{\sup_{(x, y) \in \mathbb{R}^6}E^{(x, y)}\left[\exp\left(\frac{\alpha}{\sqrt{2}}\sum_{m, n = 1}^2\int_0^T\!\!\!\int_0^t\frac{e^{-(t - s)}}{|X_t^m - X_s^n|}\,ds\,dt - A\int_0^T\frac{dt}{|X_t^1 - X_t^2|}\right)\right]\right\}. \label{equation.feynman.kac.polaron}\end{gathered}$$ These two estimates follow basically from the analysis contained in [@B Appendix A] and [@B2 Chapter 2]. Noteworthy is the fact that the quantum field variables have disappeared in the two Feynman-Kac-like formulas above. The expectation in was basically known to Nelson in his first work on his model [@N1] – a functional integral analysis of the model was in fact his first approach to the Hamiltonian , that he left behind in favor of operator methods [@N2]. The expectation in was found for the first time by Feynman [@F] in the case of a single electron, by integrating the quantum field variables, using methods developed in [@F2]. These two estimates, and variations of them, will be used throughout the rest of article. We shall make use also of the following exact Feynman-Kac formulas for the ground-state energies of the two-electron piezolectric polaron and optical bipolaron models, respectively, $$\begin{gathered} -\lim_{R \to \infty}\lim_{T \to \infty}T^{-1}\log\left[\int_{B_R}\int_{B_R}\int\!\int\exp\left(\alpha\sum_{m, n = 1}^2\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}e^{-ik(\omega_t^m - \omega_s^n)}|k|^{-1}\,ds\,dt\,dk\right.\right.\nonumber\\ \left.\left.\qquad\qquad\qquad\qquad - A\int_0^T\frac{dt}{|\omega_t^1 - \omega_t^2|}\right)\eta_R(\omega^1)\eta_R(\omega^2)\,dW_{x, x}^T(\omega^1)\,dW_{y, y}^T(\omega^2)\,dx\,dy\right],\label{equation.feynman.kac.exact.piezoelectric.polaron}\\ -\lim_{R \to \infty}\lim_{T \to \infty}T^{-1}\log\left[\int_{B_R}\int_{B_R}\int\!\int\exp\left(\frac{\alpha}{\sqrt{2}}\sum_{m, n = 1}^2\int_0^T\!\!\!\int_0^t\frac{e^{-(t - s)}}{|\omega_t^m - \omega_s^n|}\,ds\,dt\right.\right.\nonumber\\ \left.\left. \qquad\qquad\qquad\qquad - A\int_0^T\frac{dt}{|\omega_t^1 - \omega_t^2|}\right)\eta_R(\omega^1)\eta_R(\omega^2)\,dW_{x, x}^T(\omega^1)\,dW_{y, y}^T(\omega^2)\,dx\,dy\right],\label{equation.feynman.kac.exact.polaron}\end{gathered}$$ where $B_R$ is the ball centered at the origin of radius $R$, $\omega^1$ and $\omega^2$ are independent 3D Brownian motions, $\eta_R$ is the indicator function equal to 1 if a Brownian path $\omega$ is completely contained in $B_R$ and 0 otherwise, and $dW_{x, x}^T$ is conditional Wiener measure for Brownian paths that start and end at the point $x$ in $\mathbb{R}^3$. Some words pertaining Formulas and are in order now. They can be obtained from the analysis found in a book by G. Roepstorff [@R], regarding the computation of the partition function for a system consisting of a particle linearly coupled to a Bose field; specifically, the one found in Sections 5.1 and 5.3. The formulas follow basically from selecting $V(x)$ equal to $\infty$ if $x$ is not in the ball $B_R$, and equal to 0 otherwise, in [@R Equation (5.3.19)]. The expressions inside the exponentials in and are identical to the ones in and , because the way the field variables are integrated in [@R Section 5.1] is equivalent to the one in [@B2 Section 2.1]. Equation for the polaron was used in the work by Frank, Lieb, Seringer, and Thomas alluded to before [@FLST Equations (1.22) and (1.23)]. [The Structure of the Article and Acknowledgments]{} We now give an outline of the article. In Section \[section.partition\] we partition the distance between electrons in the context of the piezoelectric bipolaron. This is the first localization. In Section \[section.second.localization\] we continue referring to the piezoelectric bipolaron, and another localization is performed, where a single electron is placed in a ball, thus “pinning” it to a center. This second localization allows the two electrons to stay far apart, even with the Coulomb-like attraction between them being present, which arises from the coupling with the field. (This is not a totally trivial fact, as will become clear later in the paper.) The final result $A \geq C(\Lambda)\alpha$ is given in this section. Then, in Section \[section.polaron.nelson\] we study what happens when the method used for the piezoelectric polaron is mimicked in the optical bipolaron and Nelson models. In particular, we obtain an improvement over previous results on no-binding of optical bipolarons, bringing the condition $A \geq 36.9\alpha$ to $A \geq 25.9\alpha$, as we have previously mentioned. In Appendix A we provide a short description of the techniques behind the lower bounds for the spectra of the models involved in this work. In Appendix B we provide a short proof of an upper and a lower bound for the massless Nelson model that are used in the no-binding proof for the piezoelectric polaron. In Appendix C we explain and address a few mistakes made in the Ph.D. thesis of the author, on which the present article is partially based. We would like to take this last paragraph to thank Lawrence Thomas for very long and productive discussions. The author acknowledges as well partial support from the Danish Council for Independent Research (Grant number DFF-4181-00221). [Partition of Interparticle Distance.]{} \[section.partition\] We will focus in this and the following section on the piezoelectric polaron model. Only in Section \[section.polaron.nelson\] will we refer to the optical polaron and Nelson models. In this section we perform a partition of unity on the configuration space $\mathbb{R}^6$ for the position $(x, y)$ of two three-dimensional particles. The construction here follows the lines in [@FLST Section 2], adapted to our purposes for the piezoelectric polaron. Let $a_0, a_1, a_2, \ldots$ be positive numbers and define, for each $n \geq 0$, $s_n \equiv \sum_{i = 0}^n a_i$. We partition the half real-line $[0, \infty)$ with the functions $$\begin{aligned} \varphi_0(t) & \equiv \begin{cases} 1 & 0 \leq t \leq a_0\\ \displaystyle\cos\left[\frac{\pi(t - a_0)}{2a_1}\right]\qquad & a_0 \leq t \leq a_0 + a_1, \end{cases}\end{aligned}$$ and $$\begin{aligned} \varphi_n(t) & \equiv \begin{cases} \displaystyle\sin\left[\frac{\pi\left(t - s_{n - 1}\right)}{2a_n}\right] \qquad & s_{n - 1} \leq t \leq s_n\vspace{1mm}\\ \displaystyle\cos\left[\frac{\pi\left(t - s_n\right)}{2a_{n +1}}\right] & s_n \leq t \leq s_{n + 1}. \end{cases}\end{aligned}$$ (Each $\varphi_n$ is defined as 0 outside of the intervals given above.) Each one of the functions $\varphi_n$ represents an asymmetric bump in the shape of a sine function with one side longer than the other, with the exception of $\varphi_0$, which is the shape of a half-pill. By construction, $\sum_{n = 0}^{\infty}\varphi_n^2(t)$ is equal to 1 for all $t$, and so the functions $\varphi_n$ form a quadratic partition of unity for $[0, \infty)$. We then use the functions $\varphi_n$ to separate the interparticle distance, resulting in a partition of $\mathbb{R}^6$; namely, we consider the functions $\phi_n(x, y) \equiv \varphi_n(|x - y|)$ for $n \geq 0$. And since obviously $\sum_{n = 0}^{\infty}\phi_n^2 = 1$, the collection of functions $\phi_0, \phi_1, \phi_2, \ldots$ forms a quadratic partition of unity for $\mathbb{R}^6$. We then have, by the IMS formula [@CFKS Section 3.1], $$\begin{gathered} H_A^2 = \sum_{n = 0}^{\infty}\phi_n H_A^2\phi_n - \frac{1}{2}\sum_{n = 0}^{\infty}|\nabla\phi_n|^2, \label{equation.IMS}\end{gathered}$$ where $H_A^2$ is the Hamiltonian of the piezoelectric bipolaron, Equation . The second term in is a localization error. It tells us that localizing comes at an increase in kinetic energy (which is expected, given the uncertainty principle). For $\psi$ as any state in the quadratic form domain of $H_A^2$ one has, by defining $\psi_n \equiv \phi_n\psi$, $$\begin{aligned} (\psi, H_A^2\psi) & = \sum_{n = 0}^{\infty}(\psi_n, H_A^2\psi_n) - \frac{1}{2}\sum_{n = 0}^{\infty}\left(\psi, |\nabla\phi_n|^2\psi\right)\nonumber\\ & = \sum_{n = 0}^{\infty}\left(\psi_n, H_0^2\psi_n\right) - \frac{1}{2}\sum_{n = 0}^{\infty}\left(\psi, |\nabla\phi_n|^2\psi\right) + A\sum_{n = 0}^{\infty}\left(\psi_n, |x - y|^{-1}\psi_n\right)\nonumber\\ & \geq (\psi_0, H_0^2\psi_0) + \sum_{n = 1}^{\infty}(\psi_n, H_0^2\psi_n) - \frac{1}{2}\sum_{n = 0}^{\infty}(\psi, |\nabla\phi_n|^2\psi) + A\sum_{n = 0}^{\infty}\frac{\|\psi_n\|^2}{s_{n + 1}}. \label{equation.first.localized.bound}\end{aligned}$$ The idea now is to prove that, if $A$ is big enough, $$(\psi, H_A^2\psi) \geq 2\text{ inf spec }H^1\sum_{n = 0}^{\infty}\|\psi_n\|^2 = 2\text{ inf spec }H^1\|\psi\|^2, \label{equation.no.binding.condition}$$ which will imply no-binding. (Recall that $H^1$ is the analog of Equation for just one particle, Equation .) We will accomplish this by bounding each one of the terms in . We will start with the third one – it can be controlled as follows: by noticing that $|\nabla\phi_n(x, y)|^2 = 2|\varphi_n'(|x - y|)|^2$ for all $n$ and recalling that $\sum_{m = 0}^{\infty}\phi_m^2 = 1$, $$\begin{aligned} \sum_{n = 0}^{\infty}(\psi, |\nabla\phi_n|^2\psi) & = 2\sum_{n = 0}^{\infty}(\psi, |\varphi_n'(|x - y|)|^2\psi) = 2\sum_{m = 0}^{\infty}\sum_{n = 0}^{\infty}\left(\psi_m, |\varphi_n'(|x - y|)|^2\psi_m\right)\nonumber\\ & \leq \frac{\pi^2}{a_1^2}\|\psi_0\|^2 + \sum_{m = 1}^{\infty}\frac{\pi^2}{\min(a_{m + 1}, a_m)^2}\|\psi_m\|^2.\end{aligned}$$ We now continue with the first term in . This corresponds to the case where the electrons are close to each other. We provide in Appendix B the following lower and upper bounds for the piezoelectric polaron: The ground-state energy of the two-particle piezoelectric polaron without repulsion is bounded below by $-2C_1(\Lambda)\alpha - 8C_2(\Lambda)\alpha^2$, where $C_1$ and $C_2$ are explicit but diverging positive functions of $\Lambda$, and the one-particle piezoelectric polaron ground-state energy, which we denote by $E$ (equal to $\text{inf spec }H^1$, using the notation of ), is bounded above by $-C_1(\Lambda)\alpha$, where $C_1$ is the same as in the lower bound. Then $$\begin{gathered} \left(\psi_0, H_0^2\psi_0\right) \geq \text{inf spec }H_0^2\|\psi_0\|^2 \geq \left[-2C_1(\Lambda)\alpha - 8C_2(\Lambda)\alpha^2\right]\|\psi_0\|^2 \geq \left[2E - 8C_2(\Lambda)\alpha^2\right]\|\psi_0\|^2. \label{equation.estimate.first.region}\end{gathered}$$ By grouping terms, we summarize what has been done so far – from Equation , $$\begin{aligned} \left(\psi, H_A\psi\right) \geq & \left[2E - 8C_2(\Lambda)\alpha^2 - \frac{\pi^2}{2a_1^2} + \frac{A}{a_0 + a_1}\right]\|\psi_0\|^2\nonumber\\ & + \sum_{n = 1}^{\infty}\left(\psi_n, H_0^2\psi_n\right) + \sum_{n = 1}^{\infty}\left[\frac{A}{s_{n + 1}} - \frac{\pi^2}{2\min(a_{n + 1}, a_n)^2}\right]\|\psi_n\|^2.\end{aligned}$$ This concludes the first part of the bounding of the terms in . What remains is the bounding of the energy expectations where the electrons are far apart, the terms $(\psi_n, H_0\psi_n)$ for $n \geq 1$. An additional localization will be performed to control these expectations in the next section. [Further Localization: Single-Electron Pinning]{} \[section.second.localization\] Let $n \geq 1$. We will spend this section bounding from below the term $(\psi_n, H_0^2\psi_n)$. We will perform a second localization where one of the electrons will be effectively pinned down, which will allow us at the end to arrive at a lower bound. This localization will be made to only one of the electrons, but either of them may be selected – we will pick the “second one” (the one with $y$-coordinates). In [@FLST Section 2] the two electrons were pinned in a symmetrical fashion, which introduced an extra localization error with respect to what we do here. For the space $\mathbb{R}^3$ we construct the following partition: Let $f$ be a function $\mathbb{R}^3 \to \mathbb{R}$ with the following properties: $f$ is continuous, $f$ has compact support, $f$ is $C^1$ on its support, and $\|f\|_2 = 1$. Then consider the family of functions $f_u(x, y) \equiv f(y - u)$. Then obviously $\int_{\mathbb{R}^3}f_u^2\,du = 1$, and so the family forms a continuous partition of unity. We then have the following formula, $$\begin{gathered} H_0^2 = \int_{\mathbb{R}^3}f_u H_0^2 f_u\,du - \frac{1}{2}\int_{\mathbb{R}^3}|\nabla f_u |^2\,du. \label{equation.second.localization}\end{gathered}$$ (This follows from a proof analogous to the one found in [@CFKS Section 3.1].) The symmetry of the problem at hand will make it at the end very natural to select a sphere of a certain radius, say $R_n$, as the support of $f$, and so it will be fixed at that. One would like now to make the localization error, the second term on the right side of the equation above, as small as possible. This is just equal to $\frac{1}{2}\int_{\mathbb{R}^3}|\nabla f(y)|^2\,dy$, the infimum of which over all functions $f$ with the aforementioned properties, and support equal to a sphere of radius $R_n$ centered at the origin, is just the infimum of the spectrum of $-\Delta/2$ with Dirichlet conditions on the boundary of the sphere. We then choose $f$ to be equal to the ground-state of the aforementioned operator on the sphere of radius $R_n$, $$\begin{gathered} f(y) \equiv \begin{cases} \displaystyle\frac{\sin\left(\pi |y|/R_n\right)}{\sqrt{2\pi R_n}|y|}\qquad & |y| \leq R_n\\ 0 \qquad & |y| > R_n. \end{cases}\end{gathered}$$ Since $-\Delta f = \left(\pi^2/R_n^2\right) f$, we conclude that $\frac{1}{2}\int_{\mathbb{R}^3}|\nabla f_u|^2\,du$ is bounded below by $\pi^2/(2R_n^2)$ and that it can be made equal to this value. We furthermore pick $R_n$ to satisfy the relationship $2R_n < s_{n - 1}$. From Equation , if $\psi_{n, u}$ denotes the function $\psi\phi_n f_u$, we then obtain the formula $$\begin{gathered} (\psi_n, H_0^2\psi_n) = \int_{\mathbb{R}^3}(\psi_{n, u}, H_0^2\psi_{n, u})\,du - \frac{\pi^2}{2R_n^2}\|\psi_n\|^2. \label{equation.second.localization.performed}\end{gathered}$$ With the second localization, we have accomplished the following: the “second” electron has been pinned down to a ball in 3-space, and the “first” electron lies away from the second one in a shell that encloses the ball just mentioned, staying always at a certain distance from it, without intersecting it. The set where the electrons are may be described as $\Upsilon_{n, u} \equiv \left\{(x, y) \in \mathbb{R}^6 : s_{n - 1} \leq |x - y| \leq s_{n + 1}, |y - u| \leq R_n\right\}$, and what has been obtained with this is that the electrons have been effectively separated, as the following inclusion shows, $$\begin{gathered} \Upsilon_{n, u} \subset \left\{x \in \mathbb{R}^3 : s_{n - 1} - R_n \leq |x - u| \leq s_{n + 1} + R_n\right\}\times\left\{y \in \mathbb{R}^3 : |y - u| \leq R_n\right\}.\end{gathered}$$ Note that, since $2R_n < s_{n - 1}$, these two last subsets of $\mathbb{R}^3$ do not intersect, and so the cartesian product above can be embedded in $\mathbb{R}^3$ as the union of the two. If we now let $V_{n, u}$ be the separating potential corresponding to $\Upsilon_{n, u}$, namely $V_{n, u}(x, y) = 0$ if $(x, y) \in \Upsilon_{n, u}$ and $V_{n, u} = \infty$ otherwise, by noting that $V_{n, u}$ commutes with the potentials of $H_0$, we get the following Feynman-Kac formula, $$\begin{aligned} & \, (\psi_{n, u}, H_0\psi_{n, u})\nonumber\\ = & \left(\psi_{n, u}, \left(H_0 + V_{n, u}\right)\psi_{n, u}\right)\nonumber\\ \geq & \,\,\text{inf spec }(H_0 + V_{n, u})\|\psi_{n, u}\|^2\nonumber\\ = & -\lim_{R \to \infty}\lim_{T \to \infty}T^{-1}\log\left[\int_{B_R}\!\int_{B_R}\int\!\int\exp\left(\sum_{i, j = 1}^2\mathcal{A}_{i, j}^T\right)\right.\nonumber\\ &\qquad\qquad\qquad\qquad\qquad\times\left.\exp\left(-\int_0^T V_{n, u}(\omega_t^1, \omega_t^2)\,dt\right)\,dW_{x, x}^T(\omega^1)\,dW_{y, y}^T(\omega^2)\,dx\,dy\right]\|\psi_{n, u}\|^2, \label{equation.lower.bound.second.localization}\end{aligned}$$ where $\mathcal{A}_{i, j}^T$ is defined as $$\begin{gathered} \alpha\int_0^T\!\!\!\int_0^t\!\!\int_{|k| \leq \Lambda}\frac{e^{-|k|(t - s)}}{|k|}e^{-ik(\omega_t^i - \omega_s^j)}\,dk\,ds\,dt. \label{equation.action.piezo.electric.polaron}\end{gathered}$$ (See Subsection \[subsection.remark.functional.integrals\] of the introduction.) Note how $\exp\left(-\int_0^T V_{n, u}(\omega_t)\,dt\right)$ may be conveniently expressed as $\Omega_{n, u}^T(\omega)$, the function equal to 1 if the 6-dimensional Brownian path $\omega_t$ is completely contained in $\Upsilon_{n, u}$ for all times $0 \leq t \leq T$, and zero otherwise. Note also how can be computed explicitly, yielding $$\begin{aligned} 4\pi\alpha\int_0^T\!\!\!\int_0^t &\frac{1}{|\omega_t^i - \omega_s^j|^2 + (t - s)^2}\nonumber\\ &\times\left\{1 - e^{-\Lambda(t - s)}\left[\frac{t - s}{|\omega_t^i - \omega_s^j|}\sin\left(\Lambda|\omega_t^i - \omega_s^j|\right) + \cos\left(\Lambda|\omega_t^i - \omega_s^j|\right)\right]\right\}\,ds\,dt.\end{aligned}$$ It is easy to verify as well that the expression in braces is bounded below and above by 0 and 2, respectively. If now $\omega$ is a Brownian path such that $\Omega_{n, u}^T(\omega) = 1$, $$\begin{aligned} |\omega_t^1 - \omega_s^2| \geq & \, |\omega_t^1 - \omega_t^2| - |\omega_s^2 - \omega_t^2| \geq s_{n - 1} - 2R_n,\\ |\omega_t^2 - \omega_s^1| = |\omega_s^1 - \omega_t^2| \geq & \, |\omega_s^1 - \omega_s^2| - |\omega_t^2 - \omega_s^2| \geq s_{n - 1} - 2R_n,\end{aligned}$$ and we then have that $$\begin{aligned} & \int\!\!\!\int\exp\left(\sum_{i, j = 2}^2\mathcal{A}_{i, j}^T\right)\Omega_{n, u}^T(\omega)\,dW_{x, x}^T(\omega_1)\,dW_{y, y}^T(\omega_2)\nonumber\\ \leq & \, \int\!\!\!\int\exp\left(\mathcal{A}_{1, 1}^T + \mathcal{A}_{2, 2}^T\right)\exp\left(\int_0^T\!\!\!\int_0^t\frac{16\pi\alpha}{(s_{n - 1} - 2R_n)^2 + (t - s)^2}\,ds\,dt\right)\,dW_{x, x}^T(\omega_1)\,dW_{y, y}^T(\omega_2), \label{equation.functional.integral.estimate.piezo.electric.polaron}\end{aligned}$$ and since $$\begin{gathered} 16\pi\alpha\int_0^T\!\!\!\int_0^t\frac{\,ds\,dt}{(s_{n - 1} - 2R_n)^2 + (t - s)^2} \leq 16\pi\alpha T\int_0^{\infty}\frac{dx}{(s_{n - 1} - 2R_n)^2 + x^2} = \frac{8\pi^2\alpha T}{s_{n - 1} - 2R_n},\end{gathered}$$ it follows that, by using the independence of $\mathcal{A}_{1, 1}^T$ and $\mathcal{A}_{2, 2}^T$, is bounded above by $$\begin{gathered} \exp\left(\frac{8\pi^2\alpha T}{s_{n - 1} - 2R_n}\right)\int\exp\left(\mathcal{A}_{1, 1}^T\right) dW_{x, x}^T\int\exp\left(\mathcal{A}_{2, 2}^T\right) dW_{y, y}^T.\end{gathered}$$ From this and the estimate , we obtain that $$\begin{aligned} & \left(\psi_{n, u}, H_0\psi_{n, u}\right)\nonumber\\ \geq & \left\{-\lim_{R \to \infty}\lim_{T \to \infty}T^{-1}\log\left[\int_{B_R}\int\exp\left(\mathcal{A}_{1, 1}^T\right)dW_{x, x}^T\,dx\right]\right.\nonumber\\ & \,\,\,\, \left. - \lim_{R \to \infty}\lim_{T \to \infty}T^{-1}\log\left[\int_{B_R}\int\exp\left(\mathcal{A}_{2, 2}^T\right) dW_{y, y}^T\,dy\right] - \frac{8\pi^2\alpha}{s_{n - 1} - 2R_n}\right\}\|\psi_{n, u}\|^2\nonumber\\ = & \left(2E - \frac{8\pi^2\alpha}{s_{n - 1} - 2R_n}\right)\|\psi_{n, u}\|^2, \label{equation.estimate.second.region}\end{aligned}$$ where, as defined in the previous section, $E$ denotes the ground-state energy of the 1-electron piezoelectric polaron, $\text{inf spec }H^1$. (Right above Equation .) We then conclude, from Equation , $$\begin{gathered} (\psi_n, H_0\psi_n) \geq \left(2E - \frac{8\pi^2\alpha}{s_{n - 1} - 2R_n} - \frac{\pi^2}{2R_n^2}\right)\|\psi_n\|^2.\end{gathered}$$ By collecting terms, we conclude from this and the previous section that $$\begin{aligned} (\psi, H_A^2\psi) \geq & \left[2E - 8C_2(\Lambda)\alpha^2 - \frac{\pi^2}{2a_1^2} + \frac{A}{a_0 + a_1}\right]\|\psi_0\|^2\nonumber\\ & + \sum_{n = 1}^{\infty}\left[2E + \frac{A}{s_{n + 1}} - \frac{\pi^2}{2\min (a_{n + 1}, a_n)^2} - \frac{8\pi^2\alpha}{s_{n - 1} - 2R_n} - \frac{\pi^2}{2R_n^2}\right]\|\psi_n\|^2,\end{aligned}$$ and so no-binding will occur if each one of the terms in brackets is greater than or equal to $2E$, or $$\begin{gathered} A \geq \left[8C_2(\Lambda)(b_0 + b_1) + \frac{\pi^2(b_0 + b_1)}{2b_1^2}\right] \vee \bigvee_{n = 1}^{\infty}\left[\frac{\pi^2 t_{n + 1}}{2\min(b_{n + 1}, b_n)^2} + \frac{8\pi^2 t_{n + 1}}{t_{n - 1} - 2L_n} + \frac{\pi^2 t_{n + 1}}{2L_n^2}\right]\alpha, \label{equation.condition.for.no.binding}\end{gathered}$$ where we made the substitutions $b_i = a_i\alpha$, $t_i = s_i\alpha$ and $L_n = R_n\alpha$ in order to factor out $\alpha$, and $\vee$ denotes maximum. The expression to the right in is certainly not $\infty$ if the parameters are chosen accordingly. For instance, by picking $L_n = t_{n - 1}/4$ and $b_i = bl^i$, for some $l > 1$, the right side of is less than or equal to $$\begin{aligned} & \,\left[8C_2(\Lambda)b(1 + l) + \frac{\pi^2(1 + l)}{2bl^2}\right]\vee\bigvee_{n = 1}^{\infty}\left[\frac{\pi^2 l^{n + 2}}{2b(l - 1)l^{2n}} + \frac{16\pi^2 l^{n + 2}}{l^n - 1} + \frac{8\pi^2 (l - 1)l^{n + 2}}{b(l^{n} - 1)^2}\right]\alpha\nonumber\\ \leq & \, \left[8C_2(\Lambda)b(1 + l) + \frac{\pi^2(1 + l)}{2bl^2}\right]\vee\left[\frac{\pi^2l}{2b(l - 1)} + \frac{16\pi^2l^3}{l - 1} + \frac{8\pi^2l^3}{b(l - 1)}\right]\alpha.\end{aligned}$$ For a fixed value of $\Lambda$ one can in fact minimize the entire expression above, Equation , despite it being an infinite dimensional problem. This will be illustrated in the next section for the polaron model. In any case, the upshot is that there is an explicit function of $\Lambda$, which we shall call $C$, such that if $A \geq C(\Lambda)\alpha$, then no binding occurs. [No-Binding in the Optical Polaron and Nelson Models]{} \[section.polaron.nelson\] The same calculation as above can be carried out for the optical polaron model, and one can minimize completely the final result, the analog of Equation , since there is no dependence on $\Lambda$. Computations here are entirely similar to those from the previous section, and very few changes have to be made. In the following, $H_A^2$ will be the two-electron optical polaron model Hamiltonian with Coulomb strength $A$ (as before for the piezoelectric polaron), $H^1$ will be the 1-electron analog, and $E$ will be the ground-state energy of $H^1$. We will make use of two inequalities, that we will now briefly explain how to obtain. The first inequality is $\text{inf spec }H_0^2 \geq -2\alpha - 2\alpha^2$ [@BT; @B; @B2; @FLST], which appears explicitly right below [@BT Equation (3.13)], and can also be obtained by first replacing [@FLST Equation (1.20)] by the inequality $E \geq -\alpha - \alpha^2/4$, appearing below [@BT Equation (3.9)], and then using [@FLST Equation (2.26)]. The second inequality is $E \leq -\alpha$ [@F; @LLP; @LP; @G], which follows from the arguments in Appendix B, but applied to the optical polaron. We then have that Equation changes to $$\begin{gathered} (\psi_0, H_0^2\psi_0) \geq (-2\alpha - 2\alpha^2)\|\psi_0\|^2 \geq (2E - 2\alpha^2)\|\psi_0\|^2,\end{gathered}$$ whereas now becomes $$\begin{gathered} \left(\psi_{n, u}, H_0\psi_{n, u}\right) \geq \left(2E - \frac{\sqrt{2}\alpha}{s_{n - 1} - 2R_n}\right)\|\psi_{n, u}\|^2,\end{gathered}$$ which follows immediately from the argument in the previous section leading to , but applied now to the bipolaron action $$\begin{gathered} \sum_{i, j = 1}^2\int_0^T\!\!\!\int_0^t\frac{e^{-(t - s)}}{|X_t^i - X_s^j|}\,ds\,dt.\end{gathered}$$ From this, the no-binding condition (the analog of Equation ) becomes $$\begin{gathered} A \geq \left[2(b_0 + b_1) + \frac{\pi^2(b_0 + b_1)}{2b_1^2}\right]\vee\bigvee_{n = 1}^{\infty}\left[\frac{\pi^2 t_{n + 1}}{2\min(b_{n + 1}, b_n)^2} + \frac{\sqrt{2}t_{n + 1}}{t_{n - 1} - 2L_n} + \frac{\pi^2 t_{n + 1}}{2L_n^2}\right]\alpha. \label{equation.no.binding.condition.bipolaron}\end{gathered}$$ Since the expression involves only numbers, it is amenable to minimization. Even though one can eliminate the variable $L_n$ by solving a cubic equation (which corresponds to optimizing the two last summands in the second bracket in ), the computations involved in the elimination are so cumbersome that we will just content ourselves with simplifying the minimization problem by rescaling $x_n \equiv 2L_n/t_{n - 1}$, which significantly reduces the numerical work involved. We are led to minimizing $F : (0, \infty)^{\mathbb{N}}\times (0, 1)^{\mathbb{N}} \to (0, \infty)$, defined as $$\begin{aligned} & \, F((b_0, b_1, b_2, \ldots), (x_1, x_2, x_3, \ldots))\nonumber\\ = & \,\left[2(b_0 + b_1) + \frac{\pi^2(b_0 + b_1)}{2b_1^2}\right]\vee\bigvee_{n = 1}^{\infty}\left[\frac{\pi^2 t_{n + 1}}{2\min(b_{n + 1}, b_n)^2} + \frac{\sqrt{2}t_{n + 1}}{t_{n - 1}}\left(\frac{1}{1 - x_n} + \frac{\sqrt{2}\pi^2}{t_{n - 1}x_n^2}\right)\right]\nonumber\\ \equiv & \bigvee_{n = 0}^{\infty}F_n. \label{equation.definition.F}\end{aligned}$$ The minimization of $F$, in principle an infinite-dimensional problem, is much simpler than it seems, since it can be reduced to a low-dimensional one. Indeed, consider the truncated function $F_0\vee F_1 : (0, \infty)^3 \times (0, 1) \to (0, \infty)$ given by the maximum of the first two terms, that is $$\begin{aligned} F_0\vee F_1((b_0, b_1, b_2), x) = \left[2(b_0 + b_1) + \frac{\pi^2(b_0 + b_1)}{2b_1^2}\right]\vee\left[\frac{\pi^2 t_{2}}{2\min(b_{2}, b_1)^2} + \frac{\sqrt{2}t_{2}}{t_{0}}\left(\frac{1}{1 - x} + \frac{\sqrt{2}\pi^2}{t_{0}x^2}\right)\right].\end{aligned}$$ $F_0\vee F_1$ is now so simple that it can be minimized directly through numerical optimization. We get that its minimum is smaller than 25.9 when the parameters $b_0 = 7.27, b_1 = b_2 = 3.44, x = 0.702$ are chosen. If we now pick $b_n = (n - 1)b_2 = (n - 1)\times 3.44$ for $n \geq 3$ and $x_n = x = 0.702$ for all $n \geq 1$, it is easy to show that $F_{n + 1} \leq F_n$ for all $n \geq 1$. In this way we have found that the minimum of the expression is less than 25.9. In order to compare this with previous results in [@FLST; @BB], we ought to multiply by $\sqrt{2}$, as in those works the Laplacian was not divided by 2, and by doing so we get a number smaller than 36.7. This is a significant improvement over the previous results of 52.1 [@BB] and 53.2 [@FLST]: a reduction of more than 29.6%. We would like to remark that the partitions considered here have been indeed fully optimized: one may think, for instance, of taking not bumps in the first partition, but pills (meaning functions that are part sine, part straight line, part cosine); however, it is easy to see that one gets the optimal answer when all the straight-line segments are collapsed into a point, except for the first one. This is why we considered just one pill and let the other functions be bumps instead. We close the main body of the present article by briefly commenting on what happens in the massless Nelson model case. A family of lower bounds was provided for that model in [@B], but here we will pick just one of them. (One could certainly refine the following argument, but here we are mostly interested in illustrating a point, and not so much in sharpness.) For $N = 2$, by picking $\theta = 3/2$, we get, from (2.36) in [@B], $$\begin{aligned} E_{\alpha}^{\Lambda, 2} + Q_{\alpha}^{\Lambda, 2} \geq - D_1\alpha^2 - D_2\alpha^8,\end{aligned}$$ where $D_1$ and $D_2$ are positive constants independent of $\Lambda$, $E_{\alpha}^{\Lambda, 2}$ is the ground-state energy of the 2-particle massless Nelson model with cutoff $\Lambda$, and $Q_{\alpha}^{\Lambda, 2}$ is a renormalizing term, defined earlier, in expression , with $N = 2$. (The term $\alpha^8$ is most likely spurious – see [@B].) In any case, since we know that $E_{\alpha}^{\Lambda, 1} + Q_{\alpha}^{\Lambda, 1} \leq 0$, where $E_{\alpha}^{\Lambda, 1}$ and $Q_{\alpha}^{\Lambda, 1}$ are the 1-particle analogs of $E_{\alpha}^{\Lambda, 2}$ and $Q_{\alpha}^{\Lambda, 2}$ (see Appendix B), all the steps to conclude no-binding are identical to those for the piezoelectric polaron, except that now the condition reads as $$\begin{gathered} A \geq \left[D_1(b_0 + b_1) + D_2(b_0 + b_1)\alpha^6 + \frac{\pi^2(b_0 + b_1)}{2b_1^2}\right]\vee\bigvee_{n = 1}^{\infty}\left[\frac{\pi^2 t_{n + 1}}{2\min(b_{n + 1}, b_n)^2} + \frac{8\pi^2 t_{n + 1}}{t_{n - 1} - 2L_n} + \frac{\pi^2 t_{n + 1}}{2L_n^2}\right]\alpha, \label{equation.condition.no.binding.nelson}\end{gathered}$$ and so, as can be seen, even though a no-binding condition is obtained, it is not linear in $\alpha$. From discussions appearing in [@B], $D_2$ can probably be set equal to zero. If that is the case, then indeed one would get a condition identical to that for the piezoelectric polaron (even better, since it would not diverge with $\Lambda$). One may as well say that, after all, $\alpha$ ought to be in a certain range $[0, \beta]$, and by bounding $\alpha \leq \beta$, one could eliminate the higher order term in $\alpha$, and this would lead to a linear relationship $A \geq C\alpha$, as expected. As said earlier, this is just an illustration, and many other no-binding conditions may be obtained from the general bound [@B Equation (2.36)]. As a final comment, when we say that no-binding holds for both the renormalized and unrenormalized theories, we mean this: even though in principle we have proven no-binding only for the unrenormalized Nelson Hamiltonian, the corresponding result for the renormalized theory follows immediately, as $E_{\alpha}^{\Lambda, 2} = 2E_{\alpha}^{\Lambda, 1}$ implies $$\begin{gathered} E_{\alpha}^{\Lambda, 2} + Q_{\alpha}^{\Lambda, 2} = 2\left(E_{\alpha}^{\Lambda, 1} + Q_{\alpha}^{\Lambda, 1}\right), \label{equation.energy.renormalization.nelson.two.particles}\end{gathered}$$ and the no-binding result in this case is obtained by taking $\Lambda \to \infty$. (See the discussion preceding [@GM Equation (1.2)] for technical remarks concerning this last limiting step.) \*[Appendix A: The Clark-Ocone Formula and its Use in the Obtention of Lower Bounds in Non-relativistic QFT]{} Throughout this work, we made use of lower bounds for the spectrum of each one of the models involved. These bounds were made possible thanks to a technique that was presented in an article written by the author and L.E. Thomas [@BT], which we would like to briefly sketch here. The main idea goes along the following lines. First, we fix a model from non-relativistic quantum field theory (for example, any of the three mentioned in this paper). The number of particles involved or the addition of repulsion between them are not important factors here; the argument is fairly general. We let $H$ be the Hamiltonain of the model chosen, and $N$ be the number of particles. If one can integrate the quantum field variables, which is typically the case, one will be able to find a Feynman-Kac-like formula $$\begin{gathered} \inf\text{spec } H \geq -\limsup_{T \to \infty}T^{-1}\log\left\{\sup_{x \in \mathbb{R}^{3N}}E^x\left[\exp(\mathcal{A}_T)\right]\right\},\end{gathered}$$ for some functional $\mathcal{A}_T$ of $3N$-dimensional Brownian paths on $[0, T]$. ($E^x$ means expectation with respect to Brownian motion starting at $x$.) The Clark-Ocone formula then states that $$\begin{gathered} \mathcal{A}_T = E^x(\mathcal{A}_T) + \int_0^T\rho_t\, dX_t,\end{gathered}$$ for some $\mathbb{R}^{3N}$-valued stochastic process $\rho$, and the integral appearing is Itô. A supermartingale estimate allows one then to get the following bound: $$\begin{gathered} E^x\left[\exp(\mathcal{A}_T)\right] \leq \exp\left[E^x\left(\mathcal{A}_T\right)\right]E^x\left[\exp\left(\frac{p^2}{2(p - 1)}\int_0^T\rho_t^2\,dt\right)\right]^{1 - 1/p} \label{equation.supermartingale.estimate}\end{gathered}$$ for all $p > 1$. Upper bounds on both terms inside exponentials on the right side of , with the right growth rate in $T$ (linear or sublinear), and uniform in $x$, allow one then to obtain a lower bound on the spectrum of $H$. This is the essence of the method. We have intentionally skipped many technicalities in the description just given. For the full details, the reader is referred to references [@BT] (the paper of the author and Thomas), [@B] (a lower bound on the Nelson model), and [@B2] (the Ph.D. thesis of the author, where, in particular, additional discussions appear). \*[Appendix B: Proof of Upper and Lower Bounds for the Piezoelectric Polaron]{} \[appendix.upper.lower.bounds.piezoelectric.polaron\] In the present appendix we will prove the upper and lower bounds stated above, in Section \[section.partition\], for the ground-state energy of the $2$-electron piezoelectric polaron. We will actually do it for any number of particles $N$. It relies heavily on a recent paper of the author [@B], in which lower bounds for the renormalized Nelson model were found, using functional-integral methods developed by the author and L.E. Thomas in [@BT]. We start from an expression, [@B Equation (2.18)], whose time-integral from 0 to $T$ leads eventually to a lower bound on the ground-state energy of the Nelson model, when interpreted as an action. It is given by $$\begin{gathered} 256\pi^2\alpha^2\sum_{m = 1}^N\left(\sum_{n = 1}^N\mathcal{C}_{m, n}\right)^2,\end{gathered}$$ for some positive $\mathcal{C}_{m, n}$’s that can be bounded from above as $$\begin{aligned} \mathcal{C}_{m, n} \leq \, & \int_0^{\Lambda}\!\!\!\int_0^u\frac{1 - e^{-(r + r^2/2)(T - u)}}{1 + r/2}re^{-r(u - s)}|\varphi(r|X_u^m - X_s^n + x^m - x^n|)|\,ds\,dr\nonumber\\ & \, + \int_0^{\Lambda}\!\!\!\int_u^T\!\!\int_u^t e^{-r(t - s)}e^{-r^2(t - u)/2}e^{-r^2(s - u)/2}|\varphi(r|X_u^m - X_u^n + x^m - x^n|)|r^2\,ds\,dt\,dr\nonumber\\ \equiv \, & \mathcal{D}_{m, n} + \mathcal{E}_{m, n},\end{aligned}$$ where the vectors $X^n$ are independent 3D Brownian motions, and $\varphi(x)$ is the function $(\sin x - x\cos x)/x^2$. It was shown in [@B Lemma 2.2] that $\mathcal{E}_{m, n}$ is bounded above by $2^{-1}(1 - \delta_{nm})\|\varphi(x)/x\|_1$. A crude estimate on $\mathcal{D}$ allows us to bound it from above as $$\begin{aligned} & \int_0^{\Lambda}\!\!\!\int_0^u\frac{re^{-r(u - s)}}{1 + r/2}|\varphi(r|X_u^m - X_s^n + x^m - x^n|)|\,ds\,dr \leq \|\varphi\|_{\infty}\int_0^{\Lambda}\!\!\!\int_0^u\frac{re^{-r(u - s)}}{1 + r/2}\,ds\,dr\nonumber\\ \leq & \, \|\varphi\|_{\infty}\int_0^{\Lambda}\frac{dr}{1 + r/2} = 2\|\varphi\|_{\infty}\log(1 + \Lambda/2).\end{aligned}$$ $\mathcal{C}_{m, n}$ is then bounded above by a logarithmically diverging function of $\Lambda$. It follows then from the analysis in [@B Section 2] that the ground-state energy of the piezo-electric polaron is bounded below by $$\begin{aligned} & -8\pi\alpha N\log(1 + \Lambda/2) - 32\pi^2\alpha^2 N^3\left[\|\varphi(x)/x\|_1 + 4\|\varphi\|_{\infty}\log(1 + \Lambda/2)\right]^2\nonumber\\ \equiv & -C_1(\Lambda)\alpha N - C_2(\Lambda)\alpha^2 N^3. \label{definition.C1}\end{aligned}$$ An upper bound for the 1-particle piezoelectric polaron, good enough for our purposes here, follows immediately from certain simplifications. First, we note that in the 1-particle case the starting and ending position of the Brownian path $\omega$ does not appear in the action $$\begin{gathered} \alpha\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}e^{-ik(\omega_t - \omega_s)}|k|^{-1}\,ds\,dt\,dk\end{gathered}$$ (see Equation ), due to a cancellation in the difference of the Brownian path evaluated at different times. This fact allows us to write the ground-state energy of the 1-particle piezo-electric polaron as $$\begin{gathered} -\lim_{T \to \infty}T^{-1}\log\left[\int\exp\left(\alpha\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}e^{-ik(\omega_t - \omega_s)}|k|^{-1}\,ds\,dt\,dk\right)dW_{0, 0}^T(\omega)\right]. \label{equation.piezoelectric.polaron.one.electron}\end{gathered}$$ Equation can be derived by adapting the analysis leading to [@R Equation (5.3.48)] to the piezoelectric polaron. Furthermore, by following the arguments in [@DV Section 3], and making the necessary changes for the piezoelectric polaron, Brownian motion tied to 0 at both ends may be replaced by standard Brownian motion starting at 0, since when $T$ is large the terminal condition for a Brownian path $\omega$ is essentially irrelevant. With these simplifications, we obtain that the ground-state energy of the piezoelectric polaron can be written as $$\begin{gathered} -\lim_{T \to \infty}T^{-1}\log\left\{E\left[\exp\left(\alpha\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}e^{-ik(X_t - X_s)}|k|^{-1}\,ds\,dt\,dk\right)\right]\right\}. \label{equation.piezoelectric.polaron.one.electron.simplified}\end{gathered}$$ Now, from Jensen’s inequality, we get that $$\begin{aligned} & E\left[\exp\left(\alpha\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}e^{-ik(X_t - X_s)}|k|^{-1}\,ds\,dt\,dk\right)\right]\nonumber\\ \geq & \exp\left(\alpha\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}|k|^{-1}E\left(e^{-ik(X_t - X_s)}\right)\,ds\,dt\,dk\right)\nonumber\\ = & \exp\left(\alpha\int\!\!\!\int_0^T\!\!\!\int_0^t\chi_{\Lambda}(k)e^{-|k|(t - s)}|k|^{-1}e^{-k^2(t - s)/2}ds\,dt\,dk\right)\nonumber\\ = & \exp\left[C_1(\Lambda)\alpha T + o(T)\right],\end{aligned}$$ from which the upper bound $-C_1(\Lambda)\alpha$ for the piezoelectric polaron is obtained. (The last equality follows from Equation .) Both inequalities, the lower bound for $N = 1$ and the upper bound $-C_1(\Lambda)\alpha$ we just derived, agree for small $\alpha$ at the result one gets from second-order perturbation theory [@WGT]. Our lower bound for $N = 1$ has the advantage over a previous lower bound for the piezoelectric polaron in [@TW] that an explicit answer is obtained, valid for all values of $\alpha$. In [@TW] the lower bound involves quantities that simplify only in limiting regimes of $\alpha$. We would like to finish this appendix by pointing out a curious fact: One of the lower bounds for the piezoelectric polaron in [@TW] contains a term proportional to $\alpha\log\alpha$ that is not divergent in $\Lambda$, which is obtained under certain assumptions on $\alpha$. A term just like that was obtained in a lower bound in [@B] under a certain regime of $\alpha$, but squared. This seems to us more like a coincidence than an actual connection, since, as explained in [@B], our logarithmically divergent term in $\alpha$ is probably not there really. \*[Appendix C: Note on the Retarded Nature of the Polaron and Nelson Actions]{} \[appendix.second\] We would like to close the present article by addressing two mistakes made in Chapter 5 of the Ph.D. thesis of the author [@B2]. As the present article is based partly on that chapter from the thesis, we think it is relevant to resolve the problems here. First, in [@B2 Section 5.1] we localized the six-dimensional vector $(x, y)$, representing the positions of two electrons in 3-space, in the region $\Omega \equiv \left\{(x, y) : |x - y| \geq d\right\}$. This localization should have the effect of keeping the two electrons far from each other; however, this is not what actually happens, at least not if the electrons interact with each other through their coupling to a polar crystal. The point is that the electrons do not attract each other instantaneously; rather, they attract their entire past histories in space, with different weights, with the remote past being less relevant than the recent times. The problem then is that merely localizing $(x, y)$ in $\Omega$ will mean that a Brownian path $(X_t, Y_t)$, representing a potential trajectory of the particles, satisfies $|X_t - Y_t| \geq d$; but it will not necessarily mean that $|X_t - Y_s| \geq d$ for all $t$ and $s$. The mistake made in the thesis was to assume that $|X_t - Y_s| \geq d$ held for all $t$ and $s$ just by localizing in $\Omega$. One further localization was missing, and is the one we added in this article, where we pinned one of the electrons, in which case the entire trajectories of the particles are now well-separated. The other mistake was to neglect the factor $1/2$ in front of the localization error, arising in the IMS formula in [@B2 Equation (5.5)], due to the use of the operator $p^2/2$, instead of $p^2$. The errors combined yield a no-binding condition for the optical bipolaron given by $A \geq 17.8\alpha$, which, even though might well be true, was derived using an argument that was not completely correct, as we have just seen. [0]{} R.D. Benguria, G.A. Bley, Improved results on the no-binding of bipolarons, J. Phys. A: Math. Theor. 45, 045205 (2012). G.A. Bley, A Lower Bound on the Renormalized Nelson Model, J. Math. Phys. 59, 061901 (2018). G.A. Bley, Estimates on Functional Integrals of Non-Relativistic Quantum Field Theory, with Applications to the Nelson and Polaron Models, Ph.D. thesis, University of Virginia Library (2016). G.A. Bley, L.E. Thomas, Estimates on Functional Integrals of Quantum Mechanics and Non-Relativistic Quantum Field Theory, Comm. Math. Phys. 350, 79 (2017). H.L. Cycon, R.G. Froese, W. Kirsch, B. Simon, Schrödinger Operators, with Applications to Quantum Mechanics and Global Geometry, Springer (2008). M.D. Donsker, S.R.S. Varadhan, Asymptotics for the Polaron, Comm. Pure Appl. Math. 36, 505 (1983). R.P. Feynman, Mathematical Formulation of the Quantum Theory of Electromagnetic Interaction, Phys. Rev. 80, 440 (1950). R.P. Feynman, Slow Electrons in a Polar Crystal, Phys. Rev. 97, 660 (1955). R.L. Frank, E.H. Lieb, R. Seiringer, L.E. Thomas, Stability and Absence of Binding for Multi-Polaron Systems, Publ. Math. l’HÉS 113, 39 (2011). H. Fröhlich, Electrons in lattice fields, Adv. Phys. 3, 325 (1954). H. Fröhlich, Theory of Electrical Breakdown in Ionic Crystals, Proc. R. Soc. Lond. A, 160, 230 (1937). M. Griesemer, J.S. Møller, Bounds on the Minimal Energy of Translation Invariant $N$-Polaron Systems, Comm. Math. Phys. 297, 283 (2010). M. Gurari, Self-energy of slow electrons in polar materials, Phil. Mag. Ser. 7, 44, 329 (1953). E. Haga, Note on the Slow Electrons in a Polary Crystal, Prog. Theor. Phys, 11, 449 (1954). A.R. Hutson, Piezoelectric Scattering and Phonon Drag in ZnO and CdS, J. Appl. Phys. 32, 2287 (1961). D.M. Larsen, Cyclotron Resonance of Piezoelectric Polarons, Phys. Rev. 142, 428 (1966). T.-D. Lee, F.E. Low, D. Pines, The Motion of Slow Electrons in a Polar Crystal, Phys. Rev. 90, 297 (1953). T.-D. Lee, D. Pines, The Motion of Slow Electrons in Polar Crystals, Phys. Rev. 88, 960 (1952). E.H. Lieb, R. Seiringer, The Stability of Matter in Quantum Mechanics, Cambridge University Press (2010). E.H. Lieb, K. Yamazaki, Ground-State Energy and Effective Mass of the Polaron, Phys. Rev. 111, 728 (1958). J. Lörinczi, R.A. Minlos, H. Spohn, The Infrared Behaviour in Nelson’s Model of a Quantum Particle Coupled to a Massless Scalar Field, Ann. Henri Poincaré, 269-295 (2002). G.D. Mahan, J.J. Hopfield, Piezoelectric polaron effects in CdS, Phys. Rev. Lett. 12, 241 (1964). E. Nelson, Interaction of nonrelativistic particles with a quantized scalar field, J. Math. Phys. 5, 1190 (1964). E. Nelson, Schrödinger particles interacting with a quantized scalar field, in Analysis in Function Space: Proceedings of a conference on the theory and applications of analysis function space, MIT Press (1964). G. Roepstorff, Path Integral Approach to Quantum Physics, Springer (1996). M. Rona, G. Whitfield, Energy-versus-Momentum Relation for the Piezoelectric Polaron, Phys. Rev. B 7, 2727 (1973). J. Thomchick, G. Whitfield, Lower bound for the piezoelectric polaron, Phys. Rev. B 9, 1506 (1974). S. Tomonaga, On the Effect of the Field Reactions on the Interaction of Mesotrons and Nuclear Particles. III., Prog. Theor. Phys. 2, 6 (1947). G. Whitfield, J. Gerstner, K. Tharmalingam, Motion of the Piezoelectric Polaron at Zero Temperature, Phys. Rev. 165, 993 (1968). G. Whitfield, P.M. Platzman, Simultaneous Strong and Weak Coupling in the Piezoelectric Polaron, Phys. Rev. B 6, 3987 (1972).

Predictive factors of hospitalization for acute exacerbation in a series of 64 patients with chronic obstructive pulmonary disease. Hospitalizations for acute exacerbation in patients with chronic obstructive pulmonary disease (COPD) have a great impact on health care expenditure. The aim of this study was to look at predictive factors of hospitalization for acute exacerbation in a group of patients with moderate to severe COPD. During the year 1994, we included 64 patients with COPD in this study. At inclusion, the patients being in a stable state, we performed a complete evaluation of their clinical, spirometric, gasometric, and pulmonary hemodynamic characteristics. All patients were followed during a period of at least 2.5 yr. We recorded the intervals free of hospitalization for exacerbation and realized an analysis of the proportional hazards not to be hospitalized using the Kaplan-Meier method. Univariate analysis using the log-rank test showed that the risk of being hospitalized was significantly increased in patients with COPD with a low body mass index (BMI <= 20 kg/m2, p = 0.015) and in patients with a limited 6-min walk distance (<= 367 m, p = 0. 045). But above all, the risk of hospitalization for acute exacerbation was significantly increased by gas exchange impairment and pulmonary hemodynamic worsening: PaO2 <= 65 mm Hg versus PaO2 > 65 mm Hg, p = 0.005; PaCO2 > 44 mm Hg versus PaCO2 <= 44 mm Hg, p = 0.005; and mean pulmonary artery pressure ( Ppa) at rest > 18 mm Hg versus Ppa <= 18 mm Hg, p = 0.0008. Neither age, nor the association of one or more comorbidities with COPD, nor the smoking habits had a significant impact on the risk of hospitalization in our study. Multivariate analysis showed that only PaCO2 and Ppa were independently related to the risk of hospitalization for acute exacerbation of COPD. We conclude that chronic hypercapnic respiratory insufficiency and pulmonary hypertension are predictive factors of hospitalization for acute exacerbation in COPD patients.

Q: Visualforce dynamic sObject table column value formatting I want to allow my team to display some leads and tasks (and any known object) with custom conditions and display all the data on only one screen. I made some custom objects "blocks" containing SOQL elements : base query ; ex: select * from lead where createdDate = TODAY headers ; ex: Name, CreatedDate, id I have a controller that get all those blocks then get all the records in wrappers with a list of headers and a list of those sobjects. Then I have a visualforce page that use repeat vf command : repeat on all wrappers to create tables repeat on all headers to create the table header then fill the rows & 1st column is a link to the record This way my team can work on only one screen with data we want. But I would like to be able to format the output value, depending on the type. Obviously for dates and datetimes. I am just thinking about one thing : I could use a map of headers instead of a list, something like: key = header, value = type. GetHeaders => return List<String>(headers.keySet()) So in my columns i could check the type to use some formated output values. Edit with code : Controller with an inner class containing headers (=fields) and a list of records. Some queries are created from values contained in a custom object TodoBlock__c, then they are used to fill the list "records". public with sharing class ToDoBlockController{ public TodoBlock todoBlock {get;set;} public void initComponent(){ // init todoblock } public class TodoBlock{ // input public String name {get;set;} public String query {get;set;} public List<String> headers {get;set;} public Integer queryLimit {get;set;} // calculation public List<SObject> records {get;set;} public Integer count {get;set;} public String objType {get;set;} // modification public String sortColumn {get{ return sortColumn==null ? headers[0] : sortColumn; } set;} public boolean isAscSort {get{ return isAscSort==null ? true : isAscSort; } set;} public TodoBlock(TodoBlock__c record, Integer queryLimit, String sortColumn, String isAscSortStr){ // attributes initialization } public void runQueries(){ // queries records } } } Visualforce component containing the table. I am having trouble displaying it correctly, anyway important part is under the 2 comments. Here i would like to format the value depending on its type. Value is record[header] result. Type can be anything. I see 2 option : I can get type from VF side => i create tags with conditions in rerender attribute I need to store it somewhere in the controller => instead of String[] header I shoud use Map{String=>String} where key is header/field name and value is type 0}"> {!$ObjectType[todoBlock.objType].fields[header].label} rendered="{!todoBlock.sortColumn = header}" value="/s.gif"/> <!-- 1st col = link --> <apex:outputLink value="/{!rec.Id}" target="_blank" rendered="{!header == todoBlock.headers[0]}">{!rec[header]}</apex:outputLink> <!-- other cols = normal --> <apex:outputLabel rendered="{!header != todoBlock.headers[0]}">{!rec[header]}</apex:outputLabel> </apex:column> </apex:repeat> </apex:pageBlockTable> </apex:pageBlockSection> A: So I made a Map fieldTypeMap and a component to handle the date/datetime format Here is what I did, maybe it will be usefull for someone else. Controller I added the map as an attribute of my inner class into the controller: // header/type mapping public Map<String,String> headerTypeMap {get;set;} I initialize it at the end of the constructor, thanks to this.headers (array of string header/field name), after the queries, like this: // calculation : runQueries(); // mapping this.headerTypeMap = new Map<String,String>(); for(String field : this.headers){ this.headerTypeMap.put( field, Schema.getGlobalDescribe().get(objType).getDescribe().fields.getMap().get(field).getDescribe().getType()+'' ); } Visualforce component Because I often need to format date and datetime I thought it could be a good idea to create a formating component So I made a quick and dirty one: <apex:component controller="FormatedValueController"> <apex:attribute name="dateValue" type="Date" assignTo="{!inputDateValue}" description="input value to formatTodoBlock__c record that contains data" /> <apex:attribute name="datetimeValue" type="Date" assignTo="{!inputDateTimeValue}" description="input value to formatTodoBlock__c record that contains data" /> {!formatedvalue} Controller: public class FormatedValueController { public Date inputDateValue {get;set;} public Datetime inputDateTimeValue {get;set;} public String getFormatedValue(){ String formatedValue = ''; formatedValue += inputDateValue == null ? '' : inputDateValue.format(); formatedValue += inputDateTimeValue == null ? '' : inputDateTimeValue.format(); return formatedValue; } } And a quick&dirty test class too (for code coverage only): @isTest global class FormatedValueController_test{ static testMethod void FormatedValueController() { FormatedValueController c = new FormatedValueController(); Test.startTest (); c.getFormatedValue(); Test.stopTest(); } } 100% you-hou ;) And finally ... Main Component Oddly I need to use "{!todoBlock.headerTypeMap[header]}" everywhere, where todoBlock is the instance of my innerclass and header the var of repeat on headers attribute (table with a dynamic number of columns). I wanted to use an apex variable for each header, kind of: <apex:variable var="type" value="{!todoBlock.headerTypeMap[header]}" /> but for an unknown reason it just display the last header value in every loop. For example if I have DATE, DATETIME, STRING, it displays STRING, STRING, STRING. Not a big deal to use the full code, it is just less readable. So here it is : <apex:outputLabel rendered="{!todoBlock.headerTypeMap[header]=='DATETIME'}"> <c:FormatedValue datetimeValue="{!rec[header]}"/> </apex:outputLabel> <apex:outputLabel rendered="{!todoBlock.headerTypeMap[header]=='DATE'}"> <c:FormatedValue dateValue="{!rec[header]}"/> </apex:outputLabel> <apex:outputLabel rendered="{!NOT(AND(todoBlock.headerTypeMap[header]=='DATETIME',todoBlock.headerTypeMap[header]=='DATE'))}"> {!rec[header]} </apex:outputLabel>

Q: read an Object(customized) from ObjectInputStream So, I don't know why the Client part of my project give me this type of error Exception in thread "main" java.lang.ClassNotFoundException: Mining.FrequentPatternMiner at java.net.URLClassLoader$1.run(Unknown Source) at java.net.URLClassLoader$1.run(Unknown Source) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(Unknown Source) at java.lang.ClassLoader.loadClass(Unknown Source) at sun.misc.Launcher$AppClassLoader.loadClass(Unknown Source) at java.lang.ClassLoader.loadClass(Unknown Source) at java.lang.Class.forName0(Native Method) at java.lang.Class.forName(Unknown Source) at java.io.ObjectInputStream.resolveClass(Unknown Source) at java.io.ObjectInputStream.readNonProxyDesc(Unknown Source) at java.io.ObjectInputStream.readClassDesc(Unknown Source) at java.io.ObjectInputStream.readOrdinaryObject(Unknown Source) at java.io.ObjectInputStream.readObject0(Unknown Source) at java.io.ObjectInputStream.readObject(Unknown Source) at JabberClient.main(JabberClient.java:81) In the Server part, I cast the FrequentPatternMiner variable and then i give it to the ObjectOutputStream ObjectOutputStream out = new ObjectOutputStream(socket.getOutputStream()); FrequentPatternMiner fpMiner=new FrequentPatternMiner(dataTarget, minsup); fpMiner.salva("FP_"+nameFile+"_minSup"+minsup+".dat"); System.out.println("Frequent Patterns \n"+fpMiner); out.flush(); out.writeObject((Object)fpMiner); In the Client part, i do this ObjectOutputStream out = new ObjectOutputStream(socket.getOutputStream()); ObjectInputStream in = new ObjectInputStream(socket.getInputStream()); Object fpMiner=in.readObject(); (((ObjectInput)in).readObject()); System.out.println(fpMiner); How would I fix my code? Can you help me? A: The code is correct, but your premise isn't. You've said, that the class "FrequentPatternMiner must be unknown for the client". With that premise you can't serialize the class as you did, because serialization only transfers the data of the object and not it's implementation. You might want to look into DataTransferObjects (which has to be known on both client and server) or use a simple array to transfer the object. Example using a simple array as "DTO" Server: ObjectOutputStream out = new ObjectOutputStream(socket.getOutputStream()); // The following line assumes that dataTarget and minsup are types // that are serializable and known to the client Object[] objArray = new Object[] { dataTarget, minsup }; out.flush(); out.writeObject(objArray); Client: ObjectOutputStream out = new ObjectOutputStream(socket.getOutputStream()); ObjectInputStream in = new ObjectInputStream(socket.getInputStream()); Object[] objArray = (Object[])in.readObject(); System.out.println(objArray); // FrequentPatternMiner must still known to the client, if you need more than // the constructor arguments (like methods of the FrequentPatternMiner) Object. FrequentPatternMiner fpMiner=new FrequentPatternMiner(objArray[0], objArray[1]); Further Idea If you don't want that FrequentPatternMiner implementation/class is known to the client, you can try "Remoting" or "Remote Procedure Calls" (RPC). This is an advanced subject and there are a lot of libraries out there (and platforms) that provide this functionallity. They do basically this: You need an Interface for the Class on the client (like interface IPatternMiner { void doMine() } You connect server and client (depends on the library on how to do this) and obtain an instance of IPatternMiner You call a method on the interface and the implementation gets executed on the server (with the parameters pased in from the client). Note that file operations write on the file system on the server

Pizzi quits as Chile coach after WC elimination SAO PAULO, Oct 12: Juan Antonio Pizzi will not be looking for a new contract as Chile coach after the Copa America champions failed to qualify for next year's World Cup in Russia, reports AP. Pizzi, who is out of contract following Tuesday's 3-0 loss to Brazil in Sao Paulo, told a news conference that he took the blame for Chile's elimination from the qualifying competition. "My future? My contract ends in this situation and it seems to me, although it is the responsibility and decision of the (Chile football association) executives, that we must analyze what they want for the team and try to choose the best option," the Argentine told a news conference. "I am ruling myself out of those options." However, the head of Chile's association, Arturo Salah, said later that it was too early to decide Pizzi's future. "We need to decide this with a cool head. We are all responsible for the elimination. The rest will be part of a calm analysis," Salah said. Midfielder Gary Medel said Pizzi told the players that he was leaving in the changing room of the Allianz Parque stadium in Sao Paulo. "It was very hard for all of us. The coach that arrives has to be willing to achieve greatness," Medel said. Pizzi took over last year, replacing Jorge Sampaoli, who is now Argentina's coach. Under Pizzi, Chile won the 2016 Copa America Centenario and earlier this year reached the final of the Confederations Cup, losing to World Cup holder Germany. Brazil topped the South American qualifying standings with 41 points, while Chile ended in sixth with 26. Goalkeeper Claudio Bravo also said he was sorry for Pizzi's decision, and blamed "a lot of situations that will be discussed internally" for Chile's failure to qualify.

Xbox Games with Gold for March 2019 feature Star Wars: Republic Commando Today, Microsoft announced March's free Games with Gold for Xbox One and Xbox 360 owners. Starting on March 1, Adventure Time: Pirates of the Enchiridion and Star Wars: Republic Commando will be free with the subscription. Then, on March 16, Plants vs. Zombies: Garden Warfare 2 and Metal Gear Rising: Revengeance can be downloaded at no cost. You need an active Xbox Live membership to play the Xbox One games, but the original Xbox and Xbox 360 titles are yours to keep after you redeem them once. It doesn't matter if you're still an Xbox Live Gold subscriber. Adventrue Time: Pirates of the Enchiridion Adventure Time: Pirates of the Enchiridion is based on the popular Cartoon Network series and is surprisingly an open-world adventure rendered in a unique way. Just like South Park: The Stick of Truth, it looks like you're playing through an animated series. Star Wars: Republic Commando Star Wars: Republic Commando is one of the best first-person shooters which was an original Xbox console exclusive. The game still looks great even to this day, and if you're in shock as to how terrible EA's management of the franchise has been, then you're in luck! Star Wars: Republic Commando introduced many important new features which revolutionized the genre. Plants vs. Zombies: Garden Warfare 2 Plants vs. Zombies: Garden Warfare 2 is a lot of fun with friends or family. It's a third-person shooter but you can play as either plants or zombies. The visuals look like a Pixar film and there is a lot of content. I hope a sequel is announced soon! Metal Gear Rising: Revengeance Lastly, Metal Gear Rising: Revengeance is a hack-and-slash experience from PlatinumGames, the makers of Bayonetta and the cancelled Scalebound. It forgoes stealth and focuses on brutal attacks. The change of pace works in the Metal Gear Solid Universe, and critics loved the experience when it launched a few years ago. Be sure to download all four of these games next month because many of them are great experiences. Out of all of these, we would recommend playing Star Wars: Republic Commando because it's an incredible title that holds up even to this day.

Enlarge Image Video screenshot by Anthony Domanico/CNET The cast and crew of "Star Trek Beyond" are channeling their inner Leonard Nimoys to encourage "Star Trek" fans to live long and donate. In the final week of the -- which is raising money for nine charities picked by the cast and crew -- Zachary Quinto and the rest of his Starship Enterprise crewmates posted a video tribute to Leonard Nimoy, who died in February. The clip, which you can watch below, features Quinto talking about how great a guy Nimoy was and the impact he had on the crew and "Star Trek" fans around the world. It also shows some of the cast and crew's favorite Nimoy moments from his work on previous "Star Trek" movies. The clip goes on to promote a charity near and dear to Nimoy -- St. Jude Children's Research Hospital, which is one of the nine beneficiaries of the Omaze campaign. In addition to the satisfaction that comes with supporting a worthy cause, the campaign will give one "Star Trek" fan the chance to be in the next film in the series, "Star Trek Beyond." If you'd like to be that fan, you have one week left to donate at least $10 (about £6, AU $14) to the campaign's nine charities and earn your chance to boldly go where no fan has gone before by winning a walk-on role in the "Star Trek Beyond" movie. You can learn more about the campaign and donate at the Omaze page. "Star Trek Beyond" will premiere in theaters in the US and UK on July 8, 2016. An Australian release date is not available at this time.

Enter the tracking number of items as received from the store of purchase to see when they were delivered to us. To track shipments that have shipped out from your warehouse to you, please first login to your account and use the order number to track. Track Shipment Enter the tracking number from your store of purchase to know if items your bought have been delivered to Shoptomydoor. Shoptomydoor Christmas Free Shipping CHRISTMAS SHOPPING It’s Christmas once again. It’s a time to share love and show care to your family and friends, so we are making this Christmas a memorable one for you and your family. Take advantage of USA Black Friday and Cyber Monday sales in USA to win big and you will be saving a lot of money on your Christmas shopping this season. WANT TO WIN CASH PRIZES THIS CHRISTMAS? Register at www.shoptomydoor.com to get free US & UK address and shop from any US online store. At the point of collecting/receiving your shipment, make a video or take a picture of your delivery with our delivery man. Post it on your social media page and tag us on Facebook: @shoptomydoor, Instagram or Twitter: @shop2mydoor. We will share, repost and retweet. Photo or video with the highest number of likes and share will win up to $1000. So, get your friends to like and share your photo or video from our page to win. (Minimum of 1,000 shares, the more shares your photo/video gets the higher your chance of winning $1,000). Spend from $500 to $20,000 to Win Free Shipping of Any Product or its Equivalent Box Size You win free ocean shipping of any one of the items above or 1 box size for only 1 item/product (for example if you want a box free you can only buy one item that fit in). Terms and Condition for Christmas Free Shipping By participating, you agree to be bound by these terms and condition. Promo offer will be applied when you qualify. Past purchases are not eligible. Request to redeem the free ocean shipping offer must be forwarded between Jan 1 to March 31, 2019 with evidence of your total purchase. Winners of the $1000, $500, $100 and $50 shopping voucher will redeem their offers by use of our Personal Shopper service. You simply tell us what you want to buy for the amount won, and Shoptomydoor will buy it on your behalf. Free shipping of cars covers shipping from US to the Port in Lagos. Winners will be responsible for just the payment of clearing and customs duty on all cars. Winners of free shipping for furniture sets will have items shipped free to our Lagos office and will be responsible for duty and clearing charges as requested by customs. Winners of free shipping for other items will have their items shipped free to our Lagos office, and will have to pick up items from there. A 10% charge on the value of the item will be required to cover for customs duty for such items.

On the way back from school one day, struck by the early summer sunlight of May, the peaceful, ordinary daily life forcibly came to a close. Occasionally Ryou would return home by himself taking a detour through a back street where almost no students pass through. Facing towards the station a commotion was suddenly heard. Looking towards the vacant lot 50 metres long on all sides, a girl wearing the same uniform as himself could be seen alone surrounded by three boys wearing another school’s uniform, some kind of courting in this place was being witnessed. Ryou, who observed the troublesome situation momentarily, was deciding whether or not to leave quickly. If he heard afterwards that the girl was injured, he thought that it would leave a bad aftertaste. Profoundly, as a result of being briefly worried, he decided to intervene if it became dangerous and decided to watch the girl stealthily from cover. Judging from the appearance of the situation, a boy from another school confessed to the girl and the girl declined. Ryou saw the situation where the girl was still being strongly approached. Though it is a little far away, if ears are strained it can be heard. “Say, its fine isn’t it? We came here with much effort just to hear ‘sorry’, yes, let’s not say goodbye yet, just keep us company going out for some tea” “Yes of course, it will be comforting, so come with us for a bit so our feelings can come to an end. It’s the best for you after all, wouldn’t refusing a confession you received leave a bad aftertaste? So let’s associate for just a little bit” The men make advances towards the girl while smirking. Ryou knits his eyebrows towards the excessive and one-sided flirting, earnestly hoping the girl can safely make her own way through this place, for the sake of his own peace. Then the girl in a fed up tone said to the men. “That has nothing to do with me, you came unreservedly of your own accord. As for the reason why I must keep you company, why would I think so?” Though the girl’s complaint was indeed justifiable, in this situation, Ryou considered that it might have an adverse effect. The men while seemingly irritated, gripped the girl’s arm. “Now, listen here. All you have to do is come for a little bit” “Hey, let go!” The girl puts up resistance to her arm being gripped, and swings the bag held in her hand. The bag hits the face of the man holding the girl’s arm making him bend backwards. The arm which was gripped was parted from but the girl was threatened immediately. “That hurt!” “What, you gripped it so suddenly…, hey, let go!” A man other than the one who was shaken off, catches the girl’s arm while shaking his head, appearing to be very disappointed. “Haa, This fellow I truly want to keep company with. What do you do? Do we accompany her back to your home?” While saying so, the man gripping the arm floats a cruel smile, and looks towards a man, who grins in agreement. “That sounds good, then, let’s go to my home!” “Wai, that’s not a joke! Let go! Let go now!” “This……, be reasonable and behave yourself!” “kyah!” The girl resists to the end and swings her bag with her free arm, while resisting, suddenly the man thrusts away the arm which was held and the girl falls on her backside. “Ow……! What are you doing! I’ll call the police!” “Good, if called out then wouldn’t this be seen” Though the girl retorts back strongly, the fear in her voice couldn’t be concealed. Ryou who heard that voice sighed. If an ordinary man goes and helps, it’s certain that it would be regarded as the girl’s hero. That is to say, if he moves up front and help he will certainly be a hero. So, why then, did Ryou not go help despite being able to help the girl at any time? The reason not to help is because after helping, tomorrow the girl who was helped would talk to her friends, and he is concerned about becoming the topic of a rumor. Ryou was unsure about becoming a hero now, as it was important to maintain his position. While the girl was swinging her bag around, Ryou was hoping she would run away, however things likely won’t turn out so well. In the end, though troublesome, he had to move to rescue the girl and end this useless panic. A sigh of regret was let out. Ryou goes out from the cover and picked up a stone by his feet. Facing forward towards the girl, Ryou casually threw it towards a man in front. The stone drew a beautiful parabola and splendidly hit the forehead of the man it was aimed at. The man who was hit by the stone crouched down in pain holding his forehead. “What, you!” After the man was suddenly hit by the stone, the three men were dumbfounded and looked to their right towards Ryou and shouted. The men and girl on the left hand side were attracted towards Ryou. Ryou saw the girl turned around, despite the distance could tell she was a splendid cute girl. While calmly thinking so, Ryou and the girl who became aware of him matched eyes. Ryou made a gesture with his right hand, moving towards the right. Ryou’s meaning was “Escape that way”. The girl realizing the meaning behind Ryou’s gesture nods and quickly stands up and moves in the direction Ryou indicated. She used the opportunity to run away while the men were still taken aback and glancing sideward because of Ryou’s appearance. “Wai… you! Don’t move there!” The men carelessly overlooked the girl that ran away, seemingly further increasing in anger they faced towards Ryou. Ryou understood that the attention of the men went from the girl to himself and let out a breath of relief. These guys are simpler than Ryou thought and he chuckled expressionlessly. The men go towards Ryou who reflexively looked a bit relieved, holding their fists up approaching where he is. Ryou with composure watched the punch which could be dodged, but doesn’t move from the spot. When it is confirmed that a man had entered the range of his kick, without any preliminary movement that could be sensed, with a flash, the outer of his foot was thrust into the man’s solar plexus. The man, who received Ryou’s counter in the form of his foot, floats a facial expression of anguish and fell to his knees, letting out painful breathing sounds. “Huh!?” Another one saw that instantaneous exchange and raised his voice wildly, with an expression that he can’t believe the scene he just witnessed. Suddenly using his foot to break from running, he escaped from the very limit of Ryou’s range at the last moment. Ryou clicks his tongue inwardly, after matching his line of sight with the man, he quickly looks behind him and shouts “Over here! Come quickly!” The man was startled but became confused when he turned his head back and there was no-one there. Before he realized that he was tricked, Ryou cut down the distance while the man was looking back and struck him with a roundhouse kick to the same solar plexus as just now. “Thank you for your simplicity” Ryou mutters towards the man with a truly joyful smile as he collapses with an anguished expression. Looking towards the man who the stone was first thrown at who was absentminded and in a crouching posture. Ryou confirmed he was the only one remaining and with composure walked towards him. He realizes that Ryou is coming and stand up in a panic. The memory of being hit by the stone was recalled and he speaks sharply while pointing towards his forehead. “You, do you know what you’ve done!?” The voice was strange as a bit of fear began to invade and merge with his angry tone. Ryou ignores the man’s caustic words as they go in the one ear and out the other as he slowly draws near the man expressionlessly. The man held more and more fear towards such a Ryou, he instinctively felt so while holding up his fists he faced Ryou. The moment he entered into range he was struck by the outer of Ryou’s foot into his solar plexus and just like the other two, he collapsed with an anguished expression. Up to now, not even two minutes have passed since Ryou first threw the stone. One might say it is an indicator of Ryou’s brilliant and unobjectionable skill. Ryou confirms that the men had fainted and began to search the uniform pockets of the men. In the places that he was looking, from the breast pocket a student notebook and a wallet and cellphone are taken out of the pants pocket. Feeling a sign from behind, he smiled wryly that he forgot. As for Ryou, if the girl runs back as it is, wouldn’t his presence in class be found out. He was hoping that this could be finished without becoming a rumor. As is expected that may be too convenient for him. As he was thinking so, the girl he was assuming about appeared. To leave the person who helped and runaway alone, because anyone would think there will be resistance, it couldn’t be helped that she looked back towards Ryou. She became speechless and stiff towards the situation that was completely unexpected. The girl who looked back earlier was slender but not too thin, hands and feet which weren’t large. Good looks that can’t help but make you unintentionally turn around regardless of gender. The light brown hair hanging below her shoulder has a slight wave. She is a special A within school, no a beautiful girl of super-special A. The one standing there was his school’s idol. Ryou suddenly looks back and the beautiful girl of super-special A shows a slightly surprised expression. He immediately regroups his mind and quickly bows his head in apology. “I was saved. Thank you” Hearing the girl’s words, Ryou was taken aback thinking about how quickly she got over the situation. While his brain is moving at high speed he answered the girl in the polite tone he always used at school. Needless to say, he did not want any relations with someone of super-special A. “N-no, don’t mention it……, are you injured?” “Ah, I’m alright. Skin doesn’t seem to have been grazed anywhere” The girl waves both hands while answering Ryou. Indeed, when looking at the girl’s leg, there doesn’t seem to be any soil or blood on it, it’s a lovely leg. It’s a thin, slender and long, excessively lovely leg. While almost being charmed, he shakes his head to drive away idle thoughts and said to the girl. “That’s good, and then wouldn’t it be better if you return home before these guys wake up?” Ryou thought that even if not the best, it would be for the better to separate from the girl quickly. The girl showed a slightly puzzled expression and approached Ryou. “Er, but, that is……, well, Are we in the same school? Are you in second-year?” Did the girl notice the implied meaning of Ryou’s words to “Return quickly, or didn’t she, she noticed but pretended not to. Perhaps she was a bit puzzled, because it was unusual for men to try to end conversations early like this. There are likely many men who make advanced towards such a beautiful girl. However, Ryou guessed that the natural course of events for an ordinary looking man like himself would be that they become nervous and don’t say much. The girl who ignores Ryou’s words of “Go home”, instead tries to find out if they’re in the same school year. It wasn’t so much a question, but rather a confirmation, as the embroidery on the breast pocket was seen. In Ryou’s current school there’s a red color line on the breast pocket for first-years, blue for second-years and green for third years. Like Ryou, the line on the girl’s breast pocket was blue. “Ah, that’s right……” “Um, I want to express my gratitude……, can you tell me your name?” The girl draws near to Ryou with upturned eyes. It’s a face with exceptional destructive force, Ryou though while refusing. “No, it’s fine. If it’s an expression of gratitude didn’t you give one just now?” Ryou’s words weren’t incorrect, as there was no doubt that “Thank you” was heard before. However Ryou understood that there was a wanting to go further than just a few words. “No, no like that……, I wanted to thank you more differently……, ah, excuse me, my name is Fujimoto Erika. Class two, second year class two” Ryou, who wanted to click his tongue, endured it. The number one method to maintain his current school life was for the people of Group A to not recognize his name or face in the first place, because of that he doesn’t want his name to be known to this beautiful girl of super-special A. “Introduce oneself before asking someone’s name’ when wanting to know someone’s name, the girl who noticed that her name wasn’t given, introduced herself. Because the name and even class was given, he became dejected as it would be bad to not return it. He instantly thought to introduce himself with a false name and class, but it would be found out immediately if checked up on, so for his sake as to avoid making a commotion later on decided not to lie, and sighed a little in resignation. “……Sakuragi Ryou, class 8” “Sakuragi……Ryou? Is Ryou written with this kanji? With her a finger, the character “亮” was written in the air. “That’s correct……, it was grasped well. And so, ah, the real thanks was heard and it’s getting dark, so shouldn’t you return home quickly?” Ryou’s tone seemed to gradually sound impatient. Towards Ryou whose polite tone started to slip away slightly with force behind it, Erika said. “No, that’s no good! I want to thank you further……, um, if you like, can we exchange cellphone numbers?” While thinking that there was no need to be so fixated giving thanks and that if it is known that he exchanged numbers with her it would become troublesome, Ryou promptly said. “Ah, well then, as a reward, could you promise not to tell anybody what I did to these guys?” Erika who hears what Ryou said, has a curious facial expression. Ryou thought that he had a good idea. He won’t be talked about and the girl can express her gratitude. It’s killing two birds with one stone. “Eh……? Why, such a……?” “Ah, various points, for selfish convenience…………” “Convenience……?, eh, but is such a thing good?” “For me that is beneficial. Do you promise?” “Eh……, yes, that’s fine……” Enticed by Ryou’s words, the politeness in Erika’s tone decreased slightly and nodded. Ryou that saw such an Erika, breathes in relief, and continued what he was doing before Erika came. Restarting his cleanup work, he pulled the cellphone from the man’s pocket and held it, transmitting the man’s phone number and address data to his phone. A photograph was taken of the man’s student handbook which had his name and a photo of face on it. Furthermore it was confirmed if there was a license in the wallet, finding one he also takes a picture with his cellphone, all money notes are pulled out and put inside his own pocket. He casually scattered about the cellphone, wallet and student notebook on top of the man. Erika was dumbfounded seeing this series of experienced movements and drew closer to Ryou while panicking. “Wa, wait, what are you doing Sakuragi-kun!?” “Severing future anxiety, preventing repeat offence” Ryou spoke simply but Erika couldn’t comprehend. “Eh, b-but, do you need to go as far as take the money!?” Ryou mutters towards Erika’s inquiry. “Game……, isn’t it like in an RPG?” He answered Erika who didn’t understand the intention. “Enemy characters in game……, when monsters are defeated don’t they drop money? It’s like that” Erika cannot hide her surprise as Ryou says his peculiar theory far too indifferently. “Eh!? But isn’t it only for monsters!?” Ryou spoke while nodding. “Ah, monster drop, however in the case of these guys, it appears by feeling around inside their pockets……, on that point isn’t it kind for a monster?” “Eh!? That!?” “Besides for enemies there also legitimate humans, for a Boss there are also splendid humans, additionally even bandits drop gold or a treasure chest, don’t you agree? N……? Then, are these guys kinder than bandits?” Erika watches with a cramp on her mouth while Ryou laughs with an ‘ahaha’, requesting her agreement. And so Erika decided to observe Ryou again. He has a very plain appearance. Up until today she hadn’t been aware of him in school. She might have caught a glimpse of him but believes that today is the first time seeing him. Such a person spoke without hesitance. Erika is self-aware that her appearance is superior to most people. The males at school are inquisitive towards her and occasionally send intoxicated sticky glances. When confident men make advances towards her, they usually start to sound desperate and become aware of it. Because such people are often nearby, when ordinary men approach they become excessively nervous, conscious and run away without talking. However, before her eyes, a truly strange man was seen who could said to be very much outside of common sense. While Erika is thinking who on earth he was, Ryou finished carrying out similar activity to the two others and spoke to Erika. “So, how about returning? Does what’s going to happen from here have to be seen?” Ryou, who was worried about Erika, spoke with his normal tone. Deciding that controlling himself by speaking with a polite and courteous tone was troublesome. Towards Ryou’s question, Erika was taken aback, worried whether or not to go home. Curiosity towards Ryou started to boil, seeing such a scary event, she shook her neck. Ryou who saw that also shook his neck. “Haa……, I’m going to wake these guys so can you stay silent?” “I understand, I promise” Erika nods with an as serious as possible face. Ryou shrugs his shoulders, looks towards the two men at his feet, nudging them with his foot jolting them awake. “Hey, get up” The two men stirred, while Ryou jolted them awake, started to display anguished facial expression, began to get up. “Hey, that guy, wake him up” Hearing what Ryou said they turned their head in the direction he was looking, seeing their friend who had fainted, a flustered voice was let out. Next, it was noticed that the cellphone, wallet and student notebook which should have been in their pocket, was scattered around them, and raised their voice towards Ryou. “You, what did you do to us!?”……, why is there nothing in these wallets!?” When the men shout seeing the contents of their wallet, seeming truly irritated Ryou said. “I hear you even without shouting, so listen up and wake that guy up” “What!? What was that, you!?” Looking at the two who complained in succession towards him, Ryou with a fed up expression takes off his glasses and glared at the two of them. “You guys, who do think you’re facing with such a mouth?” Ryou shouldn’t be anyone in particular, but the moment Ryou started to glare at them, the two sensed instinctively they shouldn’t go against him, and in a panic ran to wake up the friend who was still out. Because Erika was near to where the two ran towards, Ryou beckons to Erika to get behind him and she jogs over to his location. Seeing Ryou who had taken off his glasses, Erika showed a little bit of a surprised appearance. While Erika goes to Ryou, the other man woke up and a bewildered feeling could clearly be seen on him. “Good, you guys, sit there” Ryou makes a command towards them. The men were about to complain, but immediately with Ryou’s glare, they sat down cross-legged on the spot. Ryou who saw that had a disgusted facial expression. “Are you guys idiots? When I say so kneel in seiza” While being puzzled, the three men looked at each other, then obediently kneeled in seiza when they saw the face of Ryou who was glaring. Erika watched the situation with an open mouth. Ryou confirmed the three men were in seiza and spoke to them. “That’s good, you guys. The scene of you guys who were rough with this girl, was video recorded on my cellphone. Ryou who held his cellphone in his right hand, showed Erika. “””Haa!?””” “Eh!?” It was a chorus of four people. Naturally the three men, Erika also raised her voice in surprise. Ryo slowly nodded. “And then your guys’ cellphone number, e-mail address, home address, photo of face, school and class, I have them” “Wh-What!?” The man who had just woken up a little bit ago said so, and for the first time noticed that his cellphone and things were scattered about. “And that’s not all! The money’s taken!!” Towards the men with an indignant expression Ryou says something unexpected. “It’s the consequence of your actions, aren’t you aware of the term karma? You did something bad, so simply a bad thing is returned to you. Were you not told by your parents or teacher that it’s wrong to be violent towards a girl? The money is for consolation, or think of it as an annoyance fee. Because the small change was sufficiently left behind, you can return home” When Ryou says so, the man on the right shouted. “Stop joking with me, you!” The man in the center received energy from his friend’s shout screamed at the same time. “That’s right, what are you doing to us!” Hearing the words, Ryou twitches in reaction, and casually kicks the face of the man in the middle. ‘Gon’, the man that was kicked is bent backwards with an unpleasant sound. The men to the right and left of the man who was kicked didn’t see Ryou’s foot when he kicked. Hearing a sudden unpleasant sound coming from the friend next to them, seeing him bent backwards, an expression of shock floats on their faces. Erika has a similar look of surprise on her face. “You, what to do……? You three approach a girl, should I knock you down after all?” The men felt a chill and hardened in the situation when Ryou’s atmosphere suddenly changes. Erika also held her breath and hardened for a moment, in a panic she grasped Ryou’s arm. “I’m fine, isn’t it already enough?” It’s not that Erika didn’t also feel some fear towards Ryou, however, she towards this person, felt that he isn’t someone who would use violence against a girl, so it was possible to break out of her rigidness. Ryou whose arm was grasped by Erika stiffened instantly, an expression of dismay is shown. Tilting his head Ryou looked to his side, his appearance of dismay getting stronger could be seen. Immediately pulling himself back together, he said towards the frightened men. “Anyway, do not get close to this girl again. Do not loiter around this vicinity again. Ah, be careful not to appear in her and my field of vision. If you do not follow what was said, the video with your profile will be put on the internet, including your cellphone number. Or rather, die” The men shiver from Ryou’s words, running away in a rush while saying sorry many times. In doing so, they shouldn’t approach her again. On the other hand, hearing misunderstood words, Erika grasped Ryou’s arm tighter. Ryou tried to deny it in a hurry, but stiffened once again and was not able to voice his denial. Once the men had gone away, an abrupt silence with nothing being said came about, Ryou coughed to clear his throat. Erika who inclined her neck looks up to Ryou with curiosity. Ryou who saw that face, in that moment, said to Erika while removing his glance. “Ah, um, could you release my arm?” When it was said, Erika noticed for the first time that she was embracing Ryou’s arm, also that it was pressed firmly against her chest was realized. Kya, Erika that realized it, parts from Ryou’s arm in a panic with her face bright red. “I-I’m sorry……” Erika looks at Ryou timidly, whose face has also become red. Ryou matched eyes with her and let out he really thought. “No, its fine……, it was a side benefit” Erika’ face becomes more red hearing that, coughing to clear her throat, she inquired uneasy about something. “Hey, about that video……” “Yes? Ah……, it was taken properly. If you want it to be erased just say so……” “Um……, it’s not that” “Hm……? Ryou didn’t understand what Erika was saying, Erika asked again with a smiling face. “Since when was it taken? Can you show me?” Ryou who hears those words notices his mistake, being self-conscious of what he did wrong, resigning himself, he handed over his cellphone. Ryou avoids looking at Erika as she watches the video quietly, while thinking if there wasn’t a way to prevent hearing the sound that was leaking. When the video playback ends, Erika returned the cellphone back to Ryou. Something similar to smile became visible. “It was taken very early wasn’t it?” “Hm……?, ah, that’s right” “I received you help so such a thing is difficult to say however, for what reason, didn’t you help earlier? Ryou that saw Erika’s frightening smile felt that it could unreservedly enter into the worst ranking of smiling faces. “That is, troublesome……, ahem, I thought you might be able to do something by yourself” “Is that so? When my arm was caught, and I was resisting, how was it seen so in your eyes?” “Ah……, I was rooting for you to persevere” It was Ryou’s true feelings, there was no lie. “So……” Erika faced Ryou’s front, smiling pleasantly, held her arms aloft, “Then help earlier!” while saying so she hit Ryou’s cheek. Though it was possible to avoid, Ryou considered after how frightening it seemed to be, resigned himself, and received the beautiful girl’s slap. Something painful is painful even if received on purpose, staggering lightly afterwards and waiting for the flickering in his eyes to calm down, haa, he sighed. “My bad……, I was able to help earlier, but didn’t” Erika who receives Ryou’s apology also returns an apology. Saying sorry though you saved me I glossed over it, again, you saved me, thank you, was once again said. “The promise……, do you recall?” “Promise……? Ah, yes, I know ‘not telling anybody what you did to those guys here’ isn’t it? But, is it really fine like this?” “That is fine……, well then” Ryou puts his glasses back on while answering, Erika who saw that asked him. “Why don’t you use contact lenses?” “This is, my presence……, no, I like glasses” It seems like a bit of time had gone by being unadorned, the feelings of wearing glasses hadn’t changed. Ryou, whose true intentions almost came out, thought that he must quickly part ways with the beautiful girl in front of him. “Is it so? I think it’s good without the glasses…………” Erika said so while becoming slightly red, the voice tapered off gradually and Ryou couldn’t hear it. “Eh? What” Erika shook her head flustered. “No, it’s nothing……, are we returning? You’re facing the station aren’t you?” Ryou thought inwardly not to joke. If he walks side by side with such a girl towards the station, a rumor would spread by tomorrow, and the considerable effort and troubles up to now would come to nothing. “No……, err, I remembered something I have to do at school, I’ll return for a little” “Did you? Then, let’s go t-……” Ryou interrupted Erika before she finished her words. “No, it’s fine! Thank you, later then!” Was said in a panic then he runs along the road towards the school. “Keep the promise-“is produced with the Doppler effect. Erika who had a dumbfounded appearance seeing him off “Normally, after helping a girl who was attacked, isn’t it good manners to escort her home for little bit?” muttered a very reasonable opinion.

Q: How can I call method on custom List from a property? So I'm currently working on rewriting a VB.NET application I've been working on to C# (for a refreshser) and I've run into a bit of a snag that I can't seem to figure out. I am trying to cycle through an objects properties and get all properties that are of Type CustomList<T> and run the Save method on each. VB.NET Code for CustomList Friend Class CustomList(Of T) Inherits List(Of T) Private ReadOnly Property FileName As String Get Return GetType(T).ToString + ".json" End Get End Property Private ReadOnly Property Campaign As Campaign Private ReadOnly Property FilePath As String Get Return Source.SourcePath + FileName End Get End Property Public Sub New(source As Source) _Source= source If IO.File.Exists(FilePath) Then Me.AddRange(JSON_Functions.LoadJSONObject(Of CustomList(Of T))(FilePath)) End Sub Public Sub New(objList As List(Of T)) Me.AddRange(objList) End Sub Public Sub Save() JSON_Functions.SaveJsonObject(FilePath, Me) End Sub End Class C# Code for Custom List public class CustomList<T> : List<T> { private static string FileName { get { return typeof(T).Name + ".json"; } } private Source Source { get; set; } private static string FilePath { get { return Source.Path + FileName; } } public CustomList(Source source) { this.Source = source; if (File.Exists(FilePath)) this.AddRange(GlobalElements.JSON_Functions.LoadJsonObject<CustomList<T>>(FilePath)); } public CustomList(List<T> objList) { this.AddRange(objList); } public void Save() { GlobalElements.JSON_Functions.SaveJsonObject(FilePath, this); } } I am trying to call the Save command on each property of CustomList but have hit nothing but dead ends on this. In VB.NET I was able to do this in a relatively straightforward method, but in C# I have found nothing that is the equivalent. My end goal is being able to save Object1List, Object2List, Object3List, etc. via a loop instead of having to call each properties Save method individually. VB.NET Code for Save methods (this handles any generic list, but I am still able to call a method without it being apart of VB.NETS Object definition) Public ReadOnly Property Object1List As CustomList(Of Object1) Public ReadOnly Property Object2List As CustomList(Of Object2) Public ReadOnly Property Object3List As CustomList(Of Object3) //other code stuffs Public Sub SaveCampaign() For Each p As PropertyInfo In Me.GetType.GetProperties If GetType(IList).IsAssignableFrom(p.PropertyType) AndAlso p.PropertyType.IsGenericType Then p.GetValue(Me).Save() Next End Sub C# Code for Save methods public CustomList<Object1> Object1List { get; private set; } public CustomList<Object2> Object2List { get; private set; } public CustomList<Object3> Object3List { get; private set; } //Other Code Stuff public void SaveSource() { foreach (PropertyInfo p in this.GetType().GetProperties()) { if (typeof(IList).IsAssignableFrom(p.PropertyType) && p.PropertyType.IsGenericTypeDefinition) p.GetValue(this).Save(); } } This returns error on p.GetValue(this).Save();: 'object' does not contain a definition for 'Save' and no accessible extension method 'Save' accepting a first argument of type 'object' could be found (are you missing a using directive or an assembly reference?) The biggest reason I want to accomplish this is that I might have 10+ CustomList<T> and don't want to list them every time. If anyone could offer some advice, I would greatly appreciate it!!! A: One of the option is public interface IMyCustomList { void Save(); } public class CustomList<T> : List<T>, IMyCustomList { .... } Then cast your property value to the interface var propValue = p.GetValue(this); if (propValue != null && propValue is IMyCustomList myList) myList.Save(); But still, I don't think it's good to loop through the properties like that.

An evening with St. Joan TCM has a Joan of Arc movie marathon going! I think St. Joan of Arc is a great example for young people, girls and boys alike. Have you ever read Mark Twain’s superb novel about St. Joan? He thought it was his best work. Tonight they had: 1948 – Joan of Arc with Ingrid Bergman – too bad it was so … pretty, and then there was that scandal. Jose Ferrer = loathsome. It was idealized, but it was Catholic. Joan was taken seriously and was portrayed as godly and not… well.. nuts. It was a different era, to be sure. And people of the time cared so much for morality even in the actors and actresses that the film failed in its day at the box office. 1957 – Saint Joan based on Shaw’s play – I had forgotten how pernicious it really is, but Richard Widmark? Really? Did you know he was born in Minnesota? There was a hilarious anachronistic moment after the coronation when they included in soundtrack a fugue from the end of a Gloria of a Haydn Mass. This was as bad as the 19th c. style anthem sung after the battle in Branagh’s Henry V. Preminger works in a Te Deum, again! Clever script with little jokes for the well-read. But this is a pernicious film. Constant reduction of the supernatural to the natural. George Bernard Shaw. Dumbed-down Shaw for a screen-play. But dumbed-down and made contemporary and slick by Graham Greene! But Widmark was fun… and with John Gielgud to boot! Panned. Not well received. I’m glad Preminger failed. 1928 – The Passion of Joan of Arc – just a few years after her canonization, the great silent film which barely survived destruction, new with new/old music by Richard Einhorn sung by Anonymous 4. Gripping doesn’t do it justice. 1962 – Le Proces de Jeanne d’Arc – haven’t seen this one. Based on trial records. 23 Responses to An evening with St. Joan “Dumbed down” is a mild description of what Preminger did to Shaw’s play. GB Shaw was a skeptic, to be sure, but his stage version is always smart, often fascinating, and allows for the supernatural to be a possibility. One of the most notable aspect of his polemical plays is that he gives each side of an argument a scrupulously fair hearing, with no straw men. The trial scene might amuse, or irritate, or even madden us who believe– but it also sparks some useful, if uncomfortable, thought. The film boils all that down to jokes and disbelief. I’m hoping I can stay awake for The Passion of Joan of Arc. Anonymous 4! Florence King, the Southern writer, struggled to define a ‘good old boy’ and the truly grand gesture they were sometimes capable of. Going deep into her Anglo-Saxon roots she gives as her example: the anonymous lout of an illiterate English common soldier (probably a thief, rapist and murderer as a matter of course ) who tied two sticks together from her pyre to make a cross for Jean to hold. The 1928 film is astoundingly good! It came on TCM late one night a few years ago and my Mom and I were unable to look away. I’ve actually been meaning to read the Twain book; I’ve been pondering St. Joan a lot lately. Why was her canonization so late? Some say it was a political move to bolster France after WWI. Also, why did God choose her to intervene in this one European conflict? Goodness knows France and England would fight another day, and that takeovers of other nations were frequent in European history. Did St. Catherine of Alexandria have a particular interest in choosing sides in this fight? Oh well, visions of saints are a mercurial thing. I’ll just have to wait until I get to heaven for Divine Providence to fully make sense. Sarah L– those interested in St Joan and her role in the French-English conflict might be interested in Shakespeare’s rarely performed Henry VI, part 1, in which Joan is a villainess! To the English of Shakespeare’s time she was still regarded as a sorceress, and he presents her very unsympathetically. No films of that one, I think! I’m assuming the scandal with the 1948 version has something to do with Rossellini, but then I don’t understand why Jose Ferrer is loathsome. I’m curious what the story is, and not because I’m particularly interested in tabloid type celebrity gossip, but simply because it was mentioned and then not explained. That sort of thing drives me bonkers. It’s a Pandora’s box thing for me. I was able to see the 1928 version at a theater that was showing it which gave the benefit of seeing the movie on the big screen plus having the theater sound system for the soundtrack that had been made. It was amazing. Without words it so conveyed the faith of Joan and the mission from God that she took on even though it was so outside her experience, and how much she was let down by those in power who should have been listening to the message they were being given. There was another silent one called “Joan the Woman,” from around 1916. It’s been a while since I’ve seen it, but I remember it was quite reverent. They did understandably play up the patriotic angle due to the War going on at that time. I have Mark Twain’s book, and tapes of Ingrid Bergman’s ‘Joan of Arc’ and ‘The Passion of Joan of Arc’. I also have the CD of Richard Einhorn’s ‘Voices of Light’. I remember watching ‘Saint Joan’ in 1966, before my Confirmation. I began to learn about St. Joan in my sixth-grade history class, and after I did, I was ‘hooked’ on her! That still of the burning of Jean Seberg as Joan is ‘scarifying’! I’ve also been to the three places in France connected with St. Joan: Domremy (her birthplace), Orleans (site of her great military victory) and Rouen (site of her trial and burning)-my first visit to France in 1985 was a St. Joan pilgrimage. It timed it to attend the annual ‘Fete de Jeanne d’Arc’ in Orleans. When I visited the “House of Joan of Arc’ in Orleans in 2000, I saw a wall display showing a time line of all the existing Joan of Arc films. It was dominated by a huge photo of Renee Falconetti-star of ‘The Passion of Joan of Arc’ (you can’t forget those huge glowing eyes of hers!)-embracing the crucifix before being bound to the stake. digdigby-I have sometimes wondered what happened to that unnamed English soldier who made the little cross for Joan before her death. Did she intercede with Our Lord for him after she entered heaven? Did she meet him at the gate of heaven to thank him for that kind gesture? This ‘movie marathon’ sounds really cool! I know that 2011 is the 580th anniversary of her death at Rouen-is that the reason it was done? irishgirl – -I have sometimes wondered what happened to that unnamed English soldier who made the little cross for Joan before her death. Did she intercede with Our Lord for him after she entered heaven? Did she meet him at the gate of heaven to thank him for that kind gesture? Little Therese as a girl prayed along with her sister for salvation for an astonishingly brutal murderer of an entire family who was about to be guillotined and kept refusing priestly attention. At the last moment, this ‘monster’ shoved away the priest, grabbed the crucifix and fiercely embraced and kissed the crucified Christ. Therese was satisfied that her prayers for his salvation were answered. I understand, these days, we must sometimes (at least figuratively) “push away the priest” and grab the crucifix, especially if the priest is an effeminate Marxist dressed like a rainbow. digdigby-I don’t know if Pranzini ‘pushed away the priest’ at the moment of his execution to kiss the crucifix. I know that he called for it, and then he kissed it. What do you mean by, ‘we must sometimes (at least figuratively) ‘push away the priest’ and grab the crucifix, especially if the priest is an effeminate Marxist dressed like a rainbow’? St. Joan certainly didn’t ‘push away the priest’ when the crucifix was offered her at her death! She asked him for it, and he brought it to her. She only begged him to get down and away from the stake once the fire was lighted, so that he wouldn’t get burned himself, but that he hold the crucifix up before her eyes that she might fix her gaze on it when the pain became too much for her to endure. Remember that her last word was ‘JESUS!’ When I’ve watched the video I have of ‘The Passion of Joan of Arc’, I always say, ‘Look at the crucifix!’ at the final scene when the burning takes place. Legisperitus-I’ve seen “Joan the Woman’, too. Geraldine Farrar plays St. Joan in that one. Was that directed by Cecil B. DeMille, by any chance? I viewed this at the home of a woman in Albuquerque, New Mexico, who has a website dedicated to St. Joan. She has a little museum of Joan of Arc items in a spare room of her house. I nearly cried out at the burning! That was hard to watch! Jacob-I’m thinking the same thing. Jose Ferrer was brilliant as Charles VII-in fact, ‘Joan of Arc’ was his film debut. He even looked like the ‘original’ Dauphin, if you’ve seen the portrait by Fouquet in the Louvre. Charles VII was called ‘The Victorious’, but he was a loathsome rat in deserting St. Joan when she was captured and imprisoned by the English and their Burgundian allies. He wouldn’t even allow any of her comrades-in-arms (Dunois, Alencon LaHire) to attempt a rescue of her from prison. Of course, he ‘made up for it’ by instigating the Process of Rehabilitation to clear St. Joan’s name. And it helped that her Mama, Isabelle Romee, was alive to push it through! A tenacious and valiant mother, just like her daughter! I actually portrayed the Dauphin in our little semi-pro troupe’s production of Shaw’s “Saint Joan.” I saw the 1957 movie a few years later, and was surprised to see that I (with my limited third-rate acting ability) was able to stumble upon the same approach Richard Widmark solidly nailed in his portrayal. As noted above, Shaw’s play presented all sides of the arguments, in great expository detail (which we had to compress to make the play watchable–and performable for us!), and although Shaw was glad to recast the the struggle over Joan in terms of a secular new-verus-old order perspective (the new “nationalism” as a “secular heresy” to the old feudal model), as well as to portray the Church and its officials as hypocrytical and disbelieving, the possibility of the supernatural was never sucessfully debunked within the play itself–the arguments put forth by the royal court as to how Joan did what she did fell REALLY flat, and were possibly intentionally made at way by the playwright himself. So, although Shaw’s play is pernicious, I did not think that it was very convincing in terms of de-sacralizing the Saint herself. I should have put a comma in my parenthesis (Dunois, Alencon, LaHire). That’s what happens when you use a different computer keyboard….sigh… Legisperitus-I’m glad to know I was right about ‘Cecil B’ [DeMille] being the director of ‘Joan The Woman’. Well, if he could do two films on Moses-‘The Ten Commandments’-he could certainly attempt a movie about St. Joan! One of the lines I remember from Shaw’s ‘Saint Joan’ was in the Epilogue when she appears to Charles years after her death: ‘Well, I got to go now, Charlie’, and he turns over in his bed and says: ‘Goom-bye’ [or else it was ‘Goo-night’]. It’s stuck in my mind after all these years….thought it sounded so funny…. Regarding Mark Twain’s book on St. Joan: he said it was ‘the best of all my books’. He spent twelve years doing research in France. And his severest critic while he wrote it was his wife Olivia-she’d give him a certain ‘look’ when she didn’t like what he wrote! I hope that she was there to greet him at the end of his life on earth. (Yeah, I know I’m doing ‘multiple comments’ on this entry, Father Z-but I can’t help it-St. Joan is one of my favorite Saints! I can’t saying something about her!) Search Fr. Z’s Blog Search for: When you shop… ... through Amazon, please, come here first? Enter Amazon through my search box. I'll then get a small percentage of everything you buy. (Pssst - Can't see the search box? Turn off your "ad-blocker" for this site!) My wish lists The horse is made ready for the day of battle, but the victory belongs to the LORD. - Proverbs 21:31 For Easter: another ethereal music CD from the chart-topping nuns… Support them with prayer and fasting. CLICK to buy Car Magnets & Stickers Aedificantium enim unusquisque gladio erat accinctus. - Nehemiah 4:18 "Let God arise! Let His enemies be scattered! Let those who hate him flee before His Holy Face!" CLICK and say your Daily Offering! Let us pray… Grant unto thy Church, we beseech Thee, O merciful God, that She, being gathered together by the Holy Ghost, may be in no wise troubled by attack from her foes. O God, who by sin art offended and by penance pacified, mercifully regard the prayers of Thy people making supplication unto Thee,and turn away the scourges of Thine anger which we deserve for our sins. Almighty and Everlasting God, in whose Hand are the power and the government of every realm: look down upon and help the Christian people that the heathen nations who trust in the fierceness of their own might may be crushed by the power of thine Arm. Through our Lord Jesus Christ, Thy Son, who liveth and reigneth with Thee in the unity of the Holy Ghost, God, world without end. R. Amen. Yes, Fr. Z is taking ads… ... and there will be nearly 1,000,000 page loads this month. A bit more food for thought… “Only one sin is nowadays severely punished: the attentive observance of the traditions of our Fathers. For that reason the good ones are thrown out of their places and brought to the desert.” - Basil of Caesarea - ep. 243 Help Monks in Wyoming, Fr. Z, and get great coffee too! Food For Thought “The legalization of the termination of pregnancy is none other than the authorization given to an adult, with the approval of an established law, to take the lives of children yet unborn and thus incapable of defending themselves. It is difficult to imagine a more unjust situation, and it is very difficult to speak of obsession in a matter such as this, where we are dealing with a fundamental imperative of every good conscience — the defense of the right to life of an innocent and defenseless human being.” - St. John Paul II PLEASE RESPOND. Pretty pleeeease? Should the US Bishops have us return to obligatory "meatless Fridays" during the whole year and not just during Lent? Because you don’t know when you are going to need to move fast or get along without the supermarket… Identity theft is a serious problem that you do NOT want to have. I use Lifelock. And for your cybersecurity… Wyoming Catholic College! A great place in Rome… More food for thought: “I expect to die in bed, my successor will die in prison and his successor will die a martyr in the public square. His successor will pick up the shards of a ruined society and slowly help rebuild civilization, as the church has done so often in human history.” Check out the Cardinal Newman Society feed! Be a “Zed-Head”! Fr. Z’s stuff is everywhere More food for thought… "All laws which are repugnant to the Constitution are null and void." - Marbury v. Madison, 5 U.S. 137, 176 Even More Food For Thought "Men by their constitutions are naturally divided into two parties: 1. Those who fear and distrust the people, and wish to draw all powers from them into the hands of the higher classes. 2. Those who identify themselves with the people, have confidence in them, cherish and consider them as the most honest and safe, although not the most wise depositary of the public interests." To set up a recurring, monthly donation (even a small one) go to the bottom of this blog and look for the drop down menu! Some donations also come through Chase/Manhattan (if you don't like PayPal). I remember benefactors in my prayers and periodically say Mass for your intention. I invite you to subscribe to a monthly donation. Will you help? Go to the bottom of the page. So far, new subscribers for MARCH - TZ, AD, IB Additional Food For Thought “And how we burned in the camps later, thinking: What would things have been like if every Security operative, when he went out at night to make an arrest, had been uncertain whether he would return alive and had to say good-bye to his family? Or if, during periods of mass arrests, as for example in Leningrad, when they arrested a quarter of the entire city, people had not simply sat there in their lairs, paling with terror at every bang of the downstairs door and at every step on the staircase, but had understood they had nothing left to lose and had boldly set up in the downstairs hall an ambush of half a dozen people with axes, hammers, pokers, or whatever else was at hand?... The Organs would very quickly have suffered a shortage of officers and transport and, notwithstanding all of Stalin's thirst, the cursed machine would have ground to a halt! If...if...We didn't love freedom enough. And even more – we had no awareness of the real situation.... We purely and simply deserved everything that happened afterward.” - Aleksandr Solzhenitsyn Fathers, you don’t know who might show up! It could be a “big fish” of one sort or other… And... GO TO CONFESSION! Leave Voice Mail for Fr. Z Nota bene: I do not answer these numbers or this Skype address. You won't get me "live". I check for messages regularly. Help the Sisters. They have a building project. Get great soap (gifts, etc.) while helping REAL nuns! Food For Thought “Men are qualified for civil liberty in exact proportion to their disposition to put moral chains upon their own appetites. . . . Society cannot exist unless a controlling power upon will and appetite be placed somewhere; and the less of it there is within, the more there must be without. It is ordained in the eternal constitution of things, that men of intemperate minds cannot be free. Their passions forge their fetters.” Archives ENTRY CALENDAR Do you use my blog often? Is it helpful to you? If so, please consider subscribing to send a monthly donation. That way I have steady income I can plan on, and you wind up regularly on my list of benefactors for whom I pray and for whom I periodically say Holy Mass. Some options The opinions expressed on this blog do not necessarily reflect the positions of any of the Church's entities with which I am involved. They are my own.

# Relative Date [](https://travis-ci.org/wildlyinaccurate/tiny-relative-date) Tiny function that provides relative, human-readable dates. ## Installation ``` npm install tiny-relative-date ``` ## Usage The module returns a `relativeDate` function with English translations by default. ```js const relativeDate = require('tiny-relative-date') ``` The `relativeDate` function accepts date strings or `Date` objects. ```js relativeDate('2017-06-25 09:00') // '12 hours ago' relativeDate(new Date()) // 'just now' ``` The value of "now" can also be passed as a second parameter. ```js const now = new Date('2017-06-25 08:00:00') const date = new Date('2017-06-25 07:00:00') relativeDate(date, now) // 'an hour ago' ``` ### Using a non-English locale The tiny-relative-date module can be initialised with a locale. See the [translations directory]('./translations') for a list of available locales. ```js const relativeDateFactory = require('tiny-relative-date/lib/factory') const deTranslations = require('tiny-relative-date/translations/de') const relativeDate = relativeDateFactory(deTranslations) relativeDate(new Date()) // 'gerade eben' ``` ### Using a custom locale You can also use a completely custom locale by passing a translations object instead of a locale string. Translations can be plain strings with a `{{time}}` placeholder, or they can be functions. See the **Adding new locales** section below for a list of translation keys. ```js const relativeDateFactory = require('tiny-relative-date/lib/factory') const relativeDate = relativeDateFactory({ hoursAgo: '{{time}}h ago', daysAgo: (days) => `${days * 24}h ago` }) relativeDate('2017-06-25 07:00:00') // '2h ago' relativeDate('2017-06-24 06:00:00') // '27h ago' ``` ## Contributing Contributions are welcome! Running this project locally requires Git and Node.js. ``` git clone [email protected]:wildlyinaccurate/tiny-relative-date.git cd tiny-relative-date/ npm install ``` Once you are set up, you can make changes to files in the `src/`, `spec/` and `translations/` directories. Build any changes you make by running ``` npm run build ``` And run the tests with ``` npm run test ``` ### Adding new locales If you would like to add a new locale, please create a JSON file in the `translations` directory and ensure it has the following keys: | Key | Default value ("en" locale) | |------------------------|-----------------------------| | `justNow` | just now | | `secondsAgo` | {{time}} seconds ago | | `aMinuteAgo` | a minute ago | | `minutesAgo` | {{time}} minutes ago | | `anHourAgo` | an hour ago | | `hoursAgo` | {{time}} hours ago | | `aDayAgo` | yesterday | | `daysAgo` | {{time}} days ago | | `aWeekAgo` | a week ago | | `weeksAgo` | {{time}} weeks ago | | `aMonthAgo` | a month ago | | `monthsAgo` | {{time}} months ago | | `aYearAgo` | a year ago | | `yearsAgo` | {{time}} years ago | | `overAYearAgo` | over a year ago | | `secondsFromNow` | {{time}} seconds from now | | `aMinuteFromNow` | a minute from now | | `minutesFromNow` | {{time}} minutes from now | | `anHourFromNow` | an hour from now | | `hoursFromNow` | {{time}} hours from now | | `aDayFromNow` | tomorrow | | `daysFromNow` | {{time}} days from now | | `aWeekFromNow` | a week from now | | `weeksFromNow` | {{time}} weeks from now | | `aMonthFromNow` | a month from now | | `monthsFromNow` | {{time}} months from now | | `aYearFromNow` | a year from now | | `yearsFromNow` | {{time}} years from now | | `overAYearFromNow` | over a year from now |

This invention relates to a money box, more particularly, to a money box with an anti-theft device. The paper money can be readily and smoothly received and stacked within the money box. Current money boxes have various kind of stacking mechanism. Most of the stacking mechanism have a combination mechanism. The stacking mechanism is installed within the money box. If the stacking mechanism fails to work, the money box shall be disassembled, then the stacking mechanism is accessible for maintenance. This arrangement is really inconvenient and increases labor cost. On the other hand, the assembling of a disassembled money box takes a lot of time as well. On the other hand, the stacking mechanism has a large buck size, accordingly, the inner space of the money box is wasted. As a result, the layout inside the money box is inefficient

Abstract Background. Malaria rapid diagnostic tests (RDTs) are relatively simple to perform and provide results quickly for making treatment decisions. However, the accuracy and application of RDT results depends on several factors such as quality of the RDT, storage, transport and end user performance. A cross sectional survey to explore factors that affect the performance and use of RDTs was conducted in the primary care facilities in South Africa. Methods. This study was conducted in three malaria risk sub-districts of the Limpopo Province, in South Africa. Twenty nurses were randomly selected from 17 primary health care facilities, three nurses from hospitals serving the study area and 10 other key informants, representing the managers of the malaria control programmes, routine and research laboratories, were interviewed, using semi-structured questionnaires. Results. There was a high degree of efficiency in ordering and distribution of RDTs, however only 13/20 (65%) of the health facilities had appropriate air-conditioning and monitoring of room temperatures. Sixty percent (12/20) of the nurses did not receive any external training on conducting and interpreting RDT. Fifty percent of nurses (10/20) reported RDT stock-outs. Only 3/20 nurses mentioned that they periodically checked quality of RDT. Fifteen percent of nurses reported giving antimalarial drugs even if the RDT was negative. Conclusion. Storage, quality assurance, end user training and use of RDT results for clinical decision making in primary care facilities in South Africa need to be improved. Further studies of the factors influencing the quality control of RDTs, their performance of RDTs and the ways to improve their use of RDTs are needed.