Datasets:

florentgbelidji

/

pubmed-running

like 0

PMC3739006

an animal s reaction to a sensory stimulus depends on the context in which it is presented . in the cortex , even primary sensory areas receive a large number of top - down inputs from higher - order regions , in addition to the thalamic input that directly conveys sensory messages . these top - down connections are believed to underlie the integration of sensory inputs with nonsensory context . one case in which a role for top - down cortical connections has been established is attention in the primate visual system . strong electrical stimulation of the frontal eye fields ( fefs ) produces eye movements to a topographically aligned location in space . however , weaker electrical stimulation below the threshold for eliciting an overt saccade instead mimics the effects of attention to this location , causing increased behavioral and neuronal responses to stimuli presented there ( moore and armstrong , 2003 ) . in rodents , a robust experimental model of attention has not yet been established . however , there are remarkable parallels between the effects of attention on cortical processing in primates and changes in cortical state that occur with changes in behavioral context in rodents ( harris and thiele , 2011 ) . cortical states were first described in relation to the sleep cycle . during slow - wave sleep , animals exhibit a synchronized state , characterized by large , slow fluctuations in the spiking and membrane potentials of large neuronal populations . by contrast , the cortex of awake , active , and alert animals exhibits a desynchronized state ( also termed activated state ) in which slow fluctuations are replaced by tonic cortical firing , often together with a higher - frequency gamma oscillation . recent work has shown that these classical states are in fact points on a continuum . for example , quietly resting rodents show a moderately synchronized state , with fluctuations in cortical activity that are shallower and faster than classical sleep oscillations . when animals engage in active behaviors such as whisking or running , however , these moderate fluctuations are further reduced ( polack et al . , 2013 ; poulet et al . , there are several parallels between the correlates of selective attention in primates and cortical states in rodents . their effects on local field potential oscillations are similar : when animals pay attention to a particular location in space , low - frequency oscillations are reduced in the aligned region of area v4 , while high - frequency lfps are increased ( fries et al . , 2001 ) . attention and desynchronization both produce a decrease in trial - to - trial variability and noise correlation of sensory responses ( cohen and maunsell , 2011 ; goard and dan , 2009 ; marguet and harris , 2011 ; mitchell et al . , importantly , these effects only occur when attention is directed into the receptive fields of recorded neurons . this suggests that attention causes an effect similar to desynchronization , occurring locally in the region of visual cortex topographically aligned with the attended location . moreover , recent results suggest that when attention is directed not to a region of space but to a visual feature , variability and correlation decrease in the population that encodes this feature ( cohen and maunsell , 2011 ) , suggesting that a phenomenon analogous to desynchronization has occurred in a spatially distributed neuronal assembly . the mechanisms of cortical state change have been a subject of investigation for many decades . the first , espoused by steriade and colleagues , held that cortical states are modulated primarily via the thalamus . in this view , increased cholinergic input to thalamic relay cells leads to increased tonic firing and thus to a steady glutamatergic drive to cortex that causes desynchronization . the second perspective , espoused by vanderwolf and colleagues , held that cortical state reflected direct neuromodulation of neocortex . recent research provides support for both mechanisms . in the rodent somatosensory system , whisking causes increased tonic firing in thalamus ; blocking thalamic firing with muscimol reduces the cortical depolarization caused by whisking , whereas stimulating thalamus optogenetically causes cortical desynchronization ( poulet et al . , 2012 ) . support for direct cortical neuromodulation comes from the ability of locally applied neuromodulatory blockers to reduce the desynchronization caused by electrical stimulation of nucleus basalis or locomotion ( goard and dan , 2009 ; polack et al . , if attention does indeed consist of cortical state change occurring at a local level , one might expect the two phenomena to have similar circuit mechanisms . in particular , given the role of top - down cortical connections in attention , it has been hypothesized that tonic glutamatergic input from higher - order cortex should also cause desynchronization in rodent cortex ( harris and thiele , 2011 ) . ( 2013 ) performed a number of elegant experiments to study the role of top - down connections from vibrissa motor cortex ( vm1 ) to barrel cortex ( s1 ) . they found that blocking spiking in vm1 using muscimol shifted s1 toward more synchronized states , whereas optogenetically increasing vm1 activity shifted s1 toward more desynchronized states . importantly , the effects on s1 state did not simply reflect the consequence of these manipulations on behavior . as might be expected , suppression or activation of vm1 activity caused a corresponding decrease or increase in the probability and amplitude of whisking . nevertheless , an effect of manipulating vm1 on s1 state was seen even when analyzing data within whisking or nonwhisking periods . one can thus make an analogy between the effects of stimulating vm1 in rodents and the effects of stimulating fef in primates : while strong enough stimulation of these areas causes an overt movement ( saccade or whisking ) , weaker stimulation may instead produce covert effects on sensory processing in lower cortical areas ( attention or desynchronization ) . to investigate the mechanisms by which vm1 stimulation causes desynchronization of s1 , zagha et al . current - source density analysis showed that vm1 stimulation produces sinks in layer 1 and layers 5/6 , corresponding to the major termination zones of these cortical feedback axons . by applying varying concentrations of the glutamatergic antagonist cnqx , they showed that the increase in firing of superficial layer s1 neurons required layer 1 inputs , whereas inputs terminating in deep layers were sufficient for increased firing of layer 5 cells . to investigate whether stimulation of vm1 desynchronizes s1 via a direct pathway , without requiring additional relay stations , they performed additional tests . optogenetic activation of vm1 could still desynchronize vs1 after suppressing activity in vpm thalamus ; and optical stimulation of vm1 axons in s1 could still activate s1 even when the firing of vm1 somas was blocked to eliminate antidromic signaling . these data confirm that , in addition to the classical pathways that modulate cortical states , top - down projections are capable of directly desynchronizing sensory cortex ( see figure 1 ) . previous work has shown that the response to strong , sudden stimuli , such as tone onsets or whisker deflections is robust in both synchronized and desynchronized states ( castro - alamancos , 2004 ; luczak et al . , 2013 ) . however , more subtle , temporally extended stimuli such as natural movies , sustained tones , or repeated whisker deflections are represented more faithfully by the desynchronized cortex ( goard and dan , 2009 ; luczak et al one may again make an analogy with attention : strong , sudden stimuli which are capable of eliciting bottom - up attention are able to drive responses in either state , but faithful representation of weaker stimuli requires top - down attention in the form of cortical desynchronization . ( 2013 ) investigated the effects of vm1-elicited desynchronization on the representation of a sequence of whisker deflections of random amplitudes . consistent with this view , they found that the representation of low - amplitude whisker deflections was made more reliable by vm1 stimulation , but the representation of large - amplitude deflections was less affected . this study has provided very important information on the function of top - down connections in rodent cortex , as well as further support for a close relationship between cortical state modulation and selective attention . first , how specifically can top - down connections modulate sensory cortex in rodents ? in primates , selective attention causes effects analogous to desynchronization in localized areas of cortex and even in anatomically distributed neuronal assemblies ( cohen and maunsell , 2011 ; fries et al . stimulation of primate fef causes increased sensory responses and reduced variability only in topographically aligned regions of v4 ( moore and armstrong , 2003 ) . ( 2013 ) provide a partial answer to this question by showing that vm1 stimulation causes less desynchronization of visual cortex than of barrel cortex . but could projections from vm1 to vs1 selectively target a single whisker barrel or a distributed neuronal assembly ? ( 2013 ) s study , together with previous work , shows that there are at least three circuit pathways that can contribute to cortical desynchronization : direct neuromodulation of cortex , increased tonic activity of thalamus , and increased corticocortical input ( see figure 1 ) . there are reasons to suspect that the space of states is indeed multidimensional , i.e. , that in addition to the common effect of reducing low - frequency fluctuations , different desynchronizing manipulations have diverse effects on cortical processing . 2013 ) showed that strong vm1 stimulation typically increases the firing rates of both of superficial and deep layer neurons . a similar effect was seen due to running in mouse v1 ( niell and stryker , 2010 ) , but desynchronizing brainstem stimulation ( sakata and harris , 2012 ) , or direct cholinergic manipulation of thalamus ( hirata and castro - alamancos , 2010 ) , causes a desynchronization with suppressed superficial layer firing . together with other examples ( harris and thiele , 2011 ) , these results suggest that the different pathways mediating cortical desynchronization have nonidentical effects on cortical processing . given the number of ways that context can affect stimulus perception , one should expect the neural circuits producing nonsensory control of cortex to be highly complex .

sensory cortices receive inputs not only from thalamus but also from higher - order cortical regions . here , zagha et al . ( 2013 ) show that motor cortical inputs can switch barrel cortex into a desynchronized state that enables more faithful representation of subtle sensory stimuli .

Main Text

PMC3543882

gap nonunion presents a major challenge to the orthopedic surgeon , especially when associated with infection , old or active osteomyelitis , and multiple previous surgeries.1 management of the gap nonunion is technically difficult , time - consuming , physically and psychologically demanding for the patient with unpredictable clinical outcome . the problem involves bridging or regenerating areas of bone loss while maintaining limb length and alignment.2 open fractures with bone loss are most common in the tibia due to its subcutaneous anatomical site , and a number of patients have secondary bone loss after surgical debridement of the necrotic bone or osteomyelitis.2 nonunion with infection , bone loss , or both , represents a more complex problem and is better managed with a vascularized fibular graft , free fibular graft , bone transport , or sometimes even amputation.34 the nonunion may persist despite a series of reconstructive procedures , with external fixation , internal fixation ( plate or intramedullary rods ) , bone grafting , plastic surgery , and ilizarov frame application . the patient may require multiple surgeries and sometimes the surgeon is left with no option , but secondary amputation or disarticulation . transposition of the ipsilateral fibula to the tibia ( fibula pro tibia ) was suggested by hahn in 1884 , and was first used successfully by huntington in 1903.56 subsequently , several authors have used fibular centralization in cases of posttraumatic and post - infective tibial defects , osteomyelitis , congenital deformity , and tumors.1711 the fibula is mainly a cortical bone and provides mechanical strength . in this procedure , the fibula is transferred to the tibia as a pedicle graft . due to retained blood supply to one end of the transplant , the graft easily takes up and hypertrophies upon weightbearing over a period of time.67 the aim of this retrospective analysis is to report the midterm results , problems and obstacles with ipsilateral fibular transposition for reconstruction of tibial defects . we retrospectively reviewed the results of 22 patients operated with tibialization of the fibula , operated between 1998 and 2008 . all these patients had segmental tibial loss ( more than 6 cm ) that occurred due to open fracture of the tibia ( n=14 ) , chronic hematogenous osteomyelitis with or without sequestrum ( n=3 ) and following failed / infected previous implant surgery in closed fracture of tibia ( n=5 ) . all these patients had intact or well - united fibula and intact sensation in the sole of the foot . there were 20 males and two females with a mean age of 26.8 years ( range 16 34 years ) . average time of the huntington 's procedure after the initial trauma was 20 months ( range 15 - 30 months ) . all the patients were subjected to the routine investigations for pre - anaesthetic checkup and the x - rays of the affected leg . initially sequestrum and dead necrotic bone were removed and infection was managed by debridement and antibiotics . all the operations were performed under general ( n=7 ) or regional anesthesia ( n=15 ) . seven patients had two - stage procedures and in the remaining cases it was a single - stage procedure . initially sequestrum and dead necrotic bone were removed and infection was managed by debridement and antibiotics . if soft tissues were adequately supple , a single - stage surgery was performed , whereas , in the presence of extensive scarring , particularly in the lateral compartment of the leg , a two stage surgery was preferred . in the two - stage procedure , the proximal end was tibialized in the first stage and the second stage was performed after six - to - eight weeks . through a lateral incision , 34 cm of the proximal fibula was exposed subperiosteally , above the level of the distal part of the proximal tibial fragment . the peroneal nerve was not dissected routinely , except in two cases , where the site of the nonunion was in proximal one - third of fibula . through another anterior one - and - a - half - inch long incision , the distal lateral part of the proximal tibia was exposed and a shallow trough was made on this surface to fit the fibula for better contact . the muscle and neurovascular structures in the anterior compartment were retracted anteriorly and the fibula was shifted into the trough and stabilized with two - to - three 4.5 mm ( n=16 ) cortical screws or 4 mm ( n=3 ) cancellous screws or kirschner 's wires ( n=3 ) . in the single - stage procedure , 34 cm of the distal fibula was also exposed subperiosteally below the level of the proximal part of the distal tibial fragment , through a lateral incision . through another 4-cm long anterior incision , the lateral surface of distal tibial fragment was exposed 2 3 cm below its tip , and a trough was made for fitting the fibula after lifting the neurovascular bundle and muscles anteriorly . it was stabilized using two - to - three 4.5 mm ( n=16 ) cortical screws or 4 mm ( n=3 ) cancellous screws or kirschner 's wires ( n=3 ) . in two cases where the distal tibial fragment was small , an intramedullary pin through the calcaneum , subtalar joints and ankle joint was used to fix the distal end of the fibula and apex of the distal tibial fragment . the soft tissue and skin were sutured and a well - padded plaster cast was applied from the groin to the toe , with the knee in 5 10 flexion , the ankle in 5 external rotation , and the foot in the neutral position or as much dorsiflexed as possible , in cases where there was equinus deformity . guarded weightbearing was started eight - to - ten weeks onward , when the radiological union was observed , and a full leg cast was converted to below leg cast after 16 20 weeks . patients were followed up regularly and assessed clinicoradiologically for bone union , infection , and complications like nonunion of synostosis , implant failure , fracture of fibula , and so on . bony union was said to have occurred when the authors observed the osseous bridging ( uninterrupted external bony borders ) between the fibula and tibia at the synostotic site , with no evidence of gap , in both the anteroposterior and lateral views of the x - rays . patient satisfaction was assessed using a four - level scale ( subjective assessment was done whereby the patients were asked about their satisfaction level with the final outcome ) i.e. whether they were very satisfied , satisfied , fairly satisfied or dissatisfied ; and the pain score was assessed using a 10-point visual analog scale ( vas ) , where 1 represented no pain and 10 unbearable pain . in addition the range of motion in the knee and ankle joint , with the associated deformities and shortening , were also taken into account . the patients had nonunions with gaps ranging from 6 to 16 cm ( mean 11.3 cm ) . fourteen patients had open tibial fractures , three had the sequelae of chronic osteomyelitis , and five had infected nonunion after nailing / plating for closed tibial fractures , requiring removal of the bony segments . in seven patients two - stage procedures were done , where the proximal fibula was shifted at the first stage , followed by a second - stage surgery , after six - to - eight weeks in the distal end . the mean followup after fibular transposition was 5.38 years ( range 3 10 years ) . the mean leg length discrepancy / shortening was 4 cm ( range 2 9 cm ) and the patients were advised suitable shoe raise for ambulation . in five patients , one patient had nonunion at the proximal synostotic site , even after grafting and refixation . however , this patient was mobile with brace and crutches . the average time of union was 12.8 weeks ( range 8 21 weeks ) . full weight bearing on the operated leg with ( n=14 ) or without ( n=8 ) walking aids , was achieved at average 16 months ( range 12 30 months ) . radiographically , hypertrophy of the grafted fibula was observed in all the patients , and in some cases ( n=5 ) , the grafted fibula was as thick as the tibia on the opposite side [ figures 1 and 2 ] . the infection healed in all but one patient , who had some drainage on and off . in one patient , the patient was re - operated upon and fixed with a thin diameter intramedullary rush nail , along with cancellous bone grafting . another patient had screw cut out at the distal end , but could be managed well in the plaster and had malunion [ figure 3 ] . one patient had a fractured fibula after full weightbearing , which was managed conservatively with an above - knee cast , and was united in a four - month period . most of the patients were able to perform their day - to - day activities and routine work , although with some restriction in running , climbing stairs , and doing strenuous work . no significant difference was found in terms of union , fibular hypertrophy , complications , patient satisfaction , and time of weightbearing , in patients with single - stage versus two - stage surgery . at the final followup , ten patients were very satisfied , seven satisfied , and five fairly satisfied [ table 1 ] . the results were evaluated on the basis of our observation that the patients with no pain , more walking distance without aid , less limb length discrepancy , good ankle and knee movements , and performing routine activities efficiently were more satisfied and vice versa . roentgenograms showing ( a ) anteroposterior and lateral views a big gap in the tibia ; ( b ) the fibula was approximated and compressed to tibia above and below the defect with screws ; ( c ) hypertrophy of the fibula after six years , almost three times the original girth of the fibula ( d ) clinical photograph of patient showing weight bearing on hypertrophied fibula roentgenograms showing ( a ) anteroposterior view a large gap in distal tibia and nonunion of fibula with deformity ; ( b ) fibula medialized to tibia above the defect with two screws and in the distal part the deformity was corrected , bone grafted , and stabilized with kirschner wires ( removed in followup as they became symptomatic ) ; ( c ) hypertrophy of fibula after seven years ; ( d ) clinical photograph of same patient showing full weight bearing on hypertrophied fibula ( a ) roentgenogram anteroposterior and lateral views ( b ) clinical photograph of same patient showing complication as cut out of screw in a patient with a big tibial gap clinical details of the patients gap nonunion of the tibia with infection and extensive scarring creates a challenging clinical situation for treatment . the tibia is affected more than the fibula , because of its subcutaneous location , leading to either loss of segment or requiring removal of necrotic bony segment in the process of the treatment , the fibula , being covered by muscles all around , usually escapes segmental loss and also unites easily and takes its continuity back . the option for treatment of such injuries includes a papineau type of cancellous bone grafting in patients with bone gap less than 4 cm , non - vascularized fibula graft from contralateral leg , microvascular fibular transfer , huntington 's procedure , and ilizarov technique . the cancellous bone used in the papineau 's procedure provides limited mechanical strength.91213 the ilizarov technique involves bone transfer and compression - distraction to stimulate the nonunion site . it is a prolonged , time - consuming procedure , with its own complications and obstacles.14 although early weightbearing is possible , and proper realignment of the limb can be achieved , the major drawback of this technique is that prolonged endurance with frame , is not very well accepted by patients with a significant pin track infection rate.215 the use of a free - vascularized fibular transfer from the contralateral limb adds morbidity to the normal limb , is time - consuming , and requires a specialized microsurgical team , which may not be available even in major centers.16 in extensively scarred tissue , considerable dissection of the posterior and lateral compartments to isolate the peroneal vessel is problematic and its anastomosis in such a leg is a gigantic task.1718 free fibular graft from the opposite side leg , in the presence of sepsis , may necrose and even if it survives , it will take a very long time to heal , with a poor functional outcome.9 additionally there is donor site morbidity . the use of the avascular strut allograft is often limited by the available length of the resection , risk of nonunion , fracture , and infection , besides the fear of disease transmission.1019 the presence of infection and extensive soft - tissue loss can be a serious threat to the viability of the limb . however , there has been much debate on the long term disability after amputation , as well as the cost of repeated prostheses . medialization of the ipsilateral fibula ( huntington 's procedure ) can be performed by a trained orthopedic surgeon even in hospitals with moderate infrastructure . a large graft of the ipsilateral fibula raised on a pedicle of the peroneal artery , aligned and fixed to the tibia in its posterior long axis , provide a sound mechanical and biological basis for the union.20 the fibula is surrounded by muscles all around and has abundant vascular supply from the nutrient branch of the peroneal artery and circular anastomosis of the musculoperiosteal vessels , which supports in its hypertrophy and union at the synostotic site.2021 when the fibula is subjected to more than normal weightbearing stresses , it undergoes hypertrophy and becomes an integral part of the static supporting architecture of the leg.7 the fibula placed centrally in the weightbearing axis in the medullary cavity of the tibia seems to be more biomechanically sound than synostosis of the fibula to the tibia in its lateral eccentric position , both in children and adults.21 however , in patients with extensive scarring and fibrosis , it is too difficult to mobilize the fibula centrally , without excessive periosteal stripping , thus jeopardizing the blood supply . furthermore , there is no need to touch or handle the scarred or infected gap area , as surgical incision and procedure is restricted away from the infected nonunion site . even the area of circumferential scarring can be left as such , without performing a substantial plastic procedure like free flap or cross leg flap . ipsilateral fibular transfer is an easy , simple , inexpensive biological procedure that does not require microvascular skills . the reduction in volume of the lower leg that follows the anteromedial shift of the fibula makes skin closure easier , even in cases with scarred tissue . the procedure is restricted to the same limb , unlike those cases in which the opposite fibula is used as a vascularized graft . the shorter operating time and the fact that the graft retains its blood supply may help to reduce infection , improving its chances of union and accelerating the process of hypertrophy.1022 hutington in 1944 popularized a procedure for treatment of tibial defects in children , which he described it as a two - stage procedure.6 we opted for this procedure as a last resort and had good success in salvaging the limbs . in more than half of the cases we could perform the procedure in one stage , where there were supple soft tissues on the anterolateral part of the leg . however , in cases of circumferential scarring and scarification on the anterolateral part , a two - staged procedure was preferred , as the fibula would need extensive release from the lateral surface , jeopardizing its blood supply.23 if it was medialized in the presence of a scar in this area there were chances of screw cut outs , which occurred in two patients in our series . in adults the hypertrophy of the fibula usually took a long time , as compared to children.24 therefore , they needed prolonged protective weightbearing . they were advised to use a leg brace along with a stick , till union between the fibula and tibia occurred . the procedure provided acceptable function to many patients and served as a good enough alternative to amputation , where there was adequate vascularity and intact sensation in the sole . another drawback of this procedure was that these patients were not able to participate in strenuous activities like sports , due to the risk of fractures and a shortened limb , but they could do all their routine work at farms and public transportation , without the help of walking aids . since these cases have severe bone loss in scarred extremity , hence even after other procedure they may still not be able to participate in sports . limb - salvage surgery had psychological and cosmetic advantages over amputation and might be the preferred treatment option in selected individual patients . the huntington 's procedure is still a viable option for salvaging gap nonunions of the tibia . the use of fibular grafts in the management of defects of long bones is a relatively straightforward procedure , requiring no microsurgical expertise . this procedure is effective , but for optimal results the treatment needs to be individualized by the treating surgeon , with due consideration of soft tissue coverage , socioeconomic factors , and the available expertise .

background : gap nonunion that may occur following trauma or infection is a challenging problem to treat . the patients with intact or united fibula , preserved sensation in the sole , and adequate vascularity , were managed by tibialization ( medialization ) of the fibula ( huntington 's procedure ) , to restore continuity of the tibia . the goal of this retrospective analysis study is to report the mid - term results following the huntington 's procedure.materials and methods:22 patients ( 20 males and two females ) age 16 - 34 years with segmental tibial loss more than 6 cm were operated for tibialization of fibula . the procedure was two - staged in seven and single - staged in the rest 15 patients , where the lateral aspect of the leg was relatively supple . in the two - staged procedure , the distal tibiofibular synostosis was performed six - to - eight weeks after the proximal procedure . weightbearing ( protected ) was started in a long leg cast after six - to - eight weeks of the second stage and continued for six - to - eight months , followed by the use of a brace.results:the fibula started showing signs of hypertrophy within the first year after the procedure and it was more than double in breath after the four - year period . full and unprotected weightbearing on the operated leg was achieved at an average time of 16 months . at the final followup , ten patients were very satisfied , seven satisfied , and five fairly satisfied . one patient had persistent nonunion at the proximal synostotic site even after bone grafting and secondary fixation.conclusion:huntington's procedure is a safe and simple salvage procedure and remains an excellent option for treating difficult infected nonunion of the tibia in the selected indications .

I M R D C

PMC3628227

testing of blood - fed mosquitoes plays an integral role in the surveillance for arboviruses to understand the interaction mechanisms between host , vector and reservoir , and to identify and evaluate the role of potential bridge vector species in transmission of pathogens of public health importance . additionally , blood - fed mosquitoes can give us information regarding the feeding preference , seroconversion status of that host , infectivity level of the reservoir host , etc . , which immensely helps researchers in understanding the ecology of arboviruses . sampling a blood - fed mosquito is equivalent to sampling a host - seeking mosquito as well as a wild bird simultaneously . for the purpose of arbovirus surveillance different types of traps are available in the market for trapping mosquitoes which can be basically grouped into three main categories . evs traps collect host - seeking mosquitoes but as they have not yet taken blood - meal the majority of them are sterile / non - infective and non - blood - feds . gravid traps are attractant towards oviposition females after they have digested the blood - meal and are ready to lay eggs . resting boxes are attractant to mosquitoes after they have taken blood - meal and should be ideal for collection of blood - fed mosquitoes . surprisingly , review of the literature revealed that on the us east coast , resting boxes were the least successful for disease surveillance purposes because of their low mosquito trap count . the present study was conducted to evaluate the efficacy of resting boxes in comparison with gravid traps for collecting blood - fed female mosquitoes of different species in the northwestern part of the riverside county of california . three trapping sites were selected in the northwest mosquito and vector control district ( nwmvcd ) of the riverside county of california based upon their resemblance to semi - urban and rural topographies [ figure 1 ] . these sites had a mixed resident population of horses , dogs , birds and humans . one resting box measuring h d w : 6 6 4 [ figure 2 ] was placed at each selected site , in shade under a tree , with its open end facing south . resting mosquitoes were aspirated once a week with in - house - developed battery - operated mechanical aspirator [ figure 3 ] . overnight trappings were done on a weekly basis between july - december 2009 . to maintain consistency trap deployment and mosquito collection mosquitoes were collected the next morning at the same time during cooler hours ( before 9 am ) ; transported to the nwmvcd laboratory over blue ice ; identified up to species level on chill table ; and classified as male , female and blood - fed females . the data was stored in microsoft excel spread data sheet and statistically analyzed for percentage proportion of species , sex and blood - fed females of each species collected per trap type . the brief description about the three study sites is as under : resting box used in the present study in - house - developed battery - operated mechanical mosquito aspirator located in the city of norco ( latitude : 335623.7n , longitude : 1173259.4w , altitude : 504 feet , semi - urban type ) , this site provides indoor and outdoor boarding facility to 55 horses . in addition to horses , there were over 300 chicken roosters ( gallus gallus ) , 10 goats ( capra hircus ) , 4 watchdogs ( corgi mixed breed ) and 8 human attendants living on the property . three sides of this ranch have boundaries with neighboring horse - boarding facilities . located in the city of norco ( latitude : 335411.05n , longitude : 1773312.76w , altitude : 533 feet , semi - urban type ) , this is a horse boarding place with indoor and outdoor riding arenas . thirty - five horses were living in this place with four dogs ( labrador mix breed ) and four humans . the east side of this property has an approach road while the west side of the property has a huge pond filled with waste runaway rainwater . located in the city of mira loma ( latitude : 335826.28n , longitude : 1772959.04w , altitude : 559 feet , rural type ) , this site has outdoor horse boarding with 40 horses in addition to 5 dogs ( 3 : pomerians , 2 : labrador mix breed ) . this site mimics a rural setup with the south end touching the basin of santa ana river and having floodwater wash on the east side . located in the city of norco ( latitude : 335623.7n , longitude : 1173259.4w , altitude : 504 feet , semi - urban type ) , this site provides indoor and outdoor boarding facility to 55 horses . in addition to horses , there were over 300 chicken roosters ( gallus gallus ) , 10 goats ( capra hircus ) , 4 watchdogs ( corgi mixed breed ) and 8 human attendants living on the property . located in the city of norco ( latitude : 335411.05n , longitude : 1773312.76w , altitude : 533 feet , semi - urban type ) , this is a horse boarding place with indoor and outdoor riding arenas . thirty - five horses were living in this place with four dogs ( labrador mix breed ) and four humans . the east side of this property has an approach road while the west side of the property has a huge pond filled with waste runaway rainwater . located in the city of mira loma ( latitude : 335826.28n , longitude : 1772959.04w , altitude : 559 feet , rural type ) , this site has outdoor horse boarding with 40 horses in addition to 5 dogs ( 3 : pomerians , 2 : labrador mix breed ) . this site mimics a rural setup with the south end touching the basin of santa ana river and having floodwater wash on the east side . during this study period ( july to december 2009 ) , 3953 mosquitoes ( 826 blood - fed females ) belonging to three different genera and eight species were collected in various traps . resting boxes ( rb ) collected maximum variety of different mosquito species ( rb : seven , gravid : one , evs : three species ) . quinquefasciatus ( rb : 70.7% and gravid : 97.4% of their total respective mosquito collection ) . quinquefasciatus is one of the local competent vectors for west nile virus ( wnv ) and other arboviruses . during this study period , out of the total 2474 mosquitoes collected from resting boxes , the majority ( 98.3% ) of the females belonged to the culex genus comprising five species ( cx . the proportion of blood - fed females of the culex species collected in resting boxes was 28.8 times more , while of blood - fed females of cx . overall , the proportion ( 63.3% of the total 1273 female mosquitoes collected ) of blood - fed female mosquitoes collected was the highest in resting boxes followed by gravid traps with 2.2% of their individual total female count . species - wise , 63.4% of culex , 50% of culiseta and 61.35% of anopheles females collected in resting boxes were blood - fed while the proportion of blood - fed females of these three genera in gravid traps was very low [ table 1 ] . historically speaking , since the invasion of southern california by wnv in 2003 , it has been detected in pools of cx . resting boxes collected blood - fed female mosquitoes of all the above species except cx . erythrothorax which are commonly found in the wetland area containing cattails ( typha spp . ) and bullrush ( schoenoplectus californicus ) . although in the present study area all the three collection sites were lacking such ecotone , some host - seeking but non - blood - fed cx . the success of resting boxes in collecting such a huge proportion of blood - fed females was due to their strategic locations i.e. they were strategically placed close to a potential source of blood - meals . after taking blood - meal , it is insect physiology that female mosquitoes try to rest at the next available cool dark place for its digestion and production of eggs . a resting box nearby offered such cool dark shade and care was taken to avoid exposure of resting mosquitoes to sunlight from the setting or rising sun by facing the open face of the box towards the south . another important aspect for a higher proportion of blood - fed mosquitoes from resting boxes was the aspiration time . resting boxes were aspirated during early morning cooler hours ( not later than 9 am in the present study area ) as with the rising sun , the temperature also rises , resulting in flying away of blood - fed females . during this study , whenever we were in the neighborhood of resting boxes , they were checked for the presence of mosquitoes during mid - day or afternoon hours . since resting boxes do not have any trap - door or fan to hold back the mosquitoes , they were either found empty or having very few mosquitoes . so if a researcher did not come to collect the mosquitoes from resting boxes during morning cooler hours , he / she would be disappointed with their collection ability . thus , resting boxes proved to be a huge success in collection of blood - fed mosquitoes in the northwestern part of riverside county . during this study period mosquitoes belonging to three different genera and eight species were collected in various traps . quinquefasciatus , which is one of the local competent vectors for wnv and other arboviruses . the proportion of blood - fed females of the culex species collected in resting boxes was 28.8 times more , while of blood - fed females of cx . additionally , in comparison to gravid traps , resting boxes require no batteries or dry ice to operate , generate no hazardous waste , require less man - hours per mosquito collection , have extremely low running cost and are not prone to thefts or vandalisms . these advantages make the choice of resting boxes extremely beneficial to researchers and public health agencies who have limited resources , especially in developing / underdeveloped countries where the epidemics of arboviruses , e.g. dengue , chickungunya , etc .

objectives : testing of blood - fed mosquitoes plays an integral role in arbovirus surveillance and in understanding its interaction mechanisms between host , vector and reservoir . the present study was undertaken to evaluate the efficacy of two different traps ( gravid and resting boxes ) for collection of blood - fed mosquitoes in the northwestern part of riverside county.materials and methods : three trapping sites were selected in the northwest mosquito and vector control district of riverside county , california . at each site resting boxes and gravid traps were set ; and mosquitoes were collected on a weekly basis between july - december 2009 . mosquitoes were transported over blue ice , identified up to species level on chill table , and classified as male , female and blood - fed females.results:during this study period , 3953 mosquitoes ( 826 blood - fed females ) belonging to three different genera and eight species were collected ; resting boxes collecting maximum number ( seven ) of mosquito species . overall as well as individually in each trap kind , the most abundant mosquito species collected was cx . quinquefasciatus . the proportion of blood - fed females of the culex species collected in resting boxes was 28.8 times more , while of blood - fed females of cx . quinquefasciatus was 32.2 times more than the proportion collected from gravid traps.conclusions:overall , the proportion of blood - fed female mosquitoes collected for each species trapped was highest in resting boxes . additionally , resting boxes showed the advantage of extremely low running and maintenance cost ; generation of no hazardous waste ; quick turnaround time in terms of mosquito collection per man - hour spent ; and they were less prone to vandalism or thefts .

INTRODUCTION MATERIALS AND METHODS Valley view ave Corona ave Limonite ave RESULTS DISCUSSION CONCLUSIONS

PMC3532725

in 1652 , pietro marchetti , a surgeon from padua , observed an elongation of the styloid process related to an ossifying process of the stylohyoid ligament . it was eagle ( 1937 and 1949 ) who first defined stylalgia as an autonomous entity related to abnormal length of the styloid process or to mineralization of the stylohyoid ligament complex.1 , 2 eagle s syndrome was described by eagle as styloid process of more than 25 mm long , or when there is calcification of the stylomandibular ligament . it can cause pharyngeal and cervical pain on swallowing , speaking , opening of the mouth , or during movement of the cervical region , sensation of a foreign body in the oropharynx , or pain radiating to the ear.4 , 5 the etiology and pathogenesis of this syndrome are controversial . according to eagle , a previous surgical trauma such as tonsillectomy , or a chronic irritation of the stylomandibular ligament , could cause osteitis , tendonitis , or periostitis , which could lead to reactive ossifying hyperplasia of the styloid process . other authors have suggested hypotheses such as osseous metaplasia of the reichert cartilage residues , persistence of mesenchymal elements capable of producing bone tissue in adults , and ossification of the stylohyoid ligament related to endocrine disorders . the frequency of ossification of the styloid chain styloid process , stylohyoid ligament and greater horn of the hyoid bone has been found to vary from 4% to 30% and to be mostly asymptomatic . eagle estimated the frequency of 34% for symptoms in patients presenting an elongated styloid process . only 4 to 10.3% of patients with an elongated styloid process are reported to experience pain . eagle postulated that there are two types of the syndrome that came to bear his name : the classic type and the carotid artery type . the average length of the styloid process has been shown to be less than 3 cm with the normal length ranging from 1.52 cm to 4.77 cm ; only 11 of 2,000 cranial dissections have detected a styloid process longer than 4 cm . however , the length of the styloid process has not been found to be correlated to the severity of pain . in this report , we describe a case of eagle s syndrome that was characterized by a broad tenderness in left lateral and posterior cervical as well as temporal regions . a 50-year - old female presented to shahed university dental school with a 3-year history of a small swelling on her left lateral pharyngeal region . she also had a sharp pain for one year on the left side of her neck radiating to temporal and posterior cervical regions . the pain had lead to a disability in raising the left arm even for daily activities . patient had sought medical care for the pain several times without a definitive diagnosis or treatment . in the extra - oral examination , temporomandibular joint was found to be normal , and maximum mouth opening was in the normal range . the mineralized process was palpable in the left lateral pharyngeal region , and was associated with tenderness . a panoramic radiograph was taken ( figure 1 ) , and a diagnosis of eagle s syndrome was made based on clinical and radiographic findings . under local anesthesia and intravenous sedation , resection of approximately two - thirds of elongated styloid process was performed ( figure 2 ) . in three day follow - up , patient was completely symptom - free . the styloid process is a slender bony projection arising from the lower surface of the petrous portion of the temporal bone . this process originates from reichert s cartilage of the second brachial arch and persists as a structure running from the base of the skull to the lesser horn of the hyoid , passing between the internal and external carotid arteries . elongation of the styloid process or stylohyoid ligament calcification is a well recognized finding of dental practice . most cases are asymptomatic ; however , a small number of such patients experience symptoms of eagle s syndrome , related to the compression of adjacent nerves and blood vessels . the length of the styloid process is individually variable and according to lindeman , it is 2 - 3 cm long . long styloid process has been defined as more than 4 cm , since in this situation , the highest incidence of eagle s syndrome occurs . but according to recent studies , the normal range of its size varies from 1.52 to 4.77 cm . the elongation length styloid process in the present case was comparable to the above - mentioned findings , as the surgically removed portion was 3 cm and at least 1 cm was left intact . this syndrome is found more often in females and affects subjects more than 50 years old most often , as did in our case . eagle proposed surgical trauma or local chronic irritation could cause consequent reactions like ossifying hyperplasia . later , different hypotheses formulated such as osseous metaplasia of the reichert cartilage residues , persistence of mesenchymal elements capable of producing bone tissue in adults , and ossification of the stylohyoid ligament related to endocrine disorders in women at menopause . in this case , since the patient did not have a history of trauma to the region , the pathogenesis is likely to be related to endocrine disorders of the patient who was at menopause . in cases reported by eagle , pharyngeal discomfort associated with elongated styloid process including vague facial pain , especially while swallowing , turning the head , or opening the mouth was present . however , the present case exhibited a broad tenderness in the neck and left arm , without any facial pain . other symptoms may include dysphagia , dysphasia , otalgia , dizziness , and transient syncope . eagle originally described two distinct syndromes : the classic eagle s syndrome ( classical stylohyoid syndrome ) and carotid artery syndromes ( stylocarotid syndrome ) . the classic eagle s syndrome develops by fibrous tissue formation in the area of a mineralized stylohyoid complex , distorting the cranial nerve endings in the tonsillar fossa following tonsillectomy . it is characterized by dull and persistent pharyngeal pain especially in the tonsillar area , accompanied occasionally by dysphagia and painful swallowing , foreign body sensation , as much as facial and/or cervical pain . a second form of this condition which is not dependent upon tonsillectomy is known as carotid artery syndrome or stylocarotid syndrome . the elongated , mineralized complex is thought to impinge on the internal or external carotid arteries and associated sympathetic nerve fibers . the patient s compliant is cervical pain while turning the head , i.e. when the carotid artery is compressed , which may be radiated to the other sites the artery supplies . in order to diagnose eagle s syndrome , it is necessary to obtain an accurate case history to define the type of the syndrome.12 , 13 in our case , an intense pain in the left lateral region of the neck radiating to the temporal and posterior cervical regions was present . since the elongated apparatus compresses the adjacent nerves , palpation of the neck near the trapezius muscle elicited tenderness and the pain radiated to her ipsilateral arm . these findings directed us to diagnose the second type of eagle s syndrome ( stylocarotid syndrome ) . the treatment for eagle s syndrome may be medical or surgical . medical treatment consists of infiltration of steroids or local anesthetics , or oral administration of carbamazepine . however , the long - term results of medical treatment are not satisfactory . the styloid process may be partially removed by intra- or extra - oral approaches . the extra - oral approach has the advantage of providing better visualization of the operative field , and it is possible to resolve any vascular injury without major complications . however , there are some disadvantages , such as the complexity of the technique that demands longer operating time , and an external scar that is not cosmetically pleasing . the intra - oral approach has advantages over the extra - oral technique in that it is quicker and easier to perform , eliminates the need for extensive dissection considering the risks in the cervical region , and does not leave an external scar . other factors other than only a long styloid process may give rise to eagle s syndrome . an accurate case history and the specialist s intuition are fundamental to the differential diagnosis regarding several other pharyngo - cranio - facial pain disorders . eagle s syndrome should be considered in the evaluation of patients with recurrent throat and neck pain . in the opinion of the authors , surgical treatment should be the first choice with the trans - oral approach being the preferable technique . this approach avoids potential injury to important structures of the maxillo - vertebro - pharyngeal space and is characterized by a short operation as well as an absence of visible scars and reduced hospitalization period .

elongation of the styloid process or stylohyoid ligament calcification is a well recognized finding of dental prac - tice , and an incidence of 4 to 30 percent has been reported on radiographs . rarely , complete mineralization of the stylohyoid ligament or elongation of styloid process has been associated with difficulties in intubation and significant clinical symptoms , which is termed eagle s syndrome , and it exhibits dull or sharp intermittent pain felt along the glossopharyngeal nerve that is located in the hypopharynx and at the base of the tongue and recurrent throat pain or foreign body sensation , dysphagia , or facial pain . additional symptoms may include neck or throat pain with radiation to the ipsilateral ear . in the case presented , the elongated process caused a broad tenderness in left lateral and posterior cervical as well as temporal regions .

Introduction Case report Discussion

PMC2643006

small - angle light scattering ( sals ) techniques offer a number of advantages for the investigation of the nature and behavior of polymer materials . nonintrusive characterization of the flow field of transparent film is an essential step toward an implementation of a structural control system that can regulate the structure development during processing . a combination of in situ birefringence and depolarized light - scattering experiments was used to study the formation of an ordered cylindrical microstructure in a polystyrene - block - polyisoprene copolymer melt under a shear flow field . a new multivariable measurement approach for characterizing and correlating the nanoscale and microscale morphology of crystal - amorphous polymer blends with melt - phase behavior is described . a vertical small - angle light scattering instrument optimized for examining the scattering and light transmitted from structures ranging from 0.5 to 50 m , thereby spanning the size range characteristic of the initial - to - late stages of thermal - phase transitions ( e.g. , melt - phase separation and crystallization ) in crystal - amorphous polymer blends , was constructed . the present paper explores an effective means of characterizing structural changes of poly(vinyl chloride ) ( pvc ) particles during gelation and fusion of pvc plastisols with small - angle light scattering . the sals method was shown to provide an in situ observation of swelling of pvc particles as well as quantitative information of average size of swollen particles while they are in progress of gelation and fusion . in addition , the sals method enabled one to evaluate the relative solvent power of plasticizers from the manner of increase in the correlation distances . recently , there has been increasing interest in understanding the complex processes that take place during the processing of polymer blends [ 46 ] . for this purpose , the small - angle light scattering technique is a very efficient method [ 79 ] . one of the important characteristics of light scattering is that it is a nondestructive test . this makes it possible to follow the time evolution of the phase separation process . the scattering pattern is a direct reflection of orientation , shape , and size of the structure . another advantage is that with an appropriate choice of instruments , one can follow extremely fast events having a low optical contrast [ 10 , 11 ] . for optimum mechanical and optical properties , fine - structured morphologies on a submicron scale are generally desired , as fine dispersions or cocontinuous morphologies with a low volume fraction of one component . the light scattering method is valid for giving information about overall structures but is difficult to use for extracting local information on morphology . recently , a digital image processing technique has shown its utility in analyzing the pattern formation in polymer systems . various light scattering and optical techniques have been investigated as potential candidates for characterization of multiphase polymeric materials . sals is one of the tools that can be used to study a phase separation . it is shown that sals can be used to discriminate between nucleation and growth ( ng ) and spinodal decomposition ( sd ) even when both give a pattern composed of a ring . the gelation mode as a function of time was analyzed for polymers and polymer - carbon fiber composites by using polarized microscopy and polarized light scattering in terms of the formation of polymer spherulites . endoh et al . aimed at elucidating the influence of shear - induced structures ( shear - enhanced concentration fluctuations and/or shear - induced phase separation ) , as observed by rheo - optical methods with small - angle light scattering under shear flow ( shear - sals ) and shear - microscopy , on viscoelastic properties in semidilute polystyrene ( ps ) solutions of 6.0 wt% concentration using dioctyl phthalate ( dop ) as a solvent and tricresyl phosphate ( tcp ) as a good solvent . small - angle light scattering was used to determine the binary interaction parameter in a molten blend of linear polyethylene ( lpe ) ( mw = 52 kg / mol , pdi = 2.9 ) and linear low - density polyethylenes ( lldpes ) based on homogeneous ethylene-1-butene copolymers ( lldpe-1 , 18.7 mol% butane branches , mw = 58.1 kg / mol , and lldpe-2 , 5.9 mol% butene branches , mw = 70 kg / mol ) . our results are significant because they show that the low optical contrast between coexisting phases in polyolefin blends does not limit the determination of phase boundaries by sals as was previously assumed . the quantitative analysis software system can be integrated into the picture archiving and communication system . the combination of advances in charge - coupled - device ( ccd ) fabrication , camera design , digital interface technology , and software development has enabled scientific imaging device manufacturers to overcome the challenges created by the wide range of requirements . the software kits , which include pci device driver and image processing package , are developed based on windows os . in our study , the transparent film is viewed through crossed polarizers to reveal the light scattering pattern . a high - speed ccd camera is used to record the sals signal in real time with different process conditions for subsequent analysis . an optical image real - time analysis software has been developed for accurate modeling and simulation of the structural information of the transparent film . visualization is performed via a high - performance analysis software which allows on - line data acquisition and processing the sals signal . the experiments yield information regarding the trend of the maximum light intensity of the transparent film that can be compared under different processing conditions . wavelets have been used successfully in numerous applications ranging from analysis of flotation froth to countertops [ 23 , 24 ] . lambert et al . aims at developing a more accurate measurement of the physical parameters of fractal dimension , and the size distribution of large fractal aggregates by small - angle light scattering . the theory of multiple scattering has been of particular interest in the case of fractal . outline how the wavelet transform , a hierarchical averaging scheme , can be used to perform both spatial and topological coarse - graining n systems with multiscale physical behavior , such as ising lattices and polymer models . a brief description is given of a methodology that exploits guided ultrasonic waves , lasers and fiber optics , and simultaneous time - frequency analysis to interrogate the state of a material , component , or structure . the propagating ultrasound interrogates the host material in a manner providing a wealth of information when coupled with application of the gabor wavelet transform to broadband dispersive waveforms . recent results are presented pertaining to delamination detection within layered copper / polymer films . wavelet analysis ( wa ) is typically suited in applications where data contains both large and small scales of variation , such as small - angle light signal . we presented a new technique that can be used to analyze the structural information of transparent film on - line and nonintrusively while the material is processing . the technique is based on sals , optical signal real - time analysis software , and wavelet transform method . it is shown that the proposed technique is easy to implement and provides more flexibility , approximating the relation between the intensity signal and the corresponding variation time . applying this method to analyze structural information of transparent film will be of great interest , since it will contribute information on optical prosperities that have been proven to be useful for obtaining deep insights into the molecular and structural parameters of transparent film . in our experiments , the sals signal denoised by wavelet analysis is better than the signal denoised by inducing kf factor . the variation trend of the sals signal becomes clear , and the exceptional sals signal can be accurately detected by wavelet decomposition . in this paper , the method will be evaluated on the basis of light scattering measurements for a small range of scattering angles . these measurements have been taken with a fast ccd line scan camera and appropriate optics . an attempt is made to derive information from these measurements only . with the continuous wavelet transform , sals image analysis methods are used to process the sals signal . the purpose of the present work is to apply the optical image technique to characterize the structural informal of transparent film . in particular , we attempt to on - line the analysis of the light intensity signal . when a light beam passes through a diffusion surface , the variation of propagation direction of the beam can not be determined by the principle of geometrical optics because of scattering function of light beams on diffusion surface . a transparent fluid is an optical phase object . in the experimental set - up for measuring flow fields in fluid flows by using speckle interferometry , the part of the arrangement for the object light beam is just like a subjective photographic system . the speckle displacements can change the intensity distribution of spatial speckle fields . as a result , the intensity distribution of a speckle interferogram is also changed . in this paper , this is advantageous to improve the quality of the speckle interferogram . in our experiments , device performs real - time image analysis of the evolving light scattering signal . the experimental device incorporates an he - ne laser generator , optics , a ccd camera , and a personal computer as its major hardware components . software designed specifically for this application performs real - time analysis of the light scattering pattern . figure 1 shows an experimental set - up for small - angle light - scattering measurement device . a polarizer and an analyzer are placed before and after the polymer melts . the laser light first passes the polarizer , which removes one orthogonal component of the light . the other component of light passes through the polymer melts with resulting scattering due to the orientation of molecular chain . the analyzer removes the second component since it is placed 90 out of phase with respect to the analyzer . therefore , any light that comes out of the analyzer is entirely due to the scattering within the polymer melts . the depolarized intensity of light that passes through the polarizer , polymer melts , and analyzer is recorded and related to the orientation of polymer melts . a ccd camera captures the image , and the total intensity of the image is determined in every 5 seconds . we assume that each column of the following matrix represents the intensities of one observed raman spectrum at the selected wave shifts : ( 1)d=[d1,1d1,2d1,nd2,1d2,2d2,ndm,1dm,2dm , n ] , drmxm . therefore , each spectrum is represented by ( m ) number of spectral intensities , and a total of ( n ) spectrum exists . the dispersion matrix z that represents the variation in the data is computed as ( 2)z = dtd , zrmxm . the diagram of multiple scattering is shown in figure 2 . according to the effect of the sample on the incident light , the sample can be divided into a surface layer , a first scattering layer , a second scattering layer , and so forth . the incident light first impinges on the surface of the sample of the first scattering layer ( random reflection ) of the medium . the second one comes from the first scattering layer ( because of the internal heterogeneity ) and the third in turn . , is the angle of incident light , and d is the thickness of the sample . because of multiple light scattering caused by the thickness of the sample , the light scattering images will be dispersion and distortion models the measurable intensity of scattered light is and the factual intensity of scattered light is have the relationship ( 3)is = kfis,where kf is the correcting factor that can be written as ( 4)kf = e(d / cos )d(cos11 ) { e[d(cos11)1]}1,where is the scattering angle , and is the turbidity of the sample . in a specific point supposed ( the turbidity of the sample ) is the same , so correcting factor kf is only with relation to d ( the thickness of the transparent film ) . spectral analysis and time series methods are the most commonly used signal processing techniques . however , these methods were reported to provide a good solution only in the frequency domain and poor solution in the time domain . like the fourier transform ( ft ) , the wavelet transform ( wt ) can be used to measure the frequency content of a signal . however , the wt differs from the ft in that it yields frequency information in a time - localized fashion [ 35 , 36 ] . this makes the wt far more effective than ft in identifying time - based phenomena . given a time varying signal f ( t ) , wts consist of computed coefficients of inner products of the signal and a family of wavelets . in a continuous wavelet transform ( cwt ) , the wavelet corresponding to scale ( a ) and time location ( b ) is ( 5)a , b=1|a|(tba ) , a , br , a0 , where ( a ) and ( b ) are the dilation and translation parameters , respectively . the cwt is defined as follows : ( 6)cwt{x(t);a , b}=x(t)a , b*(t)dt , where denotes the complex conjugation . in this paper , morlet wavelet function was used , which can be represented as ( 7)(t)=et2/2ejw0 t . its cwt is ( 8)a , b=1ae1/2((tb)/a)2ejw0((tb)/a ) . in ( 8) , ( a ) and ( w0 ) can be changed , each way yields a different type of wt . the sample frequency of the wavelet function and the signal is ( fw ) and ( fs ) , respectively ; the relationship of the parameter a and w0 is ( 9)a = w0fs2fwf0 , where ( f0 ) is the frequency focused signal energy . when a = 2 , b = k2 , j , k z , the wt becomes ( 10)j , k=2j/2(2jtk ) . the discrete wavelet transform ( dwt ) is defined as ( 11)cj , k=f(t)j , k*(t ) , where ( cj , k ) is a time frequency map of the original signal f ( t ) . a multiresolution analysis approach is used in this work , in which ( 12)j , k=2j/2(t2jk2j),dj , k=f(t)j , k*(t ) , where ( j , k ) is a discrete scaling function , and ( dj , k ) is a scaling coefficient . when j = 0 , j , k is the sampled version of the original signal . the dwt computes wavelet coefficients cj , k for j = 1 , , j , and scaling coefficients dj , k are given by ( 13)cj , k=n x[n]hj[n2jk],dj , k=n x[n]gj[n2jk ] , where x[n ] are discrete time signals , hj[n 2k ] are the discrete wavelets , the discrete equivalents to 2(2(t 2k ) ) , gj[n 2k ] are called scaling sequence . at each resolution j > 0 , the scaling coefficients and the wavelet coefficients are ( 14)cj+1,k=n g[n2k]dj , k , dj+1,k=n h[n2k]dj , k . from a mathematical point of view , the structure of computations in a dwt is exactly an octave - band filter band . the terms ( g ) and ( h ) are high - pass and low - pass filters derived from the analysis wavelet (t ) and the scaling function (t ) . hence , cj , k represents the high - frequency components of the signal f ( t ) . the results reported in this study were obtained with polystyrene ( ps ) and high - density polyethylene ( hdpe ) . as they are commercial polymers that melt at high temperatures , they enabled the study to be performed under quasi - industrial conditions . optical system and the polarization analyzer are detected by a ccd connected to a computer . we used two kinds of material ( ps and hdpe ) , three kinds of rotate speed ( 20 rpm , 24 rpm , and 32 rpm ) , five kinds of vibration amplitude ( 0.04 mm , 0.08 mm , 0.12 mm , 0.16 mm , and 0.20 mm ) , and five kinds of vibration frequency ( 5 hz , 8 hz 10 hz , 12 hz , and 15 hz ) . in the experiments , second , we changed the amplitude and frequency of the screw , respectively . at the same time , a ccd camera captured the light scattering image of each processing condition . finally , the optical image real - time analysis software characterized the flow field of polymer melts . the optical image real - time processing software for sals ( see figure 5 ) , which provides a user - friendly interface already familiar to the users , is based on personal pc platform running under ms windows operating system . hardware specifics of a / d and digital i / o boards which are connected on pc motherboard impose some constraints and partly determine real - time software structure , especially disposition of its components at processors . real - time visualization of various scattered light image and light intensity matrices is performed by the host application . the next step is setting parameters using corresponding dialog - boxes provided by the host application . some of these parameters are vibration parameters ( frequency , amplitude ) , display parameters ( sizing grid , display scale , image translation , and rotate angle ) , and other parameters ( rotate speed , material , sampling time ) . the light intensity matrix can be saved on disk of main workstation for further analyses . the software can measure the signal intensity of light scattering images , draw the frequency - intensity curves and the amplitude - intensity curves to indicate the variation of the intensity of scattered light in different processing conditions , and estimate the hydrodynamic parameters . so , the system brought the qualitative analysis of the structural information of transparent film success . figure 6(a ) shows a 3d light intensity image of hdpe at 24 rpm screw rotate speed without vibration . figure 6(b ) shows light intensity image of hdpe at the same rotate speed with vibration frequency of 10 hz and vibration amplitude of 0.20 mm . in comparison with 3d light intensity image without vibration , 3d light intensity image with vibration has stronger light intensity . it is illustrated that the orientation of molecular chain increases because light intensity is proportional to orientation of molecular chain . figure 7 shows the variation trend of maximum intensity projection area with the increase of vibration frequency of ps at 20 rpm rotate speed . as shown in figure 8 , with the increase of vibration frequency , the maximum intensity projection area becomes larger . it is because with the increase of vibration frequency , the molecular orientation of polymer melts also increases . as a consequence , figure 8 shows the relationship between maximum intensity projection area and vibration amplitude of hdpe at 24 rpm screw rotate speed . from figure 8 , it is clear that with the increase of vibration amplitude , the maximum intensity projection area becomes larger . the molecular orientation of polymer melts increases is also the main reason of this optical phenomenon . a signal including noise can be expressed as ( 15)s(i)=f(i)+e(i ) , i=0, ,n1 , where f ( i ) is the real signal , e(i ) is the noise , is the coefficient of the noise , and s(i ) is the signal including noise . the useful signal is included in the part of low frequency , and the noise is included in the part of high frequency . as shown in figure 9 , we used one - dimensional wavelet which decomposed the original signal into three level : ( 16)s = ca3+cd1+cd2+cd3 , where s is the original signal , ca1 , ca2 , ca3 are the approximation coefficients of levels 1 , 2 , and 3 , and cd1 , cd2 , cd3 are the detail coefficients of levels 1 , 2 , and 3 . the performance of wavelet denoising is comparable to that of inducing kf correcting factor . figure 10(a ) is the normal sals intensity signal . figure 10(b ) is the sals signal with multiple scattering noise . sym6 , the multiple scattering noise is eliminated and the signal ( see figure 10(e ) ) is becoming more smooth . from figures 10(d ) and 10(f ) , the residuals by wavelet decomposition are smaller than the residuals by inducing kf factor . wavelet method is more successful in removing multiple scattering noise than that of inducing kf correcting factor . the method of wavelet transform can reduce the ambiguities and accurately analyze the variation trend of the sals signal . as shown in figure 11(a ) , the variation trend of the original intensity signal ( s ) is not clear . sym6 , the variation trend of the intensity is obvious as shown in figure 11(f ) . as shown in figures 11(b)11(f ) , caj ( j = 1 , 2 , 3 , 4 , 5 ) are the wavelet approximation coefficients of levels 15 . it is illustrated that the orientation of molecular chain increases because light intensity is proportional to orientation of molecular chain . the wavelet transform is used to purify the original sals signal and diagnose the exceptional signal . . these coefficients can be feature parameters of the inner structural information of the transparent film for further analysis . as shown in figure 12(h ) , the exceptional signal takes place at 5001000 seconds . the result shows that this technique provides a new tool for diagnosis of exceptional sals signal . we presented a new technique that can be used to characterize the structural information of transparent film on - line and nonintrusively while the material is processing with different conditions . the technique is based on optical sals image real - time analysis software and wavelet analysis . visualization is performed via high - performance analysis software which allows real - time data acquisition and processing the sals signal . it is shown that the proposed technique is easy to implement and provides more flexibility approximating the nonlinear relation between the maximum intensity signal and the corresponding vibration intensity ( frequency or amplitude ) . applying this method to characterize the flow field of polymer melts will be of great interest , since it will contribute information on optical prosperities that have been proven to be useful for obtaining deep insights into the molecular and structural parameters of polymers . in our experiments with the increase of vibration intensity , the light intensity matrix becomes stronger and the maximum intensity projection area becomes larger . because the light intensity is proportional to orientation of molecular chain , it is illustrated that the orientation of molecular chain increases . in conclusion , this technique is believed to be important and promising to on - line characterize the structural information of transparent film in the multiple - scattering regime .

this paper describes an effective on - line polymer characterization technique by using small - angle light - scattering ( sals ) image processing software and wavelet analysis . the phenomenon of small - angle light scattering has been applied to give information about transparent structures on morphology . real - time visualization of various scattered light image and light intensity matrices is performed by the optical image real - time processing software for sals . the software can measure the signal intensity of light scattering images , draw the frequency - intensity curves and the amplitude - intensity curves to indicate the variation of the intensity of scattered light in different processing conditions , and estimate the parameters . the current study utilizes a one - dimensional wavelet to delete noise from the original sals signal and estimate the variation trend of maximum intensity area of the scattered light . so , the system brought the qualitative analysis of the structural information of transparent film success .

1. INTRODUCTION 2. THEORETICAL BACKGROUND FOR SALS 3. WAVELET ANALYSIS FOR MULTIPLE SCATTERING SALS SIGNAL 4. EXPERIMENTAL CHARACTERIZATION FOR THE FLOW FIELD OF POLYMER MELTS 5. CONCLUSIONS

PMC3657082

several therapeutic strategies exist for the treatment of osteochondral lesions ( ocls ) of the talus [ 22 , 37 ] . non - operative treatment consists of cast immobilization and non - weightbearing or weightbearing as tolerated along with a rehabilitation programme [ 13 , 26 ] . recently , platelet - rich plasma and hyaluronic acid injections have also been employed for treating talar cartilage defects . common surgical techniques include arthroscopic debridement with curettage and drilling [ 3 , 19 ] , arthroscopic debridement with microfractures [ 6 , 8 ] , autologous chondrocyte transplantation [ 4 , 5 ] , autologous matrix - induced chondrogenesis [ 7 , 33 ] , and arthrotomy with osteochondral autologous or heterologous grafts . the advantages of arthroscopic procedures for the treatment of ocls in the ankle are that they minimize invasiveness , reduce operating time , and allow a faster rehabilitation period and an earlier return to work in comparison with open procedures [ 10 , 11 , 23 ] . in the young and active population , ocls following sports - related injuries are usually associated with the involvement of the external ligamental complex and with concomitant synovitis [ 24 , 28 , 30 , 35 ] , and thus , all aspects should be addressed during the treatment in order to maximize the outcomes . a four - step protocol , which consists of synovectomy , debridement and microfractures of the ocl , capsular shrinkage , and bracing and non - weightbearing , has been developed in the department of minimally invasive articular surgery of the g. pini orthopaedic institute of milan , italy . the purpose of the present study was to retrospectively evaluate the outcomes of patients with sports - related ocls of the talus . the hypothesis was that a comprehensive four - step approach would lead to a high success rate in patients affected by post - traumatic ocls of the ankle . operative treatment was proposed to subjects with deep ankle pain symptoms during daily living or sports activities who were unresponsive to at least 6 months of non - operative treatment including physical therapy and proprioceptive training . all subjects considered met the following inclusion criteria : age 1855 years , absence of previous ankle surgery , absence of multiple ligament insufficiency , cartilage defects less than 1.5 cm . operative setting and preliminary arthroscopic inspection were made according to those described by the authors in a previous paper . cartilage defects were first debrided with the use of a motorized 4.0-mm shaver ( tomcat , stryker endoscopy , san jose , ca , usa ; formula , stryker endoscopy , san jose , ca , usa).fig . 1operative procedure , including synovectomy ( a ) , debridement and microfracture of the ocl ( b ) , and capsular shrinkage ( c ) operative procedure , including synovectomy ( a ) , debridement and microfracture of the ocl ( b ) , and capsular shrinkage ( c ) after unstable cartilage had been excised and the overlying bone had been scraped , the defect area was curetted , and the area of the defect was perforated according to the technique described by steadman ( fig . the shrinkage procedure was performed using a vapr t side effect thermal electrode ( mitek , westwood , ma , usa ) with a 3.5-mm tip at desication mode , a temperature setting of 70 c , and maximum power of 50 w. with the ankle placed in an everted position , the probe was swept from the anterior talo - fibular ligament ( atfl ) and progressing along the adjacent capsule based on visual observation of the macroscopic tissue contraction ( fig . whenever the atfl presented a complete tear , ligament remnants were debrided before performing thermal shrinkage on the surrounding capsule in the same fashion as described by the authors in their previous study . associate procedures such as the removal of loose bodies or osteophytes were performed if required . at the end of the procedure , the tourniquet was released to visualize bleeding of the ocl site , joint flushing was performed , portals were closed , and a sterile dressing was applied . immediately after the operation , for the first 3 weeks , patients were instructed to walk with non - weightbearing with the use of two crutches . after the removal of the brace , patients were encouraged to regain weightbearing as tolerated and were instructed to perform proprioceptive and complete ankle range of motion ( rom ) exercises . patients were examined pre - operatively and followed up after an average time of 4 years ( sd : 1.1 ) . clinical assessment included the american orthopaedic foot and ankle society ( aofas ) ankle and hindfoot scoring system , karlsson - peterson score , tegner activity level , sefton articular stability scale , and objective examination comprehending rom , anterior drawer sign , and talar tilt test . the test was considered either positive ( maximum manual translation more than 5 mm ) or negative ( manual translation less than 5 mm ) . magnetic resonance imaging ( mri ) patients were also asked to rate the success of their surgery as poor , fair , good , or excellent and to indicate whether they would undergo surgery again . data were analysed using the program spss version 17.0 ( spss inc . , chicago , il , usa ) . paired t - test ( two - sided test and = 0.05 ) was utilized to compare the pre - operative and follow - up status . operative setting and preliminary arthroscopic inspection were made according to those described by the authors in a previous paper . cartilage defects were first debrided with the use of a motorized 4.0-mm shaver ( tomcat , stryker endoscopy , san jose , ca , usa ; formula , stryker endoscopy , san jose , ca , usa).fig . 1operative procedure , including synovectomy ( a ) , debridement and microfracture of the ocl ( b ) , and capsular shrinkage ( c ) operative procedure , including synovectomy ( a ) , debridement and microfracture of the ocl ( b ) , and capsular shrinkage ( c ) after unstable cartilage had been excised and the overlying bone had been scraped , the defect area was curetted , and the area of the defect was perforated according to the technique described by steadman ( fig . the shrinkage procedure was performed using a vapr t side effect thermal electrode ( mitek , westwood , ma , usa ) with a 3.5-mm tip at desication mode , a temperature setting of 70 c , and maximum power of 50 w. with the ankle placed in an everted position , the probe was swept from the anterior talo - fibular ligament ( atfl ) and progressing along the adjacent capsule based on visual observation of the macroscopic tissue contraction ( fig . whenever the atfl presented a complete tear , ligament remnants were debrided before performing thermal shrinkage on the surrounding capsule in the same fashion as described by the authors in their previous study . associate procedures such as the removal of loose bodies or osteophytes were performed if required . at the end of the procedure , the tourniquet was released to visualize bleeding of the ocl site , joint flushing was performed , portals were closed , and a sterile dressing was applied . immediately after the operation , an ankle brace was applied ( air - stirrup , aircast inc . , summit , nj , usa ) . for the first 3 weeks , patients were instructed to walk with non - weightbearing with the use of two crutches . after the removal of the brace , patients were encouraged to regain weightbearing as tolerated and were instructed to perform proprioceptive and complete ankle range of motion ( rom ) exercises . patients were examined pre - operatively and followed up after an average time of 4 years ( sd : 1.1 ) . clinical assessment included the american orthopaedic foot and ankle society ( aofas ) ankle and hindfoot scoring system , karlsson - peterson score , tegner activity level , sefton articular stability scale , and objective examination comprehending rom , anterior drawer sign , and talar tilt test . the test was considered either positive ( maximum manual translation more than 5 mm ) or negative ( manual translation less than 5 mm ) . magnetic resonance imaging ( mri ) patients were also asked to rate the success of their surgery as poor , fair , good , or excellent and to indicate whether they would undergo surgery again . data were analysed using the program spss version 17.0 ( spss inc . , chicago , il , usa ) . paired t - test ( two - sided test and = 0.05 ) was utilized to compare the pre - operative and follow - up status . one patient suffered further malleolar fracture on the operated ankle that was treated surgically , and one patient was lost at follow - up ; thus , 38 ankles were considered at follow - up . the defects were mostly located in the anteromedial portion of the talus ( 31 ankles , 82 % ) , while in 7 cases ( 18 % ) they were located in the posterolateral talar region . fourteen patients practised contact sports before injury ( martial arts , rugby , soccer , basketball , etc . ) , and 24 non - contact sports ( volleyball , running , tennis , etc . ) . twelve practised sport at a competitive level , five of them as professionals , and the other 26 practised sport at the recreational level.table 1patient demographics and anthropometric datamedian age at surgery39 years ( range : 1852)gendermale23female15sideleft17right21mean body mass index ( bmi)26 ( sd : 3 ) patient demographics and anthropometric data an overview of the results is presented in table 2 . the mean aofas and karlsson - peterson score significantly improved at follow - up ( p < 0.001 ) , as well as tegner activity level ( p < 0.001 ) . return to sports occurred at an average of 15.4 weeks ( sd 3.1 ) after surgery . articular stability as assessed by sefton scale documented a significant improvement ( p < 0.001).table 2overview of the results of clinical assessmentpre - operativepost - operativep valueaofas scale ( mean)60.2 ( sd : 7.8)89 . 4 ( sd : 7.1 ) ( < 0.001)karlsson - peterson score ( mean)62.7 ( sd : 9.9)90.1 ( sd : 7.8 ) ( < 0.001)tegner score ( median)4 ( range 25)4 ( range 35 ) ( < 0.001)sefton scale ( mean)2.9 ( sd : 0.9)1.8 ( sd : 0.8 ) ( < 0.001)positive anterior drawer test30 ( 79 % ) 1 ( 2.6 % ) ( < 0.001 ) overview of the results of clinical assessment twenty patients ( 52 % ) complained giving - way symptoms before surgery . objective examination documented a statistically significant improvement in terms of ankle stability and demonstrated negative anterior drawer test in 37 ( 97.4 % ) patients . results were compared to pre - operative manual laxity tests ( p < 0.001 ) . rom was complete in 36 patients : one experienced 5 degrees dorsiflexion limitation and one patient 10 degrees less compared to the contralateral side . concomitant arthroscopic findings are summarized in table 3 : most notably , atfl was found partially or totally ruptured in all subjects.table 3overview of concomitant arthroscopic findings and related treatmentpathologyno . of patients%treatmentsynovitis38100synovectomyatfl lesion38100debridement and shrinkageloose bodies718removaltibiotalar bony impingement513bony spurs resectionatfl anterior talo - fibular ligament overview of concomitant arthroscopic findings and related treatment atfl anterior talo - fibular ligament complications that persisted at follow - up were observed in two patients ( 5.3 % ) who complained of permanent altered sensation of the anterolateral aspect of the foot . mri scans taken at 18 months after surgery revealed filling of the defect in 27 ( 71 % ) cases . in 9 ankles ( 24 % ) , the treated area appeared partially repaired with slight bone marrow oedema which was still present . in 2 ankles ( 5 % ) , thirty - one patients ( 82 % ) rated the success of their surgery as good / excellent . the most important finding of the present study was that the four - step technique presented is a valid therapeutic option for the treatment of osteochondral defects , since it contributes to fibrocartilage regeneration and confirms subjective and objective clinical improvement over a period of up to 6 years after surgery . secondly , the clinical and functional results of this study are similar or superior to those previously reported in patients treated for ocls of the talus with or without associated ankle instability , with no increased risk of complications . recently , several studies documented successful outcomes after bone marrow stimulation for the treatment of ankle ocls [ 6 , 8 , 14 , 27 , 32 ] , with optimal results observed in lesions smaller than 15 mm and in patients without concomitant factors that could negatively affect outcomes ( increasing age , higher body mass index , history of trauma , and presence of osteophytes ) . the four - step operative treatment included synovectomy ( figure 1a ) , debridement and microfracturing of the ocl ( fig . 1c ) , and bracing and non - weightbearing for 21 days . in the sprained ankle , synovitis is a common finding as it represents the reaction to an insult to the lateral ligament complex . synovial hypertrophy was detected and treated in all patients who had suffered previous ankle sprain , similar to how described in a previous study by the same authors . a strong association between ocls and ankle instability in athletes has been previously reported . in all the ankles examined in this case series the resection of the borders of the avulsed ligament and the debridement of the adjacent area allow the stimulation of fibrous tissue and enhancement of the healing process of the atfl complex . this procedure , together with the thermal shrinkage provided by radiofrequency , promotes the shortening of collagenous fibres within the connective tissue and leads to an effective reduction in capsular volume , thus enhancing joint stability [ 2 , 9 , 12 ] . controversy exists regarding the concomitant treatment of ocls and lateral ankle instability , since different rehabilitation programmes exist for the two treatment strategies . patients treated with microfractures would need early ankle motion to promote fibrocartilage healing , while immobilization with cast or brace is crucial to prevent lengthening of the treated tissue after thermal shrinkage . other papers addressing combined lateral ligament reconstruction and treatment of ocls report cast immobilization for three or 4 weeks . in this case series , the positioning of the air - stirrup brace during the first 3 weeks of the post - operative phase permitted the movement on the sagittal plane only , thus allowing earlier mobilization of the ankle without affecting ligament healing . in the patient group considered , the positive results observed in subjective perception and functional scales were also confirmed by objective examination . at follow - up , all patients reported a reduction in pain and a functional improvement . . reported on 35 ankles with isolated ocls of the talar dome which were treated with arthroscopic microfractures . at a mean follow - up of 33 months , however , differently from the cohort of patients reported in the present paper , no instability was found in any of the ankles considered . takao et al . performed arthroscopic drilling of ocls of the talus in 69 unstable ankles that were treated with lateral ankle ligament reconstruction . gregush and ferkel reported on 31 patients who underwent concomitant arthroscopic treatment of an ocl and lateral ankle stabilization in the same sitting after an average follow - up of 7.3 years . the mean aofas score was 89 with no patients complaining of ankle instability at the time of follow - up . in the present study , mri scans taken 18 months after surgery documented complete filling of the defect in 71 % of cases . the mri scans for two patients ( 5 % ) reported incomplete filling of the defect . after 4 years , none of the patients expressed symptoms of giving way or any other complaint of secondary instability . in none of the subjects was there noted persistent deep ankle pain affecting daily activities and causing joint swelling after sport or strenuous activity . three patients ( 8 % ) reached a lower activity level at follow - up . these patients did not return to their previous sport activity because of fear of reinjury . no cases of wound infections nor recurrent instability was reported . in a previous paper on arthroscopic treatment of ankle instability by the same authors , 5 cases ( 5.7 % ) of peroneal nerve injury persisting at follow - up were reported . in the present study , occurrence of neurologic complications limitations of the present study include its retrospective nature , the lack of a control group , and the relatively small sample size . the limited number of patients is due to the fact that this approach requires adopting highly selective indications as criteria for patient selection . osteochondral talar dome lesions are strictly related to soft tissue pathology , and they may coexist because of the mechanism of injury [ 16 , 28 ] . arthroscopic microfracturing itself could be insufficient for the treatment of sports - related ocls of the ankle since usually the presence of cartilage damage implies concomitant involvement of the lateral ligament complex . the four - step procedure as suggested represents a comprehensive approach that can lead to reliable improvement in symptoms in the treatment of post - traumatic ocls ankle lesion in appropriately selected patients . in addition , the four - step approach has multiple advantages compared to open techniques ( low complication rate , less operative time , no donor site morbidity ) and offers similar outcomes in comparison with previously reported case series . a comprehensive four - step protocol as presented represents a safe and clinically effective treatment option in patients with post - traumatic ocls of the ankle .

purposethe purpose of this retrospective study was to assess the treatment of post - traumatic osteochondral lesions ( ocls ) of the ankle with a four - step protocol.methodsthirty-eight patients with at least one mri - documented ocl of the ankle were treated from 2004 to 2010 . median age at surgery was 39 years ( range : 1852 ) . mean lesion size was 1.0 cm2 ( sd : 0.2 ) . all patients underwent a four - step surgical procedure including synovectomy , debridement and microfractures of the ocl , capsular shrinkage , and bracing and non - weightbearing for 21 days . clinical assessment included objective examination , the aofas ankle and hindfoot scoring system , karlsson - peterson score , tegner activity level , and sefton articular stability scale . mri scans were taken 18 months after surgery in all patients.resultsfollow-up examination at an average of 4 years ( sd : 1.1 ) after surgery showed significant improvement of all variables compared to pre - operative values ( p < 0.05 ) . most patients rated their outcome as good / excellent . mri scans taken 18 months after surgery documented completely repaired lesion in 27 ankles , slight bone marrow oedema with partially repaired defect in 9 patients , and visible defect in 2 ankles.conclusionbased on the present results , we propose a comprehensive four - step protocol as a safe and clinically effective treatment option in patients with post - traumatic ocls of the ankle.level of evidenceretrospective case series , level iv .

Level of evidence Introduction Materials and methods Surgical technique Outcome measures Statistical analysis Results Discussion Conclusion

PMC2763127

the field of gene expression analsysis has evolved dramatically in recent years . with a basis in microarray technology and the ongoing transition into next - generation sequencing technologies , the microarray technology provides a way of obtaining huge quantities of genome and transcriptome data ; it has developed from relatively small - scale experiments using in - house platforms and protocols to more robust studies using what are essentially genome - wide commercially manufactured arrays . today , several commercial and academic platforms exist , with different array manufacturing and sample preparation approaches . a common criticism of the field of global gene expression analysis has been its lack of standardised experimental protocols and well - defined reference studies comparing different platforms and procedures . to address these issues , the microarray quality control consortium ( maqc ) performed a study where relative gene expression measurements , using one and two - colour platforms , were compared within and between platforms , as well as with taqman real - time pcr data [ 13 ] . the reference data set , based on standardised commercially available rna sources , was made publicly available , enabling researchers to benchmark new procedures and platforms . one overall purpose for developing new protocols for global gene expression analysis is to improve the quality of the results produced . during recent years the quality of microarrays has been further improved in terms of content and fabrication procedures [ 46 ] , ensuring limited slide - to - slide and batch - to - batch variability . equally important is sample preparation , during which several of the steps may introduce additional variability into the experiment . to minimise variation within an experiment , an experienced technician and a good laboratory protocol are required . in general , the statistical power increases as the variance in the experiment decreases , increasing the likelihood that , for example , differentially expressed genes and subtle differences between samples will be detected . in order to achieve these goals , we present a method where all the major steps in a typical cdna library preparation protocol are automated using a robotic workstation capable of handling superparamagnetic beads . our procedure performs cdna synthesis , purification and subsequent labelling using nhs - modified fluorophores , and is capable of handling up to 48 samples per instrument in parallel . studies have indicated that automation of sample preparation for single - colour microarray experiments can reduce variation and increase throughput [ 7 , 8 ] . we present a similar approach , to benchmark our protocol against the freely available data from maqc to validate our results , and compare the automated approach to our own manual procedure as well as to several academic and commercial platforms . several methods for the purification of nucleic acids are available today , including ethanol precipitation and spin - column - based methods . these methods generally require manual input , thereby limiting the throughput of the experiment and increasing variability . in order to reduce human input and increase reproducibility , an automated protocol for cdna synthesis , labeling , and purification has been developed using a dedicated instrument capable of handling superparamagnetic beads . the procedure is outlined in figure 1 , where the two purification steps are highlighted . for a full run of 48 samples , the current protocol takes about five hours , with most of the time being incubation steps ( e.g. , cdna synthesis takes two hours ) . performing 24 similar reactions manually can be done in approximately the same time , but manual handling introduces variation that can be avoided using the automated approach . the automated protocol outperform the manual procedure when it comes to within - experiment correlation between replicates . an overview of the automated approach for total rna followed by cdna synthesis and labelling in illustrated in figure 1 . this procedure consists of several critical steps that were optimised , including evaporation from open wells , investigation of bead capacity , and proper clean - up from free fluorophores . in conclusion , we show that an automated approach for cdna synthesis performs better than a similar manual procedure when interrogated using dna microarrays . we believe that this conclusion is valid for other readouts platforms as well , including rna - sequencing [ 911 ] . in order to increase the yield from the purification steps briefly , following the first elution , the beads are returned to the supernatant , enabling capture of any residual cdna . this approach increases the yield from each purification step by approximately 15% , which has a significant impact on the overall yield of labelled cdna , given that the process makes use of two purification steps ( data not shown ) . only small amounts of beads are necessary for a high yield : approximately 1.8 g of labelled cdna can be purified using as little as 20 g of beads if there are two captures during each purification step ( figure 2 ) . to facilitate complete capture , we use 150 l of beads , thus purifying approximately 5 g of labelled cdna . precipitation is carried out in an ethanol / teg buffer , after which the bead pellet is washed five times in 80% ethanol . a large number of washes are necessary to remove unincorporated fluorophores , but does not affect the yield of sample cdna ( data not shown ) . elution can easily be performed in a low salt buffer , such as water . in order to test the performance and reproducibility of the automated process , we took advantage of the well - documented model system used by the maqc consortium [ 13 ] . the aim of the macq study was to create a freely - available large reference data set and to compare multiple transcription profiling platforms using a standard set of rna samples . we chose a subset of these platforms for our analysis . for within - experiment comparisons , the two - colour experiments , nci 3 and 4 ( national cancer institute ) , these platforms use the human probe set version 3 from operon , which is also used on the slides in our study . we used the same sources of rna , total human reference rna ( stratagene ) , and firstchoice human brain reference total rna ( ambion ) to evaluate and compare the automated protocol with the manual procedure for cdna synthesis and labelling prior to microarray analysis . ten replicates were run in two separate automated experiments and were compared with ten replicates prepared according to the manual procedure . the differential gene expression between the two sources of rna was measured in these experiments as outlined for the previous macq experiments . figure 3 shows the overall results by comparing the correlation between the m - values ( log2(sample a / sample b ) ) from our experiments ( kthauto and kthman ) and m - values from different experiments in previous studies [ 2 , 3 ] , including only two - colour platforms . the samples from our two automated experiments cluster together closely and cluster less closely to the manual samples . within the automated cluster , two samples ( kthauto_b2 and kthauto_a4 ) are set slightly apart from the other samples but are close to each other ; they are still , however , within the same super - cluster ( blue cluster , figure 3(a ) ) . in both of these samples , the cdna synthesis and labelling procedure yielded about two thirds the amount of labelled cdna compared to the other samples ( this was due to manual handling - related issues ) , while the degree of labelling was about the same ( data not shown ) . this may indicate that the total amount of hybridised material could play an important role in creating reproducible results . the median spearman correlation of all available m - values between samples labelled using the automated protocol was 0.92 and 0.91 for the two parallel experiments ( kthauto1 and kthauto2 , resp . ) , compared to 0.86 for the manual procedure ( kthman , figure 3(b ) ) indicating an increase in well - to - well reproducibility . this is in concordance with previous studies [ 7 , 8 ] . in the wider context , a higher correlation between replicates means greater statistical ability to detect differentially expressed genes . when comparing the top 200 differentially expressed genes , 175 ( 87.5% ) are common between kthauto1 and kthauto2 , which can be compared to 155 ( 77.5% ) between nci3 and nci4 ( supplementary figures 1(a ) and 1(b ) in supplementary material available online at doi:10.1155/2009/396808 ) . in the maqc study , after mapping the probes to refseq and aceview , a complete list of 12091 probes for each platform was created , representing 12091 refseq entries in 12091 entrez genes [ 3 , 14 ] . after filtering out genes with stable expression levels across all experiments ( see section 2 ) , we used this list to calculate the spearman 's rank correlation coefficient between mean m - values from each experiment . when compared to other platforms investigated in the maqc project , the data generated using the automated approach cluster together with the two - colour arrays used by nci . this is to be expected since , as aforementioned , both nci and the arrays used in the automation experiments made use of the human probe set version 3 from operon . as expected from previous studies , all one - colour platforms ( ge healthcare , applied biosystems , agilent one - colour , illumina , and affymetrix , see for more information on these platforms ) cluster together ( figure 4 ) . when comparing the spearman correlation values , the correlation between the kth auto experiments is 0.97 , whereas the highest correlation between the different experiments performed by nci is 0.94 . a higher correlation between experiments ( lower technical noise ) means that samples can be added later , while introducing relatively little variability to the data . here , we chose to take advantage of an efficient in - tip magnetic separation system [ 15 , 16 ] to assess throughput and variance within a gene expression experiment . there are several approaches available for nucleic acid purification using paramagnetic beads ; these include the use of streptavidin - coated beads and a biotinylated primer in the reverse transcription step . however , unless strictly controlled , free biotinylated primers or free biotinylated nucleotides can rapidly saturate the beads , leading to a low purification yield . here we show that , by precipitating the first - strand cdna on carboxylic acid coated paramagnetic beads , a high yield can be achieved in the purification steps , giving a large quantity of purified product . using this automated procedure , thus , automation of cdna library preparation for analysis on microarrays or using massive - scale sequencing [ 911 ] leads to decreased variance and greater statistical power to detect for example differentially expresssed genes or alternative splicing patterns . we describe an automated platform that can be used to increase the robustness of the overall performance of cdna library preparation , including target labelling . the maqc study indicated two types of variation : array content and array performance , the latter relating to the manual variation associated with performing the experiments . we show that this variation can be minimised by using an automated procedure , employing a standard microtiter plate . the number of samples that can be run in parallel can also be increased using this protocol from one up to 48 . a single row in the microtiter plate ( 1 to 12 samples ) takes approximately 4 hours and 40 minutes and the time increase for running four rows ( 48 samples ) is marginal . some modifications , other than changing the purification method , were necessary when automating the process . these were mainly due to reactions associated with the microtiter wells , which have no lids , so that evaporation occurs and is pronounced at elevated temperatures . the amount of evaporated water at a given temperature , however , is relatively constant . during the initial total rna denaturing step , about 3.5 l of water evaporates , and this prior to optimisation , the amount of cdna obtained from the first strand synthesis on the workstation was approximately 20% less than from synthesis in closed tubes . this effect was completely eradicated when water was added at regular intervals during the cdna synthesis ( data not shown ) . the adjusted volume of the samples was determined empirically . to investigate the performance of our automated procedure , we chose dna microarrays because of the access to a well established reference set of rna samples and the standardized statistical procedure to address and demonstrate technical variation . in general , well - to - well correlation increased when compared to a manual protocol . correlation between different experiments ( i.e. , the same experiment performed at different days ) , we noted a higher correlation using our automated procedure when compared to the procedure carried out by nci . our results indicate that automation of sample preparation improves technical reproducibility , and should be general indifferent of the platform for readout , dna microarrays or rna - sequencing . in all experiments , total human reference rna ( stratagene ) ( sample a ) and firstchoice human brain reference total rna ( ambion ) ( sample b ) were used . the two rna samples were labelled as described below , and subsequently hybridised to microarrays . in each experiment , a total of 10 microarrays was used . on five of these , sample a labelled with cy3 and sample b labeled with cy5 were hybridised . on the remaining five slides , the dye setting was reversed , giving a dye - balanced direct design , corresponding to the two - colour microarray experiments that were carried out within the maqc study . using the optimised protocol , we performed two experiments following the automated approach and one following our manual procedure . for the automated sample preparation , the process from total rna to purified labelled cdna was performed on a magnatrix 1200 ( magnetic biosolutions , sweden ) robotic workstation . this workstation is equipped with a heating block and a system for in - tip magnetic separation . for initial cooling in the instrument the protocol takes approximately 4 hours and 40 minutes for a single microtiter row of 12 samples , and only slightly longer for the double amount of samples . twenty micrograms of total rna was primed with 5 g of random hexamers ( invitrogen , usa ) in a total volume of 22 l depc - treated sterile deionised water . after denaturing the rna for 10 minutes at 70c , the mixture was cooled in a pcr - cooler ( eppendorf ) in the instrument , maintaining 0c in the wells for 5 minutes prior to starting the first strand cdna synthesis . after this step , approximately 3.5 l of liquid had evaporated , resulting in a total volume of about 18.5 l . a volume of 11.5 l of a reverse transcription master mix was then added , setting the reaction composition to 1x first - strand buffer ( invitrogen ) , 0.01 mm dtt ( invitrogen ) , 0.4 mm aminoally l - modified dutp ( biotium ) , 0.1 mm dttp ( sigma - aldrich ) , 0.5 mm datp , dctp , and dgtp ( sigma - aldrich ) and 400 units of superscript iii reverse transcriptase ( invitrogen ) . an initial incubation of 10 minutes at room temperature ( approximately 22c ) was followed by two hours at 46c . during the incubation , 2.5 l depc - treated sterile deionised water was added every 15 minutes to compensate for evaporation . the cdna synthesis reaction was stopped by the addition of 3 l 0.2 m edta after which rna was hydrolysed by the addition of 5 l 1 m naoh together with incubation at 70c for 15 minutes . ph neutralisation was achieved by the addition of 15 l 1 m hepes , ph 7.0 , after the hydrolysis step . prior to purification , the storage buffer was removed from 150 g of dynabeads myone carboxylic acid ( invitrogen ) by magnetic separation . the beads were resuspended in the neutralised cdna synthesis mixture , after which three volumes ( 150 l ) of binding buffer , containing 80% ethanol and 6.7% teg , were added . after a single 10-minute incubation at room temperature , the beads were collected from the supernatant and washed five times in 45 l 80% ethanol . elution was carried out by resuspending the beads in 10 l sterile deionised water and mixing for 1 minute . to increase the yield , collected beads were resuspended in 5 l of sterile deionised water and returned to the supernatant for a second capture . the incubation , washing and elution steps were then repeated as described above , resulting in a final volume of 20 l . in order to set the ph to facilitate coupling to fluorophores , 2 l 1 m nahco3 , ph 9.0 , was added to the eluted cdna , after which the mixture was transferred to a 5 l aliquot containing one tenth of the contents of mono - functional nhs - ester cy3 or cy5 dye tubes ( ge healthcare ) dissolved in dmso ( sigma - aldrich ) . after a single 30-minute incubation at room temperature , 2 l of 1 m hepes , ph 7.0 , was added to neutralise the mixture prior to purification of fluorophore - coupled cdna using carboxylic acid coated paramagnetic beads as described above . briefly , the pre - cdna synthesis incubation was performed at 25c instead of room temperature , and the purification steps were carried out using the minelute cleanup system ( qiagen ) according to the manufacturer 's recommendations . differences include changing the recommended washing buffer before labelling the cdna to 80% ethanol and the elution buffer to sterile deionised water . moreover , the neutralisation step was carried out using 5 l 1 m hcl . the arrays used were provided by the kth microarray center ( http://www.ktharray.se/ ) , and consisted of the human genome oligo set version 3.0 ( operon ) printed in 30% dmso onto ultragaps slides ( corning ) . after printing , the slides were uv cross - linked at 150 mj / cm . the slides were prehybridised for 30 minutes at 42c in a prehybridisation solution consisting of 5x ssc , 0.1% sds ( sigma - aldrich ) and 1% bsa ( sigma - aldrich ) to avoid unspecific hybridisation to the glass surface . the slides were subsequently washed in water and isopropanol ( sigma - aldrich ) and dried using a slide centrifuge . the two samples were dye - balanced to make sure that equal amounts of dye were hybridised in each channel , then they were pooled and denatured ( 3 minutes at 95c ) in a hybridisation mixture containing 50% formamide ( sigma - aldrich ) , 5x ssc and 0.1% sds ( sigma - aldrich ) , 20 g human cot-1 dna ( invitrogen ) , and 20 g yeast trna ( invitrogen ) . the 65-l hybridisation mixture was then cooled on ice for 1 minute and applied under a cover slip ( erie scientific company ) , placed on top of the printed array ; it was then hybridised for 24 hours at 42c in a water bath . following hybridisation , the slides were washed with increasing stringency using 2x ssc and 0.1% sds at 42c , followed by 0.1x ssc and 0.1% sds at room temperature and finally by five repeated washes with 0.1x ssc at room temperature . the arrays were scanned at 10-m resolution using an agilent g2565ba scanner ( agilent technologies , usa ) , with the photo multiplier tube set to 100% for each laser . the images thus acquired were analysed using the irregular gridding algorithm in genepix pro 5.1 ( axon ) and the resulting data were imported into the r environment for statistical computing and visualisation . the raw data were extracted from the median foreground intensity for both channels and subsequently filtered on the basis of flags ( features either not found by the image software , or marked as bad spots ) , a low signal compared to the local background and saturated signals . data normalisation was carried out using a block - wise lowess approach , included in the aroma package and a per - feature mean log2-ratio ( m - value ) across all slides was calculated using the limma software package . the data was compared with relevant parts of the maqc data set , using clustering and correlation analysis tools in the kth software package . mean fold change and p - values for each platform were calculated , and all contrasts set up between all platforms using the limma software package . the files containing raw data were made publicly available in the arrayexpress repository , with experiment number e - tabm-749 . for intraplatform comparisons , a subset of platforms with the same probe set ( operon human probe set version 3 ) and experimental design from maqc was used . features were mapped using the oligonucleotide i d , which is a unique identifier for each oligonucleotide sequence . for interplatform comparisons , the m - values for 12091 genes common to the platforms were extracted , as well as a subset of 906 genes with available taqman real - time pcr - data ; these were compared to all the microarray platforms within maqc . genes for which the interquartile range was lower than 0.5 were removed from the analysis , in order to reduce background noise from genes with stable expressions levels across all tested platforms . in addition to hybridising the labelled cdna samples to microarrays , the binding capacity of the carboxylic acid - coated paramagnetic beads was measured . the number of washes after binding the cdna was optimised , after which elution was carried out and cdna and fluorophore concentrations were determined using a nanodrop nd-1000 instrument ( nanodrop ) .

background . several technologies , such as in - depth sequencing and microarrays , enable large - scale interrogation of genomes and transcriptomes . in this study , we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation , capable of handling superparamagnetic beads . here , we describe a fully automated procedure for cdna synthesis and labelling for microarrays , where the purification steps prior to and after labelling are based on precipitation of dna on carboxylic acid - coated paramagnetic beads . results . the fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility . we compare our results to a manual sample preparation procedure and , in addition , use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures . conclusions . we demonstrate , in an automated gene expression microarray experiment , a reduced variance between replicates , resulting in an increase in the statistical power to detect differentially expressed genes , thus allowing smaller differences between samples to be identified . this protocol can with minor modifications be used to create cdna libraries for other applications such as in - depth analysis using next - generation sequencing technologies .

1. Introduction 2. Results 3. Discussion 4. Materials and Methods

PMC4580703

during the cardiac device implantation procedure , selection of the appropriate vein puncture site is important to reduce the risk of vascular and lead - related complications.1 ) nerve injuries that arise during device implantation procedures are sparsely reported in the literature.2)3 ) here , we report a case of brachial plexus injury caused by indwelling transvenous pacing leads . a 64-year - old male patient underwent cardiac resynchronization therapy ( crt ) device with defibrillator implantation for dilated cardiomyopathy and recurrent ventricular tachycardia . during the implantation procedure , it was difficult to determine the location of the left axillary vein as although the left subclavian vein was punctured and a guide wire could be inserted , we could not insert a peel - away introducer across the costoclavicular junction and handle the inserted right ventricular lead due to mechanical resistance at the costoclavicular junction . to avoid the risk of difficult lead handling and future subclavian crush syndrome , a second puncture was performed at a more lateral site approximately two fingers away from the initial puncture point . although a puncture needle should be inserted almost vertically in order to reach the lateral axillary vein near the junction of the cephalic and brachial veins , we were able to insert peel - away introducers and the left ventricle ( lv ) and right atrium ( ra ) leads without any difficulty . the lv and ra leads were positioned where the optimal values of sensing and pacing parameters were obtained . after starting biventricular pacing , the episodes of ventricular tachycardia decreased remarkably , suggesting successful electrical remodeling . the patient was discharged without overt complications . however , two weeks after the implantation of the crt device , the patient started complaining of " electric shock - like " pain in the left axillary area radiating to the medial border of the left arm . the patient described the pain as being usually triggered by active shoulder movements , especially when pulling up his pants . during physical examination , typical pain in the left axillary area was reproduced whenever his left shoulder was passively abducted more than 60 degrees . chest computed tomography scans showed the lv and ra leads running together into the lateral axillary vein along the lateral side of the pectoralis minor muscle causing a curvature with an acute angle ( fig . fluoroscopic examination in the supine position showed that the lv and ra leads were positioned at an acute angle directing towards the left brachial plexus whenever the patient 's shoulder was passively abducted more than 60 degrees ( fig . 2 ; video in the online - only data supplement ) . severe left axillary and radiating arm pain recurred whenever the lv and ra leads formed such an acute angulation on fluoroscopic examination . analgesics and antibiotics were prescribed to control the pain and to treat the possible subclinical device - related infection . however , the patient complained of gradual worsening of the pain despite continued administration of high - dose pain killers . six months after implantation of the crt device , the patient was readmitted for adjustment of lead angulation due to worsening of the left axillary and radiating arm pain which impeded the patient 's daily physical activities . due to the fact that the lv and ra leads were inserted across the pectoralis major and minor muscles into the lateral axillary vein , which was located deep in the patient 's chest , correction of the lead angulation by generator repositioning was technically impossible . operators had to move the entry site of the lv and ra leads from the distal to the proximal axillary vein using the cut - down method . under general anesthesia , the pectoralis minor muscle was cut and the axillary vein was exposed . after disconnection of the lv and ra leads from the generator , we attempted to manually extract the disconnected leads through the transverse incision line . however , the leads were tightly adhered to the axillary venous wall , and the possibility of vascular injury and lv lead malpositioning due to extraction force was considered . finally , we had to open the left axillary vein to separate the leads safely . the left axillary vein was incised longitudinally from the initial insertion site of the lv and ra leads to the more proximal site which was 3 cm away ( figs . 2d and 3b ) . separated leads were moved to the proximal site through the longitudinal incision line and the remaining incision lines were closed . after adjusting the lv and ra lead insertion site , acute angulation was not observed during passive shoulder abduction more than 60 degrees on fluoroscopic examination ( fig . although curvatures of the lv and ra leads were slightly modified after the correction surgery , there was no significant change in the lv lead tip location and lv capture threshold . neuropathic pain decreased remarkably two weeks later and analgesic agents could be withheld two months later . the ranges of passive and active shoulder movements increased gradually but were nearly completely normalized at six months after the surgery . during the cardiac device implantation procedure , selection of the appropriate vein puncture site is important to avoid the risk of vascular or pacing lead - related complications.1 ) in the present case , to avoid the risk of subclavian crush syndrome , the lv and ra leads were inserted into the lateral axillary vein which is close to the brachial plexus , under the guidance of contrast venography.4 ) unfortunately , the inappropriately inserted crt device leads caused brachial plexus injury . although transvenous pacing lead - induced nerve injury is not a frequent complication seen in clinical practice , this possibility should be kept in mind by the operators . if this type of complication occurs , correction surgery for the lead insertion site using the cut - down method can be considered as a therapeutic option . understanding the vascular anatomy with adjacent nerve structures and carefully selecting the vein puncture site are necessary for minimizing the risk of pacing lead - induced nerve injury .

a 64-year - old male patient underwent cardiac resynchronization therapy ( crt ) device implantation via the axillary venous approach . two weeks later , the patient started complaining of " electric shock - like " pain in the left axillary area . during physical examination , typical pain in the left axillary area was reproduced whenever his left shoulder was passively abducted more than 60 degrees . fluoroscopic examination showed that the left ventricle ( lv ) and right atrium ( ra ) leads were positioned at an acute angle directing towards the left brachial plexus whenever the patient 's shoulder was passively abducted . brachial plexus irritation by the angulated crt leads was strongly suspected . to relieve the acute angulation , we had to adjust the entry site of the lv and ra leads from the distal to the proximal axillary vein using the cut - down method . after successful lead repositioning , the neuropathic pain improved rapidly . although transvenous pacing lead - induced nerve injury is not a frequent complication , this possibility should be kept in mind by the operators .

Introduction Case Discussion Supplementary Materials

PMC4562171

in the seventies , dr . harald zur hausen firstly postulated the link between human papillomaviruses ( hpvs ) and cervical cancer : studies to develop an anticancer vaccine followed . approximately 70% of cervical cancers worldwide are associated with two high - risk hpv types ( 16/18 ) [ 1 , 2 ] and almost 90% of genital warts are associated with two low - risk hpv types ( 6/11 ) . each year around 500,000 women develop invasive cervical cancer worldwide , with 83% of new cases and 85% of deaths occurring in developing countries [ 3 , 4 ] . risk factors associated with hpv infection are younger age at first coitus , higher number of sexual partners , smoking cigarettes , and history of herpes simplex virus infection [ 5 , 6 ] . some 75% of sexually active women develop a hpv infection , more frequently soon after their sexual debut : the majority of these infections ( between 70% and 90% ) spontaneously clear [ 810 ] . a minority progress from acute infection to cervical cancer , a process taking decades and going through precancerous lesions named cervical intraepithelial neoplasia ( cin ) of increasing severity , from cin1 to cin3 ; spontaneous regression of the lesions is possible at any point [ 4 , 8 ] . incidence of genital warts is less precisely known , due to lack of data on the general population , but it is estimated to be around 1% . based on the results of five randomized controlled trials ( rcts ) involving 40,000 women [ 1117 ] two hpv vaccines entered the market . the quadrivalent vaccine against hpv6/11/16/18 was approved by the fda and the ema in 2006 [ 18 , 19 ] , whereas the bivalent vaccine against hpv16/18 was first approved in europe in 2007 and then in the usa in 2009 . soon after , several western countries such as the usa , australia , and five european states started national immunization campaigns targeting adolescent girls . the number of countries adopting the vaccines has since increased : in april 2014 , 23 out of 29 european countries were reported to have implemented it , budgetary constraints being one relevant obstacle for the remaining countries . the primary target of hpv vaccination is adolescent girls aged 11 to 13 years , with some minor differences in national recommendations : in the usa routine vaccination is recommended at age 11 or 12 years with quadrivalent or bivalent vaccine for females and with quadrivalent vaccine for males in a 3-dose schedule during a 6-month interval ; in the uk hpv vaccine is recommended for girls under 15 years of age and consists in two injections spaced at least six and not more than 24 months apart . both vaccines contain human papillomavirus l1 self - assembling virus - like particles and are not infectious . differences between the two vaccines are the number of hpv types included and formulation of the adjuvant ( table 1 ) possibly leading to different vaccine efficacy ( ve ) [ 3638 ] . head - to - head comparisons between the two vaccines are still exclusively based on immunogenicity [ 38 , 39 ] , although an immune correlate of protection has not yet been established . three meta - analyses , published when vaccines were marketed , showed comparably high efficacy of the two vaccines against precancerous lesions associated with hpv16/18 [ 30 , 41 , 42 ] . the meta - analyses subsequently published [ 43 , 44 ] have confirmed the high efficacy of the vaccines against lesions associated with hpv16/18 , but they did not provide information about ve against any cervical lesions irrespective of hpv type , nor did they discuss possible differences in terms of efficacy of the two vaccines . thus , our systematic review that includes studies with longer follow - up aims to assess differences between the two vaccines from a public health perspective , considering all cervical lesions . the systematic review was developed based on a prespecified protocol ( protocol number farm8n2zfl ) funded by the italian medicines agency ( aifa ) within a program of independent research on drugs . the prisma ( preferred reporting items for systematic reviews and meta - analyses ) statement guided the content and reporting of the review . published and unpublished rcts comparing any of the two hpv vaccines versus placebo or any other control were considered for inclusion . we exclusively considered studies involving women , irrespective of age at enrolment . as for protocol , primary outcome measures were cervical lesions ( i.e. , cervical cancer , cin2 , cin3 , and ais ) associated with any hpv type and cervical lesions exclusively associated with hpv16/18 occurring in three study populations : according to protocol population ( atp ) , the general population of vaccinated women ( total vaccine cohort ( tvc ) ) approximating all women regardless of status of hpv infection at vaccination , and a selected population of women seronegative for hpv16/18 and hpv dna negative for 14 oncogenic hpv types , approximating the group of young adolescent girls targeted in the national immunization campaigns ( tvc - nave ) . in this paper only data related to cervical lesions associated with any hpv type occurring in the tvc and in the tvc - nave population are reported , as the other data are not relevant from a public health perspective . trial identification : we searched the cochrane library ( to issue 3 , 2014 ) , medline ( to march 2014 ) , and embase ( to march 2014 ) using keywords and mesh terms as reported in annex 1 online , in combination with a highly sensitive filter for identifying rct . reference lists of relevant papers were also examined to identify additional studies . for unpublished rcts , we searched the internet for prepublication study presentations at conferences or meetings . moreover experts in the field and vaccine manufacturers were contacted for further information ( unpublished studies and single patient data ) . two review authors independently screened abstracts of potential studies and retrieved full articles for those deemed eligible . two reviewers carried out independent assessment of citations retrieved . when more than one publication reported the same trial , the one with a longer follow - up was selected . quality of trials was assessed using the criteria outlined in the cochrane handbook and included the assessment of ( i ) generation of the randomization sequence , ( ii ) quality of the allocation concealment , ( iii ) completeness of follow - up , and ( iv ) blinding of the outcome assessment . based on quality assessment the risk of bias of the included trials was defined as low , high , or unclear . to event data the hazard ratio ( hr ) was used as a measure of association . the results were summarized by using the inverse of variance method and the random effects model . point estimates as well as their 95% confidence intervals ( 95% ci ) were calculated and represented by the forest plot . vaccine efficacy ( ve ) was calculated as ve(% ) = ( ru rv)/ru 100 , where ru is the rate of disease in the unvaccinated and rv is the rate in the vaccinated . the equation can be rewritten to use the hr in the following way : ve(% ) = ( 1 hrv / u ) 100 , where hrv / u is the hr of the vaccinated versus the unvaccinated . the following prespecified subgroup analyses were planned : geographical areas ( europe , africa , asia , north america , and south and central america ) : the literature suggests that prevalence and circulation of hpv high risk types varies according to geographical areas [ 4951].vaccine type ( bivalent , quadrivalent ) : data on ve can be influenced by type of vaccine used as differences between the two formulations could be not negligible . geographical areas ( europe , africa , asia , north america , and south and central america ) : the literature suggests that prevalence and circulation of hpv high risk types varies according to geographical areas [ 4951 ] . vaccine type ( bivalent , quadrivalent ) : data on ve can be influenced by type of vaccine used as differences between the two formulations could be not negligible . study identification and selection process is outlined in figure 1 . of the 726 records initially identified , 3 were duplicates and 670 were excluded based on title and abstract assessment . the most common reasons for exclusion were the following : reports were not rcts , did not assess the outcome of interest , were not related to oncogenic hpv or to vaccine administration , or were studies reporting exclusively laboratory or immunogenicity data . we assessed the full text of 53 articles and excluded 44 ( reasons reported in figure 1 ) . thus nine reports [ 2629 , 3135 ] , corresponding to five registered protocols [ 5256 ] , were included in the systematic review : in three trials ( 20,797 women ) the bivalent vaccine was used ( patricia trial being the larger study ) [ 2729 ] and in two trials ( 17,622 women ) the quadrivalent vaccine was assessed ( future i and future ii trials ) . five publications reporting subset of data of the above - mentioned trials relating to specific geographical areas were also included [ 3135 ] . the data of the phase iii trials included in our meta - analysis have a mean follow - up of 4 years for the bivalent trial and 3.6 years for the quadrivalent trial , longer than that of the systematic reviews with meta - analysis published up to now eligible participants were healthy , not pregnant women aged between 15 and 26 years , with 6 or less lifetime sexual partners and no history of abnormal pap smear at enrolment . risk of bias was low in 4 out of 5 trials : generation of the randomization sequence , quality of allocation concealment , completeness of follow - up , and blinding of outcome assessment were adequate . risk of bias was unclear ( generation of the randomization sequence and allocation concealment were not described ) in one smaller trial conducted in japan ; as the japanese trial provided only data on cin2 + lesions exclusively associated with hpv16/18 , its results are not reported here . characteristics of the women enrolled in the trials used in this meta - analysis are reported in table 3 . pooling of the data was possible for cin2 + [ 2628 ] , cin3 + [ 26 , 27 ] , and ais [ 26 , 28 ] . data for each outcome are presented below for the tvc and the tvc - nave cohorts . the pooled hrs for cin2 + lesions associated with any type of hpv in the tvc and in the tvc - nave are reported in figure 2 . corresponding values of ve were 26% ( 95% ci : 11 , 39 ) in the tvc [ 26 , 27 ] and 58% ( 95% ci : 35 , 72 ) in the tvc - nave [ 2628 ] . results suggested substantial heterogeneity among bivalent and quadrivalent vaccines : i test was 68.7% and 66.4% in the tvc and in the tvc - nave , respectively . the pooled hrs for cin3 + lesions associated with any type of hpv in the tvc and in the tvc - nave are reported in figure 3 . corresponding values of ve were 32% ( 95% ci : < 0 , 56 ) in the tvc [ 26 , 27 ] and 78% ( 95% ci : < 0 , 97 ) in the tvc - nave [ 26 , 27 ] . results suggested substantial heterogeneity among bivalent and quadrivalent vaccines : i test was 86.3% and 90.7% in the tvc and in the tvc - nave , respectively . the pooled hr for lesions associated with any type of hpv was 0.31 ( 95% ci : 0.140.70 ) in the tvc [ 26 , 27 ] , corresponding values of ve being 69% ( 95% ci : 30 , 86 ) . ais cases in the tvc - nave cohort were zero in the vaccine group and ten in the placebo ; thus only an approximate estimate of the efficacy was possible . the pooled hr for lesions associated with any type of hpv was 0.01 ( 95% ci : 0.010.22 ) resulting in a ve of 99% ( 95% ci : 78 , 99 ) [ 26 , 27 ] . although formally required by the scientific advisory unit of ecdc in stockholm , the two manufacturers did not provide single patient data ( the authors received only partial data unsuitable for the analysis from gsk and no answer at all from sanofi pasteur msd ) . five published papers [ 3135 ] reported data according to geographical areas . pooling of the data was not appropriate since geographical areas definition differed ( table 4 ) . since their introduction into the market , the effectiveness of the two vaccines against cervical cancer , based on first published data [ 1117 ] , has been subject of debate . enthusiastic positions assumed that if vaccines are immunogenic and prevent infections associated with hpv16/18 they also prevent cervical cancer and therefore should be widely used [ 5759 ] . uncertainty was related to the following issues : correlation between immune response and clinical outcomes , need for a booster dose , replacement with other oncogenic strains , and possible reduction of pap - test screening among the vaccinated [ 6065 ] . our systematic review highlights that , for precancerous lesions ( cin ) , the only available proxy of cervical cancer and heterogeneity among pooled studies is substantial ( figures 2 and 3 ) : the bivalent vaccine shows higher efficacy against precancerous lesions . we focus our comments on the tvc - nave cohort , as ve in the tvc is confirmed to be much lower and hpv vaccination is not universally offered to women already sexually active and data on ais are too sparse to make sensible comments . for cin2 + lesions estimates of efficacy of the two vaccines in the tvc - nave cohort differ but the wide limits of the confidence intervals partially overlap ( ve 65% ; 95% ci : 54 , 74 for the bivalent and ve 43% ; 95% ci : 23 , 57 for the quadrivalent ) , whereas for cin3 + lesions estimates of efficacy largely differ and the limits of the confidence intervals do not overlap ( ve 93% ; 95% ci : 77 , 98 for the bivalent and ve 43% ; 95% ci : 12 , 63 for the quadrivalent ) . however , due to limited number of patients with lesions detected , leading to wide confidence intervals of our estimates of effect , our conclusions should be interpreted with caution . the heterogeneity observed might be due to higher efficacy of the bivalent vaccine against cervical cancer possibly related to the specific adjuvant used ( aso4 adjuvant system ) , as suggested in two recent immune response head - to - head studies that consistently showed a higher neutralizing antibody production [ 38 , 39 ] and a higher cd4 + t cell response in bivalent than in quadrivalent vaccine recipients . heterogeneity can also be due to baseline differences between the populations enrolled in the two trials , although such differences were not reported in the two trials ( table 3 ) . however , misclassification of nave women can not be ruled out since the two manufacturers used different laboratory tests to measure immune response and to identify nave girls . in fact clia test was used in the future trials whereas elisa test that has a higher sensitivity than clia was used in the patricia trial . moreover , data are often differently and poorly reported in the published trials [ 2629 , 3135 ] ; thus our ability to make meaningful comparisons and further analysis ( e.g. , assess the possible effect modification by smoking status or age ) is hindered . we asked the manufacturers to provide individual patient data , but we did not receive a positive answer . another relevant point is that the length of the follow - up in the trials assessed seems insufficient to detect information relevant to the public and to policy - makers : as time interval from hpv infection to cervical cancer development is approximately 20 years , all information gathered in a much shorter period of time is not conclusive . nevertheless the patricia trial has a planned follow - up of 4 years and longer follow - up data on bivalent vaccine are only available for 436 brazilian women enrolled in a previous phase ii trial . we will have more information in 2020 , when the results of the finnish study that extended the follow - up for finnish girls enrolled in the patricia study will be published and when the extension studies for the future ii trial assessing the quadrivalent vaccine will also be available . in the meantime an open debate in this respect is urgently needed : national health agencies should set up a surveillance system to provide data on actual vaccines efficacy in the field and to allow international comparisons . at the moment , this comparison is not possible and we still do not know how to choose between the two vaccines . contrary to what is previously reported in other meta - analyses [ 30 , 4144 ] , our systematic review suggests that the quadrivalent and the bivalent vaccines differ in terms of efficacy . for example , in italy hpv vaccines are chosen and purchased through tendering schemes organized by regional health authorities that are based on the lowest price . apart from cervical cancer prevention , quadrivalent vaccine is known to effectively prevent genital warts [ 71 , 72 ] , whereas the bivalent vaccine can only marginally impact on these benign but distressing lesions . the uk and a few italian regions have recently substituted the bivalent with the quadrivalent vaccine , assuming comparable efficacy of the two vaccines against cervical cancer and giving an additional value to the activity against genital warts of the quadrivalent vaccine [ 10 , 74 ] . unfortunately , it is not possible to anticipate the consequences of the uk 's and italian choice : if different vaccine efficacy of the bivalent and the quadrivalent vaccine is going to be confirmed , lack of equivalence in terms of cervical cancer prevention could become an issue . the availability in the coming years of new broader spectrum hpv prophylactic vaccines could provide more insight into the current debate [ 75 , 76 ] . in conclusion , we acknowledge that this systematic review has some limitations due to a low number of women with events and a high heterogeneity among trials that suggest caution in the interpretation of results . however , our conclusions are consistent with those from recent immunogenicity head - to - head studies [ 38 , 39 ] and that provides strength to our interpretation . our systematic review suggests that after nine years since hpv vaccines were introduced , their estimates of efficacy seem to diverge over time . the decision to consider the two vaccines similar in terms of cervical cancer prevention seems challenged by our longer term follow - up analyses . this might have implications for policy and pragmatic choices and deserves an open and comprehensive discussion . moreover , international comparisons of the actual effectiveness of the two vaccines used in the field can add valuable information . finally , regulatory agencies should encourage the pharmaceutical companies to provide data across trials to assess all relevant outcomes in a comparable way , to reduce uncertainty , and to support health policy - makers that have to choose between alternative options [ 77 , 78 ] .

background . when the bivalent and the quadrivalent hpv vaccines were marketed they were presented as having comparable efficacy against cervical cancer . differences between the vaccines are hpv types included and formulation of the adjuvant . method . a systematic review was conducted to assess the efficacy of the two vaccines against cervical cancer . outcomes considered were cin2 + , cin3 + , and ais . results . nine reports ( 38,419 women ) were included . at enrolment mean age of women was 20 years , 90% had negative cytology , and 80% were seronegative and/or dna negative for hpv 16 or 18 ( nave women ) . in the tvc - nave , ve against cin2 + was 58% ( 95% ci : 35 , 72 ) ; heterogeneity was detected , ve being 65% ( 95% ci : 54 , 74 ) for the bivalent and 43% ( 95% ci : 23 , 57 ) for the quadrivalent . ve against cin3 + was 78% ( 95% ci : < 0 , 97 ) ; heterogeneity was substantial , ve being 93% ( 95% ci : 77 , 98 ) for the bivalent and 43% ( 95% ci : 12 , 63 ) for the quadrivalent . ve in the tvc was much lower . no sufficient data were available on ais . conclusions . in nave girls bivalent vaccine shows higher efficacy , even if the number of events detected is low . in women already infected the benefit of the vaccination seems negligible .

1. Introduction 2. Methods 3. Results 4. Discussion 5. Conclusions

PMC5027132

salmonella enterica serovar typhimurium is a gram - negative enteric motile bacterium and a member of the enterobacteriaceae family . s. typhimurium can infect humans and animals , leading to the development of gastroenteritis . after entering intestinal epithelial cells , the bacteria damage the microvilli on the surface of the cells . the pathogenicity of s. enterica infection depends on its ability to invade tissues and survive in macrophages ( 1 ) . in addition to phagosomal killing resistance via the production of reactive oxygen species ( 2 ) , the emergence of antibiotic resistance has become a serious problem in salmonellosis control and treatment ( 3 ) . although new antibiotics and medicinal plants have recently been introduced that are effective against infectious disease ( 4 , 5 ) , vaccination is the best way to combat resistance . vaccination has economic aspects , in addition to hygiene promotion ( 6 , 7 ) . several oral vaccines are available that killed cellular parts of the bacterium or contain attenuated bacterium . some vaccines have been produced that include outer membrane proteins ( purines ) of s. typhimurium . next - generation vaccines have also been developed that utilize polysaccharides as a subunit vaccine , but these polysaccharides are t - cell independent antigens and do not incite memory responses . consequently , researchers have focused on bivalent subunit conjugate vaccines , which bind the polysaccharide to a proteinaceous macro - carrier as a carrier element in a hapten - carrier model ( 8 - 11 ) . diphtheria toxoid ( dt ) is a common carrier with a molecular weight of 70 kda and antigenic properties that are used in subunit vaccines ( 12 ) . in this study , the immunogenicity of ops ( o side chain isolation ) and a dt - conjugated compound was investigated in a mouse model to determine its efficacy as a vaccine candidate . this was an experimental study performed in the department of microbiology , zanjan branch , islamic azad university , zanjan , ir iran . s. typhimurium : lyophilized s. typhimurium sh4809 and s. typhimurium sh2201 were purchased ( biological research center of islamic azad university of zanjan ) and cultured on nutrient agar medium ( conda s.a . , s. typhimurium sh4809 was used for lipopolysaccharide ( lps ) preparation , and s. typhimurium sh2201 was used in the oral challenge . lps extraction : bacterial lps was extracted according to published protocols ( 13 , 14 ) . lps concentration : the tube was centrifuged at 4 c at 2500 rpm for 20 minutes to deplete protein , rna , and dna , and then the volume of the supernatant was measured . a mixture of 96% ethanol ( merck co. , germany ) and nacl ( 3:1 ) was added to the supernatant and then placed in a refrigerator for 24 hours until halo formation . the next day , the mixture was centrifuged at 4 c , 2500 rpm for 60 minutes . the supernatant was then discarded , and the residue containing the lps was stored ( 15 ) . isolation of ops : the tube containing the lps precipitate was refrigerated , and then 4 ml of distilled water were added , and the tube was shaken . to dissolve the precipitate , 12 ml of distilled water were added , drop by drop , followed by 200 l of 2% acetic acid ( merck co. , germany ) in distilled water . it was sealed , placed in a beaker and then autoclaved at 120 c for 15 minutes . next , the tube was centrifuged at 2500 rpm for 30 minutes at 4 c , followed by the addition of 2 grams of trichloroacetic acid ( merck co. , germany ) . the tube was then shaken and centrifuged at 2500 rpm for 30 minutes at 4 c again . finally , the ops - containing supernatant was isolated , and 96% ethanol in a volume of 3:1 was added and refrigerated for 2 hours to allow precipitation ( 15 ) . gel filtration for purification of the o side chains : the ops - containing supernatants were purified , as described previously ( 16 ) . after gel filtration was completed , the light absorbance of all the fractions was read at 210 nm ( figure 1 ) . afterward , the absorption spectrum of each tube was measured at 100 and 300 nm , and the contents of tubes with higher absorption were merged with each other . ph alignment : the ph of the solution was adjusted to 8.5 by adding hcl or naoh ( merck co. , germany ) and incubated in a refrigerator for 24 hours . endotoxin level of the d - lps samples : the endotoxicity of the antigens was measured using the lal method , as described previously . the permissible amount of endotoxin for humans is lower than 5 eu / ml ( 15 ) . . the admissible amount of protein in lps is 10 mg , according to the who protocol ( 17 , 18 ) . total carbohydrate assay : this assay was performed using phenol , as described previously ( 19 ) . nucleic acid assay : uv spectrophotometry at 260 nm was performed to check for contamination by dna ( 17 ) . detoxification of lps : this was done by the alkaline method , as reported previously ( 20 ) . conjugation of detoxified ops samples with dt : conjugation was performed via the amidation reaction using cyanogen bromide , sodium bicarbonate , adipic acid dihydrazide , and 1-ethyl-3- ( 3-dimethylaminopropyl ) carbodiimide ( edac ) ( sigma co. , uk ) ( 15 , 17 ) . to purify ops - dt conjugation crossed through a sepharose cl-2b chromatography column using the gel filtration method ( 16 ) . the light absorption of the fractions was then measured at 210 and 280 nm ( figure 2 ) . the molecules were conjugated when the peaks of light absorption of the curves overlapped at 210 and 280 nm . rabbit pyrogenicity test : to analyze the pyrogenicity of the prepared conjugations , rabbits were chosen in three groups , and their body temperatures were checked . after first temperature recording by putting the thermometer into the rabbit s anal , next measurements were done each 15 minutes over a 1-hour period . the inoculation was done by injecting through ear marginal vein , and the body temperature was recorded each 15 minutes over a 3-hour period . body temperature changes lower than 0.5 c for each rabbit was considered as apyrogenic inoculum ( 21 ) . toxicity test : to determine whether the inoculum was toxic , 10 g ( equals one human dosage ) were injected intraperitoneally into three mice . the animals were then monitored for 7 days to determine weight reductions and mortality ( 21 ) . sterility test : in this assay , prepared conjugations were cultured on tioglicolate , nutrient agar , blood agar , mac conkey agar , and saboraud dextrose agar ( conda s.a . , the media was maintained at both aerobic and anaerobic conditions , and the results were analyzed after an adequate time ( 22 ) . vaccination : sixty female balb / c mice were purchased from the research institution of pasteur ( karaj , ir iran ) . before the experiment , the mice were housed in standard stainless cages at 23 - 25 c , 60 - 70% humidity , and a 12-hours light / dark cycle for a week . the first group was vaccinated with ops , and the second group was vaccinated with ops - dt . the third and fourth groups were vaccinated with dt and normal saline , respectively , as control groups . the vaccine was administered intraperitoneally three times ( 0.5 cc each time ) for 2 weeks . two weeks after each injection , peripheral blood was collected from five mice in each group . each time , the blood was centrifuged at 3000 rpm for 5 minutes to obtain serum and stored at -20 c. enzyme - linked immunosorbent assay ( elisa ) : an indirect elisa was performed to determine the levels of iga , igm , igg3 , igg2b , igg2a , igg1 , and total igg antibodies in the titers , as published previously ( 15 ) . challenge infection : to attain a satisfying profile of the ops - dt compound , the challenge strain of s. typhimurium sh2201 was cultured on nutrient agar ( conda s.a . , afterward , the colonies were suspended in pbs , and the dosage was determined according to the agar plate count technique . each group ( ops , ops - dt , and control groups ) was orally administered a 50% lethal dose ( ld50 ) of s. typhimurium 21 days after the vaccination doses . to analyze the results of the oral challenge test , all the mice were examined three times daily after 3 days of the challenge for 3 weeks . to determine the clinical status of the animals , the following clinical responses to infection were recorded by direct observation : weight , feeding , activity , vitality , appearance , ataxia , and tremor . the clinical status was scored , with scores for each factor ranging from 0.0 to 5.0 . the average score of the three daily measurements was determined as the final daily score . all the challenge procedures were done according to the principles of laboratory animal care ( 23 ) , and they were approved by the ethical committee of islamic azad university , zanjan ( ec 92 - 308 ) . after running the elisa in triplicate , the average titration of each antibody was calculated . differences between the sera titrations of the ops and ops - dt groups with those of the control groups were analyzed by spss 18.0 software using a t - test , and p < 0.05 was considered a significant difference . after running the elisa in triplicate , the average titration of each antibody was calculated . differences between the sera titrations of the ops and ops - dt groups with those of the control groups were analyzed by spss 18.0 software using a t - test , and p < 0.05 was considered a significant difference . according to the bradford protein assay method , the protein content was 0.2 mg per 1 kg of dried lps . as shown in figure 2 , the light absorption of the ops - dt conjugations indicated that the ops polysaccharide antigens were conjugated to dt . the rabbit pyrogen test and animal survival indicated that the prepared conjugations did not contain any pyrogen substance and were not toxic . the iga titration analysis after the first injection indicated little variation in the iga levels of the ops and ops - dt groups . however , the iga titer of the ops - dt group was higher than that of the ops group 2 weeks after the second and third injections . the iga titer in the ops - dt group increased from 20 iu / ml to 29.2 iu / ml after the third injection in comparison to the first . the iga titer increased significantly 2 weeks after the administration of the vaccine , as compared to that of the control groups ( p < 0.001 ) ( table 1 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the igm titer of the ops - dt group increased from 97 iu / ml to 826 iu / ml after the third injection in comparison to after the first injection . the increase in the igm titer of the ops and ops - dt groups after 2 weeks was significant in comparison to that of the control groups ( p < 0.001 ) ( table 2 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the total igg in the titers of the groups vaccinated with the conjugate vaccine increased from 371 iu / ml after the first injection to 1870 iu / ml after the third injection ( table 3 ) . the igg subclasses in the titers of the groups vaccinated with the conjugate vaccine are listed in tables 4 - 7 . 4 - 7 . the titers of total igg and those of all the igg subclasses increased significantly after 2 weeks in the ops and ops - dt groups in comparison to those of the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . according to the antibody titration results , the oral challenge did not affect the clinical status of the ops - dt group . this group showed strong protection 21 days after exposure to the challenge strain of s. typhimurium . in contrast , the ops - only group showed little protection against the oral challenge , and the clinical status of the mice declined 2 weeks after the administration of the challenge . the two control groups showed no protection against the challenge strain , and their clinical status decreased all during 3 weeks evaluation ( figure 3 ) . the iga titration analysis after the first injection indicated little variation in the iga levels of the ops and ops - dt groups . however , the iga titer of the ops - dt group was higher than that of the ops group 2 weeks after the second and third injections . the iga titer in the ops - dt group increased from 20 iu / ml to 29.2 iu / ml after the third injection in comparison to the first . the iga titer increased significantly 2 weeks after the administration of the vaccine , as compared to that of the control groups ( p < 0.001 ) ( table 1 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the igm titer of the ops - dt group increased from 97 iu / ml to 826 iu / ml after the third injection in comparison to after the first injection . the increase in the igm titer of the ops and ops - dt groups after 2 weeks was significant in comparison to that of the control groups ( p < 0.001 ) ( table 2 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the total igg in the titers of the groups vaccinated with the conjugate vaccine increased from 371 iu / ml after the first injection to 1870 iu / ml after the third injection ( table 3 ) . the igg subclasses in the titers of the groups vaccinated with the conjugate vaccine are listed in tables 4 - 7 . 4 - 7 . the titers of total igg and those of all the igg subclasses increased significantly after 2 weeks in the ops and ops - dt groups in comparison to those of the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the iga titration analysis after the first injection indicated little variation in the iga levels of the ops and ops - dt groups . however , the iga titer of the ops - dt group was higher than that of the ops group 2 weeks after the second and third injections . the iga titer in the ops - dt group increased from 20 iu / ml to 29.2 iu / ml after the third injection in comparison to the first . the iga titer increased significantly 2 weeks after the administration of the vaccine , as compared to that of the control groups ( p < 0.001 ) ( table 1 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the igm titer of the ops - dt group increased from 97 iu / ml to 826 iu / ml after the third injection in comparison to after the first injection . the increase in the igm titer of the ops and ops - dt groups after 2 weeks was significant in comparison to that of the control groups ( p < 0.001 ) ( table 2 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . the total igg in the titers of the groups vaccinated with the conjugate vaccine increased from 371 iu / ml after the first injection to 1870 iu / ml after the third injection ( table 3 ) . the igg subclasses in the titers of the groups vaccinated with the conjugate vaccine are listed in tables 4 - 7 . 4 - 7 . the titers of total igg and those of all the igg subclasses increased significantly after 2 weeks in the ops and ops - dt groups in comparison to those of the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . * and * * denotes a significant difference in comparison to the control groups ( p < 0.001 ) . according to the antibody titration results , the oral challenge did not affect the clinical status of the ops - dt group . this group showed strong protection 21 days after exposure to the challenge strain of s. typhimurium . in contrast , the ops - only group showed little protection against the oral challenge , and the clinical status of the mice declined 2 weeks after the administration of the challenge . the two control groups showed no protection against the challenge strain , and their clinical status decreased all during 3 weeks evaluation ( figure 3 ) . diseases caused by s. typhimurium range from gastroenteritis to systemic infections . at present , no vaccine is available that can induce protective immunity ( 24 ) . in the present study , the immunogenicity of the s. typhimurium - derived ops conjugated with dt ( as the carrier protein ) was evaluated to determine its efficacy as a vaccine candidate . in various studies , therefore , in the present study , ops , a component of the cell wall component , was used . many previous studies have tested the potential of bacterial lps as a vaccine candidate antigen . these studies reported inadequate responses to nontyphoidal s. enterica infections because s. enterica is a facultative intracellular pathogen , and both b- and t - cell responses are required for successful clearance ( 24 ) . polysaccharides , such as lps , are thymus - independent antigens and can not trigger t cells ; consequently , they can not elicit an efficient memory response . furthermore , some bacterial polysaccharides are similar to the host s glycolipids and glycoproteins and therefore have poor immunogenicity ( 27 , 28 ) . in addition , as lps is a toxic component , it is not a suitable candidate for use in a vaccine . to eliminate this problem , the toxic portion ( lipid a ) of lps is removed , and the remaining polysaccharide is used in the vaccine . however , the remaining polysaccharide side chain has low immunogenicity and is thus unable to generate a vigorous immune response , as mentioned above . to increase the immunogenicity of polysaccharides , they are bound to an immunogenic protein , resulting in the conversion of a thymus - independent antigen to a thymus - dependent antigen ( 28 ) . in the present study , the vaccine candidate was conjugated by dt as a carrier component . in previous studies , the results of the present study indicated that the antibody response to ops - dt was comparable to that reported in those studies . in other research , an acceptable lps - dt conjugate vaccine against pseudomonas aeruginosa was introduced ( 15 ) . in addition , in the present study , the antibody responses to the ops - dt compound were greater than those to ops . long - term and effective immunity are crucial requirements of any vaccine ( 32 ) . in the present study , increases in the titers of all the antibodies were noticeable after ops - dt vaccination . the predominant antibody was igg1 , which was similar to that reported in an earlier study ( 15 ) . it seems that igg1 has the most protective activity . according to a previous study , mucosal and serum antibodies ( iga and igg ) , as well as cell - mediated immunity , provided protection against salmonella infections . enhanced levels of secretory iga antibodies and serum igg and igm antibodies were also reported to be essential to the efficacy of a vaccine candidate ( 33 ) . in the present study , according to the antibody titers and the results of the oral challenge , ops - dt seemed to provide adequate protection . in this basic research study , the ops - dt compound induced a favorable response to s. typhimurium infection in mice . these results may be helpful in the design of future vaccine and immunization studies against other bacterial infections . in conclusion , the antibody response of the ops - dt group was higher than that of the ops group . the levels of all types of antibodies increased after vaccination , and the predominant antibody was igg1 . therefore , ops - dt elicited a t - dependent antibody response , which enables isotype switching .

backgroundsalmonella enterica serovar typhimurium ( s. typhimurium ) causes gastroenteritis in humans and paratyphoid disease in some animals . given the emergence of antibiotic resistance , vaccines are more effective than chemotherapy in disease control.objectivesthe aim of this experimental study was to evaluate the immunogenicity of diphtheria toxoid ( dt ) conjugated with s. typhimurium -derived ops ( o side chain isolation ) in mice to determine its potential as a vaccine candidate against salmonellosis.materials and methodslipopolysaccharide ( lps ) was extracted from the bacterial strain . after isolation of the o side chain of lps , detoxification , and conjugation of the detoxified ops samples with dt , pyrogenicity , toxicity , and sterility tests were performed . to vaccination , four groups of female balb / c mice were used in an immunization test . antibody responses were measured by the elisa method . challenging processes were performed to analyze the efficacy of the ops - dt compound.resultstwo weeks after the first vaccination dose , there was no significant difference in the antibody titers of the ops and ops - dt groups . however , after the second and third doses , the antibody titers of the ops - dt group increased significantly compared with those of the control groups ( p < 0.001 ) . the induction of anti - ops antibodies was as follows : ops - dt > ops . the most anti - ops igg antibody was igg1 . challenging procedure showed successful protective characteristics in clinical examinations.conclusionsthe results indicated that dt increased anti - ops antibodies against the ops - dt compound . the antibody response to ops - dt was greater than that to ops alone . we conclude that ops - dt is an appropriate and acceptable vaccine candidate against salmonellosis .

1. Background 2. Objectives 3. Materials and Methods 3.1. Statistical Analysis 4. Results 4.1. Antibody Titers in Each Group 4.1.1. IgA 4.1.2. IgM 4.1.3. Total IgG and Its Subclasses 4.2. Oral Challenge of Mice After Vaccination 5. Discussion

PMC4315417

molecular dynamics ( md ) simulations are commonly used for ( a ) studying dynamics of protein structures , ( b ) protein structure prediction , and ( c ) calculating thermodynamic properties such as free energies , enthalpy , and entropy of conformational states of proteins . all - atom cartesian md simulations is a classical mechanics based toolkit using cartesian coordinates as degrees of freedom . the cartesian md method is used widely for calculating statistical and thermodynamic properties of materials and biomaterials . one of the attractive features of the cartesian all - atom dynamics model which uses absolute coordinates is its mathematical simplicity . there has been extensive development of all - atom cartesian dynamics algorithms for thermostats and simulation ensembles such as constant temperature ( nvt ) , constant pressure ( npt ) , and constant stress ( grand canonical ensemble ) . the thermodynamic properties calculated from these ensemble simulations can be directly compared with experimental measurements . additionally , constraints and/or bias potentials are often used in cartesian md to increase the time step size , enhance conformational sampling , and simulate large - scale conformational changes . the addition of these constraints into the cartesian dynamics makes the equations of motion differential algebraic , requiring differential - algebraic equation solvers that can adversely impact simulation robustness and complexity . bond length , bond angle , and torsion angle ( bat ) relative coordinates are more natural than cartesian absolute coordinates for describing the bonded structure of proteins . md simulations in bat coordinates are referred to as internal coordinate md ( icmd ) methods . in icmd models of proteins , degrees of freedom that are nonessential for effecting large scale conformational changes in proteins , such as high frequency bond length degrees of freedom , can be constrained by simply excluding them from the model . not only do the resulting icmd models have fewer number of degrees of freedom , but they also retain the simpler structure of ordinary differential equations instead of the more complex differential - algebraic structure required for constrained cartesian models . other advantages of icmd are the following:1.the low - frequency torsional coordinates allow larger time steps for integration of the equations of motion.2.conformational search is more effective in the low frequency torsional degrees of freedom and leads to significant conformational changes.3.enhanced sampling methods are more effective when performed in torsional space.4.the six translation and orientation degrees of freedom for a molecule are explicit coordinates rather than implicit as in cartesian models . this is useful when calculating the conformational entropy using quasi - harmonic analysis.5.they provide a large range of options for selecting and controlling the granularity of the dynamics model.6.fixman potential corrections for constraint - induced biases in the partition function are easier to apply . the low - frequency torsional coordinates allow larger time steps for integration of the equations of motion . conformational search is more effective in the low frequency torsional degrees of freedom and leads to significant conformational changes . the six translation and orientation degrees of freedom for a molecule are explicit coordinates rather than implicit as in cartesian models . they provide a large range of options for selecting and controlling the granularity of the dynamics model . fixman potential corrections for constraint - induced biases in the partition function are easier to apply . the ability of the icmd simulation methods to control the granularity of the dynamics model makes them highly suitable for the development of multiscale methods and strategies for the simulation of protein macromolecular complexes and polymeric materials . our vision is to develop a robust and advanced icmd method that capitalizes on the inherent advantages of icmd , and to use these methods to develop a comprehensive icmd simulation toolkit for tackling important problems in structural biology . the coupled nature of the icmd coordinates and the higher complexity of icmd models however demands far more sophisticated mathematical techniques and algorithms . torsional md is a well - known example of an icmd method that constrains all bond lengths and bond angles . many research groups have used the torsional md method for simulating the dynamics of peptides and proteins in addition to clarifying the stubborn challenges associated with the torsional md methods . the wider usage of torsional md methods has been hampered by serious bottlenecks that slowed their progress and viability of icmd methods as a structural biology tool . two long - standing concerns have been ( a ) the mathematical and computational complexity of the equations of motion associated with the icmd models and ( b ) the increased rigidity in the torsional md dynamics resulting from keeping the bond lengths and angles constrained , affecting the transition barriers and probability density functions of states in a protein . when all the bond lengths and bond angles are constrained in torsional md , the equations of motion in the dihedral angle space become computationally expensive with the solution scaling as the cubic power of the number of torsion degrees of freedom . this has been a major bottleneck that stunted the use and growth of icmd methods . euler inverse mass operator ( gneimo ) method that is based on the wealth of mathematical theory and analysis using spatial operator algebra techniques originally developed for spacecraft and robot dynamics domains . there has been a considerable amount of research over the years on the development of the spatial operator algebra methods for the analysis of robot multibody system dynamics . the key insights that have been developed included analytical techniques for the factorization and inversion of the mass matrix for tree - topology systems . these techniques have opened up the opportunities to revisit and advance torsional md simulations and make it computationally accessible to the wider community . our spatial operator algebra based icmd algorithm for solving the equations of motion was the first to overcome the icmd computational cost bottleneck by reducing costs to being just linearly , instead of cubically , proportional to the number of degrees of freedom . this low cost algorithm has been adopted by other groups to implement torsional md capability . the gneimo method has been applied to study a wide variety of structural biology problems such as protein folding , protein structure refinement , and domain motion in proteins . this algorithm is now being used routinely in refining nmr structures ( in the software called cyana ) and x - ray crystal structures ( in the software called nih - xplor ) . however , these two applications require only short time scale dynamics and do not require calculation of accurate thermodynamic properties from simulations . although the first challenge was eliminated making torsional md simulations computationally feasible with the spatial operator algebra based solution , the second bottleneck arising from the rigidity of the model still persisted . the increased rigidity of the dynamic model stemming from freezing degrees of freedom led to fewer dihedral transitions and to systematic errors in the probability density functions for proteins and peptides . researchers have observed that the use of rigid constraints in both bond lengths and bond angles in the torsional md simulations alters the potential energy surface and the free energy surface of the system compared with unconstrained md simulations . addressing the rigidity of the dynamics model imposed in the torsional md simulations , fixman in the 1970s proposed a compensating potential that rigorously corrects for treating stiff and uncoupled bond angles as rigid in the icmd model , and generates a partition function that gives probability density functions closer to that of all - atom cartesian simulations . while the fixman potential removes such biases for those bond angles that are stiff , it remained intractable and hence not tested for larger branched molecules . by developing a spatial operator algebra based general purpose and low - cost computational method to calculate the fixman potential for all linear and branched molecules , we have solved the longstanding problem of using the fixman potential in icmd simulations to remove constraint - induced biases in thermodynamic properties and the probability density function . our studies verify that , as predicted , the inclusion of the fixman potential recovers the equilibrium probability density function of the conformational states , the transition barrier crossing rates , and the free energy surface for serial and branched molecules . to the best of our knowledge , this is the first time that the fixman potential has been used for icmd of large and realistic branched polymers . overcoming the two long - standing bottlenecks along with several theoretical and algorithmic advances in the gneimo icmd method made in the past five years has led to a robust long time scale icmd simulation method and an associated software package for use to study protein structural dynamics . the highlights of these methods are described in section 2 , and the highlights of the results for several protein simulation applications and their comparison to experimental findings are given in section 3 . the current state of the icmd methods and the areas that need further development are discussed in section 4 . the icmd method is a molecular dynamics simulation method performed in bat coordinates also known as internal coordinates . the gneimo method is a generalized icmd method based on spatial operator algebra , for performing multibody dynamics of macromolecules . constraints on the high frequency bond lengths can be placed in the gneimo method to perform icmd simulations with the bond angles and torsion angles as degrees of freedom . if both the bond lengths and bond angles are kept rigid , the resulting torsional md method is also supported by gneimo . in the gneimo torsional md method , the bond length and bond angle degrees of freedom are treated as rigid and the macromolecule of tree topology is modeled as a collection of rigid bodies ( of varied sizes ) connected by flexible hinges . the rigid bodies also known as clusters can vary in size and shape ranging from a single atom to a methyl group , or a helix or an entire domain of a protein . however , these hinges have one to six degrees of freedom , with the one degree of freedom being just the torsion angle . when the hinge has six degrees of freedom , it allows the bond stretch , bond angle bending , and torsion about the bond connecting the clusters . the default cluster model of proteins in the gneimo method is shown in figure 1 . when the bond lengths and bond angles are treated as rigid , the equations of motion in icmd become coupled and are shown in eq 11where is the vector of the generalized coordinates ( e.g. , torsional angles ) , denotes the vector of generalized forces ( e.g. , torques ) , denotes the mass matrix ( moment of inertia tensor ) , and includes the velocity dependent coriolis forces . the dynamics of motion is obtained by solving eq 1 for the acceleration and integrating them to obtain new velocities and coordinates . with conventional algorithms , the equations of motion involve calculating the inverse of the dense mass matrix that scales as the cubic power of the number of degrees of freedom . the gneimo method uses a spatial operator algebra based method to derive an analytical expression for the inverse of the mass matrix followed by the following expression for 2the , , , etc . , terms in the above expression are associated with mass matrix related factorizations and are described in detail in refs ( 5 and 19 ) . standard clustering scheme used for torsional md in gneimo shown for the tripeptide ala - tyr - ala . the rigid clusters are shown in a single color , and these clustered atoms move together as a single unit . the gray rods and arrows represent hinges connecting two clusters . the expression on the right can be evaluated using recursive algorithms whose cost scales just linearly with the number of degrees of freedom and thus provides a computationally tractable method for solving the equations . this recursive algorithm described in detail in ref ( 5 ) avoids the computationally intensive inversion of the dense mass matrix shown in the matrix equation in eq 1 . we further extended this method to simulate the canonical n , v , t ensemble with constant temperature dynamics using the nos hoover thermostat method . hoover icmd method are given below.34 here is the additional frictional force term due to the canonical ensemble which is dependent on , the dynamic variable representing the thermostat , is the mass parameter of the thermostat , t is the instantaneous temperature , and tb is the thermostat temperature . since the gneimo nos hoover equations of motion shown above are similar to the equations of motion in eq 1 , all the spatial operator equations and factorization discussed in ref ( 5 ) hold good for these equations as well . the nos hoover thermostat mass parameter was optimized to be 10 times the time step size for torsional md simulations . the accuracy and stability of the gneimo torsional md simulations were measured by the conservation of the total hamiltonian and the extent of fluctuations in the temperature . other research groups such as brooks and co - workers and schweiters and co - workers adapted the gneimo algorithm into charmm and nih - xplor programs for icmd simulations . however , the systematic biases in the probability density functions calculated from icmd simulations arising from the rigidity of the model remain to be solved . to rigorously correct for the systematic biases in the probability density function caused by treating stiff bond angles as rigid , fixman proposed a compensating potential of the form5where denotes the mass matrix in the full bat coordinates , q0 the coordinates for the frozen degrees of freedom , k the boltzmann constant , and t the temperature . while the fixman potential removes such biases , it was computationally intractable for generalized branched molecules and hence remained untested and unused for several decades for icmd simulations , except for small model systems such as c4 or c5 . we derived a spatial operator algebra based algorithm that calculates the fixman potential with just 24% additional cost in the computation time . this method which we call gneimo - fixman is rigorous , general purpose , low - cost , and applicable to general linear and branched systems with little additional cost . more significantly , the gneimo - fixman method is also able to compute the partial derivatives of the fixman potential . these partial derivatives define the additional forces , i.e. , the fixman torque , to be applied within constrained md simulations . this makes it feasible to use the fixman potential during the torsional md simulations and test the effect of the fixman potential on recovering the accuracy of the probability density functions and the dihedral transition rates . to study the effectiveness of the fixman potential in recovering the thermodynamic probability density function of torsion angles , we performed torsional md simulations with langevin force for various linear and branched molecular systems without force fields . the effect of the fixman potential can be most clearly seen by comparing the probability density functions calculated from torsional md simulations with the fixman potential to the probability density functions calculated from unconstrained cartesian md simulations . figure 2 shows the joint probability distribution function of the two main chain torsion angles in alanine dipeptide . it is seen from the plots that the torsional md introduces biases in the joint probability density function that are removed when the torsional md simulations are performed with the fixman potential and the torques . the magnitude of the fixman potential is much smaller in comparison to the potential energy from the all - atom force field . there are some bond angles in the protein that are weakly coupled to the dihedrals and the nonbond forces while other bond angles such as backbone bond angles that show strong coupling to the dihedrals and the nonbond forces . although the fixman potential corrects for the errors in the probability density function stemming from treating stiff and uncoupled bond angles as rigid , it does not do so for soft bond angles that couple to the torsion angles or the nonbond interactions . there are two approaches for eliminating the bias in the potential energy surface imposed by treating the bond angles that are coupled to torsions and nonbond interactions , as rigid . the first approach is to open up some of the bond angles and treat them as movable degrees of freedom in the icmd simulations . this approach reduces rigidity and the error in probability density function and transition rates , with little impact on time step size . the second approach is to use correction torsional potentials that compensate for the rigidity in the coupled bond angles to recover the probability density function . examples of this approach are the ecepp family of force fields or icmff that correct the torsional angle potential for all of the bond angles . the icmff corrects the force constants used for the torsional angle potentials by refitting the torsional energy curve obtained from the rigid model to the torsional energy curve calculated using the flexible model . the force constants thus obtained will reproduce the torsion energy barriers of the flexible cartesian model . chen et al . showed that this method enhances the number of dihedral transitions during the torsional md simulations . the possible caveat with this method is that it is not rigorous and is system specific . the icmff has been tested for alanine dipeptide and remains to be tested for larger systems . in summary , it is necessary to treat the bond angles that show strong coupling to torsion angles as flexible degrees of freedom in order to achieve thermodynamic accuracy in the probability density function . however , this is not required if the torsional md simulations are used for structure prediction applications . this is because the goal in structure prediction applications , such as refining the loop structures in proteins , is to enrich the native ensemble by widening the conformational sampling and generally not in recovering the accuracy of the partition function of the cartesian md simulations . besides the two major challenges ( described above ) that have hampered icmd method development , there were other developments that were required to make the icmd method robust and suitable for long time scale simulations . several research groups have shown that constrained icmd models are not the limiting case of stiff cartesian models . to address the differences between constrained icmd models and cartesian models of the molecule , we showed that the application of the conventional equipartition theorem that is based on the cartesian model to the icmd model in internal coordinates does not yield an equipartition principle analogous to that for cartesian models . instead , the ensemble averages involve configuration dependent coupled coordinates , that are not easy to interpret or use . therefore , we introduced a coordinate transformation to modal coordinates that transforms the system s kinetic energy into a decoupled form similar to that for cartesian models . additionally , we showed that using the modal velocity coordinates one can derive an equipartition principle for the icmd model that is analogous to the one for cartesian models . this principle holds even though the modal coordinates are not canonical coordinates in the hamiltonian sense . the equipartition principle based on modal coordinates provides a method for the thermodynamically correct initialization of velocities in icmd simulations . joint probability distribution function of the two backbone torsion angles in alanine dipeptide : ( a ) cartesian simulations ; ( b ) icmd simulations ; ( c ) icmd + fixman simulations . the bin size for each axis is d = 18. material : reprinted with permission from ref ( 18 ) . we have developed a modular software package called gneimosim for efficient implementation of icmd simulations . gneimosim is quite possibly the first software package to include advanced features such as the icmd equipartition principle and methods for including the fixman potential to eliminate systematic statistical biases introduced by the use of hard constraints . moreover , gneimosim s architecture allows it to be extended and easily interfaced with third party force field packages for icmd simulations . the availability of a comprehensive python interface to the underlying c++ classes and their methods provides a powerful and versatile mechanism for users to develop simulation scripts to configure the simulation as well as to control the simulation flow . the alpha version of the gneimosim software is available for use for the research community at http://dartslab.jpl.nasa.gov/gneimo/index.php . in figure 3 , the blue line shows the average run time for a simulation for the start - up and solution of the equations of motion in the gneimo algorithm without using a force field . it shows the effective linear scaling of the dynamics equations solver cost for the gneimo method in gneimosim . the average run time for calculating the forces using openmm with gbsa ( on a gpu ) and using lammps and rosetta force fields on a cpu are shown in yellow , red , and green lines , respectively . the cost of running the equations of motion solver in gneimo is equivalent to the force field cost of using the amber force field with the generalized born solvation module on gpu using the openmm force field engine . however , for larger systems , the cost of the gneimo equations of motion solver will have a linear dependence while the cost of the calculation of forces will show a higher order increase in computational time . additionally , the increase in computational time for icmd is compensated to an extent by the ability to take larger time steps than are possible in a cartesian simulation . we have implemented in gneimosim several methods that are routinely used in md simulations such as1.advanced integrators including runge kutta , lobatto , adaptive cvode , and verlet integrators for stable long time scale ( microseconds ) torsional md simulations.2.an adaptation of the generalized born solvation method ( gbsa ) for implicit solvation.3.support for multiple molecules of any type , including explicit solvent.4.a temperature - based replica - exchange ( remd ) method in which temperatures may be switched randomly or probabilistically using the metropolis algorithm.5.periodic boundary conditions for simulations with explicit water.6.support for standard cartesian simulations for comparison.7.user defined harmonic distance restraints between pairs of atoms.8.more recently , we have added langevin dynamics and accelerated md ( amd ) methods to gneimosim . kutta , lobatto , adaptive cvode , and verlet integrators for stable long time scale ( microseconds ) torsional md simulations . an adaptation of the generalized born solvation method ( gbsa ) for implicit solvation . a temperature - based replica - exchange ( remd ) method in which temperatures may be switched randomly or probabilistically using the metropolis algorithm . more recently , we have added langevin dynamics and accelerated md ( amd ) methods to gneimosim . average run times per step for the gneimosim simulation using different force fields . the bat coordinates are natural coordinates to describe a bonded system like proteins and polymers . they also lend themselves readily to freezing and thawing any internal coordinate degree of freedom . for example , many torsional degrees of freedom can be kept constrained during dynamics such as freezing a whole helixin a protein structure , if needed . this freeze and thaw can be done at the start of the simulation or during the course of the md simulations in the gneimo icmd method . we refer to the freeze and thaw technique on the fly during the dynamics simulations as dynamic clustering . the dynamic clustering scheme can be applied automatically on the basis of user specified criteria to freeze and thaw internal coordinate degrees of freedom . the default clustering scheme for the gneimo torsional md treats all the torsions of the backbone and main chain as degrees of freedom . all - torsion md simulations may not be adequate for simulating long time scale events such as large conformational changes in proteins . adaptable clustering strategies that allow change in the cluster model of the protein during the simulations are more suitable for simulating large conformational changes . wagner et al . used criteria to freeze secondary structure elements when performing folding simulations at high temperature replicas and allow them to thaw at lower temperature replicas . however , it should be noted that , since the freeze and thaw mechanism can alter the pathway of the process being simulated , it is advisable to use this method for conformational search purposes only . other criterion to freeze or thaw a degree of freedom is by using an upper threshold for the velocity , a hinge can be treated as flexible if its velocity stays closer to the threshold velocity . this ensures that torsions that undergo significant motion are not treated as rigid . additionally , monitoring the accumulation of stress forces at a hinge that is treated rigid we have used the freeze and thaw strategy to fold four proteins starting from their respective extended structure . the secondary structure elements were predicted using sequence information and built into the extended structure . gneimo torsional md with the replica exchange method was used to run the folding simulations . the adaptive time step cvode integrator using the adams the cvode adaptive integrator ensures stable simulations while allowing rapid conformational sampling of clustered rigid bodies , by adjusting the time step size to avoid clashes that destabilize the md simulations . using the md trajectory of the b domain of staphylococcal protein a , we calculated the population density histogram shown in figure 4 . this figure also shows the corresponding representative structures from each of the conformational clusters . the x - axis is the root - mean - square deviation ( rmsd ) of the backbone atom coordinates from the crystal structure . we used 12 temperature replicas ranging from 300 to 1050 k. the folding process begins with the extended structure with just the predicted helices using secondary structure prediction methods . initially , a small number of interhelical contacts are made that collapses the structure to a rmsd range of 1216 . at 811 , slightly incorrect protein topologies are explored that finally fold to the correct topology below 7 . this example demonstrates the rapid conformational sampling realized using the dynamic clustering strategy . large scale domain motion caused by the low frequency modes in a protein are often difficult to capture with cartesian md simulations . the conformational transitions between the substates are often affected by long time scale and rare events difficult to capture within the relatively short ( hundreds of nanoseconds ) time scale md simulations . enhanced sampling methods are therefore often used to simulate the conformational transitions in proteins . some of the enhanced sampling methods require explicit knowledge of the conformations for which the transitions are being simulated , and therefore not readily applicable to unknown systems . the temperature based remd method when used with cartesian md simulations often leads to unraveling and reforming of secondary structure motifs . thus , the transitions are wasted in high frequency modes and the extra thermal energy is not focused on searching in the low frequency modes . we studied the use of remd with gneimo torsional md simulations to see how effective they are in conformational search in two highly flexible proteins , namely , fasciculin and calmodulin . calmodulin is a calcium signaling protein that belongs to the ef - hand family of proteins . the three - dimensional structure of calmodulin consists of two domains , namely , the amino terminus ( n - terminus ) domain and the carboxy - terminus ( c - terminus ) domain , that are connected by a long helical stretch . calmodulin is a dynamic protein that exhibits major conformational changes in response to calcium binding as revealed by nmr studies . upon binding to calcium , calmodulin samples a large ensemble of structures that allows it to bind to a wide range of proteins . there are several experimental studies on the dynamics and conformational changes in calmodulin . these studies show that there are two major steps involved in the conformational changes : ( 1 ) upon removal of the bound calcium , the central helix that connects the carboxy terminal domain and the amino terminal domain collapses followed by ( 2 ) the dynamics of the n - terminus domain relative to the static c - terminus domain . cartesian md simulations in explicit solvent showed the collapse of the central helix connecting the two domains but could not map the entire dynamics ensemble obtained from the nmr study . the gneimo - remd simulations with no bias potential were performed on the entire calmodulin protein . the trajectory showed conformational sampling of the collapse of the central helix , and the sampling of various conformations resulting from the relative reorientation of the two domains . although the collapse was observed in the cartesian md , the flexibility of the n - terminus domain was observed only in the gneimo - remd simulations . comparison of the ensemble of conformations of the carboxy terminus domain to the ensemble of conformations from nmr experiments is shown in figure 5 . it is seen that the gneimo conformations ( shown in blue in figure 5 ) cover most of the nmr conformations . backbone crmsd histogram of a dynamic clustering replica - exchange simulation of 1bdd , beginning from an extended conformation containing predicted secondary structure elements with representative structures . overlay of the conformations sampled in the gneimo - remd torsional md simulations ( shown in blue ) of calmodulin without calcium , to the nmr structures pdb i d : 1dmo ( shown in gold ) . quantitative comparison of the average hydrogen bond distances between residues showing hydrogen bonds in the nmr structures ( pdb i d : 1dmo ) to those in the gneimo - generated trajectories shows that about half of the average distances calculated fall within one standard deviation of the corresponding distances in the nmr structures . gneimo torsional md simulations on proteins such as crambin and bpti at 310 k have shown that the correlations in the torsional motions of residues that are farther apart in space can be captured in a shorter simulation time scale than with cartesian md simulations . for example , in the case of bpti , analysis of correlation in the backbone torsion angles of residues in two loops connected by a disulfide bond was shown to be strong in the millisecond level simulations of shaw and co - workers . we have shown that we could capture the torsional angle correlations between residues 9 to 18 and residues 35 to 40 in 100 ns of nvt gneimo torsional md simulations at 310 k. the gneimo algorithm has been implemented in the software package cyana for nmr structure refinement and in nih - xplor for x - ray crystal structure refinement . brooks and co - workers have tested torsional md simulations based on the gneimo algorithm for few proteins . however , this method has not been tested for refining protein homology models of lower accuracy compared to their respective crystal structures . due to the large number of protein structures of similar proteins available in the protein data bank , homology or template based modeling of related protein sequences has been shown to be the most feasible and accurate method of predicting protein structures . however , the target sequence has to have a > 60% sequence similarity to the template crystal structure . the accuracy of the model derived using homology modeling methods depends on the sequence similarity between the template and the target . there is an increasing need for high throughput computational methods that refine low accuracy homology models . using cartesian md simulation methods leads to refined structures only when used with restraints with the choice of restraints remaining arbitrary and system dependent and hence difficult to automate . starting from the homology based models , robust structure refinement methods are important to derive high useful accuracy models . an efficient conformational sampling method and an accurate energy function to identify the native structure are the two important components of a structure refinement algorithm . we have evaluated the usefulness of the conformational sampling afforded by gneimo - remd with the generalized born solvation method in enriching the refined structures compared to the starting decoy . the gneimo - remd method leads to a refinement of up to 1.3 for 28 out of 30 casp target proteins . these torsional md simulations using gneimo were done without any experimental information as restraints . figure 6 shows the contact map for one target ( t0453 ) as an example of the refinement using the gneimo method . figure 6 shows the contact map for refinement of the target protein t0453 . the contact map shows far is a given residue in the gneimo refined model from its crystal structure . the white color regions indicate the residue positions that are closer to the native structure than the residues in the deep red regions . it is evident from figure 6 that the gneimo refined structure shows significant refinement in the packing of the loop structure against the core of the protein . the long - range contacts between the loop residues 30 to 40 to those residues between 40 and 60 improve remarkably from 14 to 16 to 2 to 4 , as seen in figure 6 . the contact map shows the distance to the decoy structure , and the contact map in the third column shows how far each residue is refined corresponding to the native structure . while the gneimo method leads to substantial refinement in the loop packing , the unconstrained cartesian remd method shows unraveling and reformation of secondary structure elements and hence is less effective in conformational search . thus , starting from homology models of varying accuracy , the gneimo method shows improvement in structure refinement without unraveling the structures . the overall extent of refinement across many targets was modest and needs further improvement . the icmd simulation method is not a replacement for the cartesian md method . we envision developing an icmd simulation method to perform md simulations in bond , angle , and torsion ( bat ) coordinate systems . such a md simulation method is highly suitable for selecting and controlling the granularity of the dynamics model of proteins and polymers , and is a foundation for the development of multiscale simulation methods for the simulation of protein macromolecular complexes . the multiscale icmd simulation method can also be used for real space refinement of structural model fitting to low resolution crystallography or electron microscopy data of large protein complexes . currently , studies of the large scale dynamics that govern protein function commonly use all - atom cartesian md simulations , often with geometric constraints . such geometric constraints can adversely impact the integration time - step size and the stability of the dynamics . on the other hand , our recent theoretical developments based on spatial operator algebra have led to a robust long time scale icmd simulation method gneimo and associated toolkit known as gneimosim . we have demonstrated the power of the gneimo icmd technique with applications to protein domain motion studies and homology model refinement studies . the results of these applications have shown great promise in the wider use of this icmd technique . however , there remain extensions of the methods that need to be addressed to harness the advantages of icmd methods to their fullest . some of the possible extensions are the following:1.to calculate accurate conformational entropy using the gneimo torsional md simulation trajectories with the quasi - harmonic analysis ( qha ) method to improve the accuracy while correctly including traditionally difficult metric tensor correction terms.2.the second advancement in icmd simulations will be to extend the icmd simulation method to allow movement of certain bond angles that show strong coupling to the dihedral angles . for example , it has been shown that the bond angle hinged on the c atoms of a protein have strong coupling to the backbone dihedral angles . we will extend the gneimo icmd method to free up desired bond angle degrees of freedom . this will lead to a comprehensive suite of hybrid icmd models that bridge the wide gap between coarse grain torsional md and fine grain all - atom md models . these hybrid icmd models , with all bond angles open , can also be used for accurately calculating conformational entropy as discussed here.3.gneimosim software has enhanced sampling methods such as langevin dynamics , replica exchange method implemented . gneimo can be readily combined with other enhanced sampling techniques such as steered md , umbrella sampling , or accelerated md ( amd ) to name a few . to calculate accurate conformational entropy using the gneimo torsional md simulation trajectories with the quasi - harmonic analysis ( qha ) method to improve the accuracy while correctly including traditionally difficult metric tensor correction terms . the second advancement in icmd simulations will be to extend the icmd simulation method to allow movement of certain bond angles that show strong coupling to the dihedral angles . for example , it has been shown that the bond angle hinged on the c atoms of a protein have strong coupling to the backbone dihedral angles . we will extend the gneimo icmd method to free up desired bond angle degrees of freedom . this will lead to a comprehensive suite of hybrid icmd models that bridge the wide gap between coarse grain torsional md and fine grain all - atom md models . these hybrid icmd models , with all bond angles open , can also be used for accurately calculating conformational entropy as discussed here . gneimosim software has enhanced sampling methods such as langevin dynamics , replica exchange method implemented . gneimo can be readily combined with other enhanced sampling techniques such as steered md , umbrella sampling , or accelerated md ( amd ) to name a few . with these improvements , the gneimo method will be useful for applications to large protein dynamics simulations with explicit solvent . the gneimo method can be used with any type of force field such as an all - atom force field or a coarse grain force field . we also envision using the gneimo torsional md method combined with the torsional monte carlo method for protein structure prediction applications . in summary , the gneimo method offers a comprehensive icmd simulation method that allows easy coarse graining of the dynamics model ranging from all - atom to large domains of proteins being treated as clusters .

internal coordinates such as bond lengths , bond angles , and torsion angles ( bat ) are natural coordinates for describing a bonded molecular system . however , the molecular dynamics ( md ) simulation methods that are widely used for proteins , dna , and polymers are based on cartesian coordinates owing to the mathematical simplicity of the equations of motion . however , constraints are often needed with cartesian md simulations to enhance the conformational sampling . this makes the equations of motion in the cartesian coordinates differential - algebraic , which adversely impacts the complexity and the robustness of the simulations . on the other hand , constraints can be easily placed in bat coordinates by removing the degrees of freedom that need to be constrained . thus , the internal coordinate md ( icmd ) offers an attractive alternative to cartesian coordinate md for developing multiscale md method . the torsional md method is a special adaptation of the icmd method , where all the bond lengths and bond angles are kept rigid . the advantages of icmd simulation methods are the longer time step size afforded by freezing high frequency degrees of freedom and performing a conformational search in the more important low frequency torsional degrees of freedom . however , the advancements in the icmd simulations have been slow and stifled by long - standing mathematical bottlenecks . in this review , we summarize the recent mathematical advancements we have made based on spatial operator algebra , in developing a robust long time scale icmd simulation toolkit useful for various applications . we also present the applications of icmd simulations to study conformational changes in proteins and protein structure refinement . we review the advantages of the icmd simulations over the cartesian simulations when used with enhanced sampling methods and project the future use of icmd simulations in protein dynamics .

Introduction Methods Results and Discussion Conclusions

PMC4327686

the rising interest in esthetic dentistry by patients over the past decade has led to an increased demand for metal - free restorations in the posterior as well as anterior region25 . because of their esthetics and biocompatibility , many patients prefer all - ceramic crowns to metal - ceramic crowns . nowadays , strong ceramic core materials have been developed to support the weaker veneering ceramic materials , particularly for the use of all - ceramic restorations in the posterior region6 . lithium - disilicate glass - ceramic , glass - infiltrated alumina and tetragonal stabilized zirconia are useful for three - unit bridges in present time15 . in 1998 , three - unit bridges made of lithium disilicate glass ceramic were introduced for the replacement of a missing tooth up to the first premolar , where the recommended connector crosssection area is 16 mm2,20,23 . in 2005 , an improved press ceramic material called ips e.max press was introduced to the market . this pressed ceramic is intended to expand the range of indications of empress 2 . while it features similar physical properties as the latter , ips e.max press system encompasses a high - stability framework material which consists of lithium disilicate ( 2 sio - li2o ) . the restorations can be customized either by using a layering technique based on fluorapatite glass ceramic or by using the staining technique24,26 . as far as it could be arcertained , there is no study concerning the resistance of implant - supported ips e.max press restorations in the literature . as they have aided overcoming several of the limitations encountered with prosthetic solutions , dental implants have become a reliable alternative in the treatment of partial or complete edentulism . studies evaluating the long - term prognosis of implant - supported restorations have been published2,9 . it is well known that the load bearing capacity of bridges depends on the ceramic material 's properties , but also to a high extent on the size , shape and position of the connectors , as well as on the span of the pontics20 , the fabrication technique , the surface finish of the crowns and the luting method1,3,4 . pontic designs were well described for situations that require pontics in the fabrication of fixed partial dentures . these designs are include : saddle ( ridge lap ) , modified ridge lap , hygienic ( sanitary ) , conical and ovate . pontics of bridges have to fulfill esthetic , mechanical , functional , and hygienic requests in prosthetic dentistry . proper design is more important for cleanability and good tissue health than the choice of materials22 . the final healed ridge shape may be an even greater departure from the orginal configuration . the tooth opposite the gap can begin to drift out of its socket . in these cases if the pontic design is altered , the characteristic stress pattern can be optimized to improve the survival time of implant - supported all - ceramic bridges . the purpose of the the study was to evaluate the effect of different frameworks designs ( concave , convex and biconvex pontic design ) on fracture resistance of all - ceramic systems by loading test . the null hypothesis tested was that the different pontic designs do not affect the fracture resistance of all - ceramic restorations . to simulate clinical conditions , 2 implants ( iti solid screw implants , 3.8-mm diameter , 10-mm bone sink depth ; straumann ag , waldenburg , switzerland ) were arranged in a stainless steel model . this distance was approximately corresponded to a three - unit dental bridge from a second lower premolar to a second lower molar . the cement retention abutments ( solid abutments ; straumann ag ) were tightened to 35 ncm using the implant manufacturer 's torque device ( straumann ag ) . biconvex form designed as the control group , 1 mm curves to the direction of the occlusal surface ( convex form ) and 1 mm curves to the direction of the gingival surface ( concave form ) . convex and concave pontics had an occluso - gingival height of 4 mm , and a bucco - lingual width of 4 mm whereas biconcave pontic had an occluso - gingival height of 6 mm , and a bucco - lingual width of 4 mm . a high viscosity ( zetaplus ; zhermack , rovigo , italy ) and low viscosity hydrocompatible condensation silicone ( oranwash l ; zhermack , rovigo , italy ) were used to fabricate indexes on a wax - up of the first specimens . this index was used to prepare standardized wax patterns with the same dimensions for the rest of the specimens . the dimensional accuracy of each of the specimens was controlled with a micrometer ( mitutoyo absolute digimatic ; mitutoyo ltd , hampshire , england ) . the wax frameworks were sprued and invested with a speed investment material ( ips pressvest speed ; ivoclar vivadent ag , schaan , liechtenstein ) . a lithium - disilicate glass - ceramic ingot ( ips e.max press ; ivoclar vivadent ag ) was heated and pressed into an investment mold in the furnace ( ep 600 ; ivoclar vivadent ag ) after the burn out of the wax analogue . after divestment with glass polishing beads at 4 bar pressure , fine divestment was carried out with glass polishing beads at 2 bar pressure . the pressed frameworks were immersed into the 1% hydrofluoric acid ( invex liquid ; ivoclar vivadent ag ) and clean in an ultrasonic cleaner ( whaledent biosonic jr . the white reaction layer was removed carefully using aluminium oxide at 2 bars . to standardize the ceramic layer thickness , one framework for each group was veneered ( ips e.max ceram dentin a1 , ips e.max ceram transpa incisal , ips e.max ceram glaze paste , ivoclar vivadent ag ) . three silicone molds were manufactured for each group , allowing all other bridges to be veneered similarly . one type of porcelain was used for all specimens , and the manufacturer 's instructions were followed . the protocol applied comprised dentin firing i and ii , and glaze firing with glazing material . all frameworks were independently evaluated by 2 experienced clinicians using visual and tactile methods to ensure that the fit was acceptable . the shapes of the three - unit restorations are shown in figure 1 . axial compressive load was applied at central of pontic through steel ball ( 10.5 mm in diameter ) ( figure 2)14,18,29 . the fracture resistance of bridges was determined at a constant cross - head speed of 0.5 mm / min on a universal testing machine ( tstm 02500 , elista corp . , loading was continued to the point of fracture , and values of failure loads ( n ) were recorded with computer software . the crack initiation point on the load - versus - chart - speed curve for the all - ceramic bridges was determined by a sharp decrease in the loading curve and confirmed by an audible sound . additionally , the location and nature of the fracture patterns was recorded and photographed by using a ccd camera ( dfk 21af04 , the imaging source europe gmbh , bremen , germany ) and a computer ( toshiba satellite l10 - 102 ; toshiba europe gmbh , hampshire , england ) ( figures 2 and 3 ) . the fracture resistance values of all specimens were analyzed statistically by kruskal - wallis and mann - whitney u tests . the groups were compared to verify the differences at a significance level set at p<0.05 using the spss 11 for windows statistical software ( spss inc . , chicago , il , usa ) . the fracture resistance values of all specimens were analyzed statistically by kruskal - wallis and mann - whitney u tests . the groups were compared to verify the differences at a significance level set at p<0.05 using the spss 11 for windows statistical software ( spss inc . , chicago , il , usa ) . the fracture resistance values of bridges designed with biconvex , convex or concave pontics were 349.71 , 438.20 and 300.78 n , respectively . kruskal - wallis test revealed a significant difference ( p= 0.026 ) between mean fracture loads according to type of pontic design ( table 1 ) . bridges designed with convex pontic showed the best mechanical properties as demonstrated by the high values of fracture resistance . however , no statistically significant differences ( p>0.05 ) were found between the fracture resistances of the groups , except for convex and concave groups ( p<0.05 ; p=0.009 ) ( table 1 ) . different letters indicate statistically significant difference at 5% level the fractures were located between the loading point and one of the connectors . the ways of crack propagation were mostly oblique gingivo - occlusally through the connector and pontic and parallel bucco - lingually to the occlusal surface along the occlusal embrasure ( figure 3 ) . the fracture location occurred in the mesial or distal regions of the pontic ( table 2 ) . all - ceramic bridges exhibited outstanding esthetics and excellent biocompatibility have been increasingly used during the past decade and today . continuous development of both ceramic materials and fabrication techniques in addition to recent advances in bonding materials allowed for the introduction of new all - ceramic systems17,12,13 . the mechanical properties of these systems have to meet the requirements needed to withstand the stresses and strains that can arise in this region because of the increasing use in posterior regions21 . many studies on the fracture resistance of all - ceramic fixed partial dentures were investigated the effect of connector area and span of the pontic10,15,18,19,28 . however , the shape of pontics may also influence the clinical performance of a restoration . tsumita , et al.30 ( 2005 ) stated that the concave shape caused the highest maximum tensile stress , and high tensile stresses were appeared at the lower surface of pontic . researchers also reported that convex design reduced the stress contrentration at the connector area of the gingival embrasure , and this pontic shape resisted the load as compressive stress . kokubo , et al.14 ( 2007 ) evaluated the effect of straight , convex and concave pontic designs on the fracture resistance of implant - supported all - ceramic fixed partial dentures and declared that convex design is particularly useful for molar region . the results of present study agree with those of tsumita , et al.30 ( 2005 ) and kokubo , et al.14 ( 2007 ) . it is known that porcelain is weaker when stressed at tension and it is much stronger under compression17 . tensile stresses tend to occur at lower surface of concave or straight beams by loading16 . also , the convex arches are the most efficient method of forming a structure with materials that have good compressive strength and low tensile strength16 . therefore , highest values of fracture resistance with respect to the other pontic designs studied were observed at convex design , while concave design showed lowest values of fracture resistance . based on these results , the null hypothesis that different pontic designs would not affect the fracture resistance of all - ceramic restorations was rejected . it has been reported that the mean adult occlusal force is about 400 to 800 n at the molar region , 300 n at the premolar region , and 200 n in the anterior region5 . oh and anusavice18 ( 2002 ) stated that clinical contact areas on the pontic and the adjacent abutments may generate variations in the mode of failure in all - ceramic 3-unit bridges and ceramic prostheses may fail at values far lower than the mean values measured intraorally . the mean fracture loads for all designs were found lower than the mean maximum masticatory forces for molar region . although luting can improve resistance of metal free restoration , fpds were not cemented on the abutments in this study . this procedure may explain the low fracture resitance values . also , lack of a thermomechanical loading is another limitation . nevertheless , manufacturer suggested the use of ips e.max press system to remain limited with anterior and premolar regions , and there is no data about the use of this system at posterior region . since the aim of the present study was to compare the effects of different designs rather than to assess the clinical performance , providing standard conditions for all test designs would be enough for evaluation . thus , the inherent limitations in this study should be considered . in the present study , cracks propagated obliquely through the gingival embrasure and pontic ( directing from the gingival embrasure to the occlusal contact area ) except for one specimen belonging to group 3 , at which the crack was between one of the connectors and pontic . oh and anusavice18 ( 2002 ) and sundh , et al.29 ( 2005 ) reported results similar to those of this study . the greatest incidence of fractures was observed in the premolar - molar connector for convex design . the findings indicate that the direction of force transmission for this design is different than the other two groups . the major drawback of specimens with geometry similar to that of real prosthesis is the difficulty to prepare specimens with reproducible dimensions27 . the core / veneer thickness ratio and the properties of the veneering porcelain have been shown to affect the resistance of bilayered core / porcelain specimens8,11,29 . the connector 's cross - section diameter , shape and position is founded to be important for the appropriate design of dental bridges10,18,19,28 . in the present study , ips e.max bridges were fabricated by the same dental technician by using silicone molds to standardize the ceramic layer thickness . in the same way as observed for several in vitro studies , it is difficult to extrapolate the results of this study directly to a clinical situation , and data obtained from current study must be supported by clinical investigations . within the limitations of this study , the following conclusions can be drawn : 1 . the pontic designs were affected the fracture resistances of implant - supported all - ceramic fixed partial dentures ; 2 .

objective : the purpose of this study was to compare the fracture resistance of implant - supported all - ceramic fixed partial dentures , which have three different pontic designs.material and methods : two implants were placed in a metal model simulating mandibular left second premolar and mandibular left second molar . thirty standardized 3-unit all - ceramic fixed partial dentures with biconvex , convex or concave pontic designs were fabricated using ips e.max system ( n=10 ) . afterwards , specimens were centrally loaded on the pontics until failure with a universal testing machine . results were analyzed by kruskal - wallis and mann - whitney u tests at 5% significance level.results:the fracture resistance values of all - ceramic fixed partial dentures designed with biconvex , convex or concave pontics were 349.71 , 438.20 and 300.78 n , respectively . there were no statistically significant differences between the fracture resistances of the groups ( p>0.05 ) , except for convex and concave groups ( p<0.05 and p=0.009 , respectively).conclusions : convex design showed the best mechanical properties as demonstrated by the high values of fracture resistance .

INTRODUCTION MATERIAL AND METHODS Statistical Analysis RESULTS DISCUSSION CONCLUSIONS

PMC3714528

this was a cross - sectional epidemiological survey of the nationwide , population - based norwegian childhood diabetes registry ( ncdr ) . the participants were recruited from the ncdr between 1 april 2010 and 31 march 2011 . in our study , a total of 1816 individuals with type 1 diabetes aged 1119 years in the ncdr were invited to participate in the study . the ncdr , a nationwide , population - based registry established in 2006 , includes all newly diagnosed children with diabetes . all the pediatric departments in norway perform an annual examination of all their patients with diabetes and report the results to the ncdr . the final sample consisted of 770 children and adolescents with type 1 diabetes aged 1119 years ( 42.40% response rate ) . participants were somewhat younger than nonparticipants ( 14.6 vs. 15.1 years ; p 0.001 ) , had slightly lower hba1c ( 8.5 vs. 8.7% ; p 0.01 ) , and had somewhat shorter duration of type 1 diabetes ( 5.3 vs. 6.1 years ; p 0.001 ) than nonparticipants ; however , the effect sizes were very small ( 0.2 , 0.1 , and 0.2 , respectively ) . these groups did not differ with respect to zbmi or age at onset of type 1 diabetes . written consent was obtained from participants and their parents , if the participant was below the age of 16 years . questionnaires were distributed to the participants at their regularly scheduled appointments at their local outpatient diabetes clinics . the deps ( 14 ) was the first measure designed to screen for deb in type 1 diabetes , such as insulin restriction to lose weight . the original instrument consisted of 28 items but has recently been revised to create the deps - r , a brief 16-item version that can be completed in less than 10 min and has demonstrated good psychometric properties ( 13 ) . responses are scored on a 6-point likert scale ranging from 0 to 5 , and higher scores indicate greater pathology . the eat ( 12 ) is a generic screening measure of eating pathology used internationally to detect pathologic eating attitudes and behaviors . a 12-item norwegian version , eat-12 has been developed ( 15 ) and has demonstrated adequate psychometric properties ( 16 ) . hba1c was determined for all participants by high - performance liquid chromatography ( tosoh g7 ; tosoh europe n.v . , tessenderlo , belgium ) at the same central diabetes control and complications trial standardized laboratory . bmi was calculated from weight and height ( kg / m ) and standardized to a z - score ( zbmi ) according to age and sex because the participants were primarily younger than 18 years using the centers for disease control and prevention ( cdc ) growth charts for 2000 ( 17 ) . weight was categorized in four groups according to the world health organization ( 18 ) : underweight ( bmi < 18.5 kg / m ) , normal weight ( bmi 18.524.9 kg / m ) , overweight ( bmi 2529.9 kg / m ) , and obese ( bmi 30 kg / m ) . data were assessed as part of the annual extended diabetes examination at the local diabetes outpatient clinic . nonparametric tests were used for skewed data . for the deps - r and the eat-12 , convergent validity between the deps - r and the eat-12 was investigated with spearman population correlation coefficient ( ) . in line with cohen ( 19 ) , correlations of 0.100.29 were interpreted as small , 0.300.49 as medium , and 0.501.0 as large . correlations were also carried out to explore relationships with other constructs hypothesized to covary with deps - r scores , such as hba1c , zbmi , age , and sex . a principal axis factoring ( paf ) was used to explore the factor structure of deps - r . the data were considered suitable for paf because the kaiser - meyer - olkin measure of sampling adequacy value was > 0.6 and the bartlett test of sphericity value was significant . effect sizes were calculated by means of cohen d value , and the guidelines used for interpreting this value were as follows : 0.20 , small effect ; 0.50 , moderate effect ; and 0.80 , large effect ( 19 ) . statistical analyses were conducted with spss version 18 ( ibm corporation , armonk , ny ) . this was a cross - sectional epidemiological survey of the nationwide , population - based norwegian childhood diabetes registry ( ncdr ) . the participants were recruited from the ncdr between 1 april 2010 and 31 march 2011 . in our study , a total of 1816 individuals with type 1 diabetes aged 1119 years in the ncdr were invited to participate in the study . the ncdr , a nationwide , population - based registry established in 2006 , includes all newly diagnosed children with diabetes . all the pediatric departments in norway perform an annual examination of all their patients with diabetes and report the results to the ncdr . the final sample consisted of 770 children and adolescents with type 1 diabetes aged 1119 years ( 42.40% response rate ) . participants were somewhat younger than nonparticipants ( 14.6 vs. 15.1 years ; p 0.001 ) , had slightly lower hba1c ( 8.5 vs. 8.7% ; p 0.01 ) , and had somewhat shorter duration of type 1 diabetes ( 5.3 vs. 6.1 years ; p 0.001 ) than nonparticipants ; however , the effect sizes were very small ( 0.2 , 0.1 , and 0.2 , respectively ) . these groups did not differ with respect to zbmi or age at onset of type 1 diabetes . was obtained from participants and their parents , if the participant was below the age of 16 years . questionnaires were distributed to the participants at their regularly scheduled appointments at their local outpatient diabetes clinics . the deps ( 14 ) was the first measure designed to screen for deb in type 1 diabetes , such as insulin restriction to lose weight . the original instrument consisted of 28 items but has recently been revised to create the deps - r , a brief 16-item version that can be completed in less than 10 min and has demonstrated good psychometric properties ( 13 ) . responses are scored on a 6-point likert scale ranging from 0 to 5 , and higher scores indicate greater pathology . the eat ( 12 ) is a generic screening measure of eating pathology used internationally to detect pathologic eating attitudes and behaviors . a 12-item norwegian version , eat-12 has been developed ( 15 ) and has demonstrated adequate psychometric properties ( 16 ) . hba1c was determined for all participants by high - performance liquid chromatography ( tosoh g7 ; tosoh europe n.v . , tessenderlo , belgium ) at the same central diabetes control and complications trial standardized laboratory . bmi was calculated from weight and height ( kg / m ) and standardized to a z - score ( zbmi ) according to age and sex because the participants were primarily younger than 18 years using the centers for disease control and prevention ( cdc ) growth charts for 2000 ( 17 ) . weight was categorized in four groups according to the world health organization ( 18 ) : underweight ( bmi < 18.5 kg / m ) , normal weight ( bmi 18.524.9 kg / m ) , overweight ( bmi 2529.9 kg / m ) , and obese ( bmi 30 kg / m ) . data were assessed as part of the annual extended diabetes examination at the local diabetes outpatient clinic . nonparametric tests were used for skewed data . for the deps - r and the eat-12 , convergent validity between the deps - r and the eat-12 was investigated with spearman population correlation coefficient ( ) . in line with cohen ( 19 ) , correlations of 0.100.29 were interpreted as small , 0.300.49 as medium , and 0.501.0 as large . correlations were also carried out to explore relationships with other constructs hypothesized to covary with deps - r scores , such as hba1c , zbmi , age , and sex . a principal axis factoring ( paf ) was used to explore the factor structure of deps - r . the data were considered suitable for paf because the kaiser - meyer - olkin measure of sampling adequacy value was > 0.6 and the bartlett test of sphericity value was significant . effect sizes were calculated by means of cohen d value , and the guidelines used for interpreting this value were as follows : 0.20 , small effect ; 0.50 , moderate effect ; and 0.80 , large effect ( 19 ) . statistical analyses were conducted with spss version 18 ( ibm corporation , armonk , ny ) . as shown below , mean age of the 770 participants was 14.6 ( 2.1 ) years and age at onset of type 1 diabetes was 8.9 ( 3.6 ) years . mean type 1 diabetes duration was 5.3 ( 3.4 ) years , mean zbmi was 0.3 ( 0.9 ) , and mean hba1c was 8.5% ( 1.4% ) . pubertal state was categorized by tanner stage 15 as prepubertal ( tanner stage 1 ) pubertal ( tanner stage 24 ) , and postpubertal ( tanner stage 5 ) . participant characteristics the cronbach coefficients for the deps - r were 0.89 , 0.81 , and 0.90 for the entire sample , males , and females , respectively . for the eat-12 , coefficients were 0.74 for the whole sample , 0.63 for males , and 0.76 for females . the deps - r was significantly and positively correlated with the eat-12 ( = 0.65 ; p 0.01 ) ( table 2 ) . additional significant , although small , correlations were found between the deps - r and zbmi ( = 0.28 ; p 0.01 ) , hba1c ( = 0.22 ; p 0.01 ) , age ( = 0.27 ; p 0.01 ) , and sex ( = 0.27 ; p 0.01 ) . the eat-12 was also significantly correlated with hba1c ; however , this was an even smaller correlation ( = 0.08 ; p 0.05 ) . correlations between deps - r and eat-12 , hba1c , zbmi , age , and sex the deps - r norms ( sd ) for the total sample , males , and females were as follows : 11.0 ( 10.7 ) , 7.7 ( 7.4 ) and 14.2 ( 12.4 ) , respectively . mean deps - r score was more than three times higher in the obese group than in the underweight group , and two times higher in the oldest than in the youngest age group . table 3 presents the deps - r scores according to sex , age , and zbmi category . norms according to different categories of age and weight after the suitability of data for factor analysis was assessed , paf was performed on the 16 items of the deps - r . the kaiser - meyer - olkin value was 0.92 , and the bartlett test of sphericity reached statistical significance , supporting the factorability of the correlation matrix . paf revealed three components with eigenvalues > 1 , explaining 38.7 , 8.5 , and 7.4% of the variance , respectively , accounting for a total of 54.6% of the variance . on the basis of eigenvalues and inspection of the scree plot , three components were chosen for further investigation . to assist in the interpretation of these three components , all three components showed relatively strong loadings and items loaded exclusively on one component , with the exception of one item ( item 13 ) . further examination of the three factors was conducted by running correlations with the deps - r total score and hba1c . factor 1 correlated more strongly with both the deps - r total score ( 0.91 ; p < 0.001 ) and hba1c ( 0.27 ; p < 0.001 ) than did factors 2 ( 0.88 ; p < 0.001 and 0.16 ; p < 0.001 , respectively ) and 3 ( 0.47 ; p < 0.001 and 0.09 ; p < 0.05 , respectively ) pattern matrix for paf with oblimin rotation of three - factor solution of the deps - r items to examine sex differences in factor structure , the paf was also conducted separately for males and females . when investigating males only , however , the intercorrelations among the items were not strong enough ( 20 ) , and consequently the data were not considered appropriate for factor analysis . as shown below , mean age of the 770 participants was 14.6 ( 2.1 ) years and age at onset of type 1 diabetes was 8.9 ( 3.6 ) years . mean type 1 diabetes duration was 5.3 ( 3.4 ) years , mean zbmi was 0.3 ( 0.9 ) , and mean hba1c was 8.5% ( 1.4% ) . ( tanner stage 1 ) pubertal ( tanner stage 24 ) , and postpubertal ( tanner stage 5 ) . participant characteristics the cronbach coefficients for the deps - r were 0.89 , 0.81 , and 0.90 for the entire sample , males , and females , respectively . for the eat-12 , coefficients were 0.74 for the whole sample , 0.63 for males , and 0.76 for females . the deps - r was significantly and positively correlated with the eat-12 ( = 0.65 ; p 0.01 ) ( table 2 ) . additional significant , although small , correlations were found between the deps - r and zbmi ( = 0.28 ; p 0.01 ) , hba1c ( = 0.22 ; p 0.01 ) , age ( = 0.27 ; p 0.01 ) , and sex ( = 0.27 ; p 0.01 ) . the eat-12 was also significantly correlated with hba1c ; however , this was an even smaller correlation ( = 0.08 ; p 0.05 ) . correlations between deps - r and eat-12 , hba1c , zbmi , age , and sex the deps - r norms ( sd ) for the total sample , males , and females were as follows : 11.0 ( 10.7 ) , 7.7 ( 7.4 ) and 14.2 ( 12.4 ) , respectively . mean deps - r score was more than three times higher in the obese group than in the underweight group , and two times higher in the oldest than in the youngest age group . table 3 presents the deps - r scores according to sex , age , and zbmi category . after the suitability of data for factor analysis was assessed , paf was performed on the 16 items of the deps - r . the kaiser - meyer - olkin value was 0.92 , and the bartlett test of sphericity reached statistical significance , supporting the factorability of the correlation matrix . paf revealed three components with eigenvalues > 1 , explaining 38.7 , 8.5 , and 7.4% of the variance , respectively , accounting for a total of 54.6% of the variance . on the basis of eigenvalues and inspection of the scree plot , three components were chosen for further investigation . to assist in the interpretation of these three components , all three components showed relatively strong loadings and items loaded exclusively on one component , with the exception of one item ( item 13 ) . further examination of the three factors was conducted by running correlations with the deps - r total score and hba1c . factor 1 correlated more strongly with both the deps - r total score ( 0.91 ; p < 0.001 ) and hba1c ( 0.27 ; p < 0.001 ) than did factors 2 ( 0.88 ; p < 0.001 and 0.16 ; p < 0.001 , respectively ) and 3 ( 0.47 ; p < 0.001 and 0.09 ; p < 0.05 , respectively ) . pattern matrix for paf with oblimin rotation of three - factor solution of the deps - r items to examine sex differences in factor structure , the paf was also conducted separately for males and females . when investigating males only , however , the intercorrelations among the items were not strong enough ( 20 ) , and consequently the data were not considered appropriate for factor analysis . this study replicates and extends previous research demonstrating the psychometric properties of the deps - r for children and adolescents . internal consistency was found to be very good ( 0.89 ) and consistent with the original validation study of deps - r ( 13 ) , which reported a cronbach of 0.86 . in contrast , the cronbach for eat-12 was 0.74 in our study . data also supported the construct validity of the deps - r , as indicated by significant and positive correlations with the eat-12 . additional positive , although relatively weak , correlations were found with hba1c , zbmi , and age , constructs previously found to be associated with deb ( 13,21 ) . the relatively small correlations between the deps - r and other variables are in line with earlier studies ( 13 ) . this underscores the importance of screening for deb in young patients with type 1 diabetes , because clinical variables such as zbmi and hba1c seem to be poor indicators of deb in this population . when comparing the deps - r with the eat-12 , the deps - r generally appears to be a better screening tool than the eat-12 for deb in young patients with type 1 diabetes . in addition to convincing internal consistency , the deps - r was more strongly correlated with hba1c than was the eat-12 , although both correlations were relatively weak . also , previous research comparing the deps with the 26-item eat found that deps scores were more strongly correlated with formally diagnosed eating problems than were eat scores . these findings might be explained by the fact that the deps and the deps - r can identify diabetes - specific deb , such as insulin omission to lose weight , which is a core feature of deb in type 1 diabetes . such diabetes - specific behaviors are not likely to be detected by the use of generic screening tools , indicating the risk of false negatives associated with these measures . norms of the deps - r were established in this study , and significant differences were found between males and females . our results are similar to those reported in the previous deps - r validation study ( 13 ) . the norms were additionally categorized according to zbmi and age and demonstrated a threefold increase in debs in the obese group relative to the underweight group and a twofold increase in the oldest age group ( 1719 years ) relative to the youngest age group ( 1113 years ) . determining fixed norms is challenging because of the variability in mean scores between different weight and age categories . in a clinical setting , we therefore recommend interpreting the deps - r score in relation to the patients zbmi and age . both higher zbmi and higher age appear to be risk factors for the development of debs among adolescents and children with type 1 diabetes . this finding is consistent with studies of eating pathology in the general population ( 22,23 ) . because the factor structure of the deps - r has not been previously reported , paf was conducted . although our model identified three factors , it is difficult at this point to establish obvious subscales related to these three factors . one possible interpretation is that factor 1 appears to address maladaptive eating habits , factor 2 the preoccupation with thinness or weight , and factor 3 the concept of maintaining high blood glucose values to lose weight . further examination of the three factors showed that factor 1 correlated more strongly with hba1c than did factors 2 and 3 . even though three factors were identified , it is unclear at this time whether the deps - r would benefit from using this factor structure for scoring purposes . the ease of administration and short administration time already make the deps - r clinically useful as a screening tool in busy clinical settings . nonetheless , the factor structure could be worth considering for further psychometric work on the deps - r . it is possible that scores on each factor could facilitate treatment recommendations according to which factors the individual scores highest . as expected , and in line with other studies of deb ( 13,22 ) , females scored significantly higher than males on both the deps - r and the eat-12 . this is consistent with previous research demonstrating that females are at higher risk of developing deb than males , both among patients with type 1 diabetes and in the general population ( 24 ) . it is also possible that males have underreported their symptoms of eating pathology compared with females . this has also been suggested in studies of other types of pathology ( 25,26 ) . further , when males and females were analyzed separately , internal consistency and construct validity of the deps - r were stronger among females . for example , the cronbach coefficient was lower among males ( 0.81 ) than among females ( 0.90 ) . weaker validity among males has been previously demonstrated in studies conducted with other measures of disordered eating ( 21,27 ) . because of sex disparities in prevalence rates of disordered eating ( 28 ) , assessment tools have largely been developed with female populations ; however , some studies suggest that traditional assessments may fail to provide a comprehensive assessment of male - specific eating , weight , and shape concerns ( 29 ) . items focused predominantly on restricted eating and a desire for thinness may not reflect the dual presence of a drive for thinness and a drive for muscularity that characterizes the lean , mesomorphic body ideal unique to boys and men . this may contribute to the lower validity coefficients for the deps - r among males in this study and raises the general issue of whether existing screening tools provide an adequate assessment of deb among men . in norway , all patients with type 1 diabetes are offered the same modern and intensive insulin treatment independent of social status . the strengths of this study include the high number of participants , the population - based national registry inclusive of > 95% of all eligible children and adolescents , and the validation of deps - r against an established measure of disturbed eating and somatic data . first , the response rate was relatively low ( 42% ) , and participants were on average 6 months younger with a shorter duration of illness ; however , effect sizes were small . second , it fails to compare the deps - r with a diagnostic interview such as the eating disorder examination ( 30 ) . comparison with the eating disorder examination would allow an investigation of the ability of the deps - r to identify clinical eating disorder diagnoses . future research is warranted to validate the deps - r against a diagnostic interview . in conclusion , because of the significant risks of morbidity and mortality associated with the occurrence of disordered eating and type 1 diabetes together in youth , screening and early intervention for deb should be routinely included in standard diabetes care ( 3 ) . the deps - r is a valid screening tool for deb in type 1 diabetes , is easy to administer , and is a potentially important addition to clinical practice . there were significant differences in deps - r scores according to sex , age , and zbmi , and we therefore recommend that these aspects be considered when interpreting deps - r scores .

objectivethe purpose of this study was to examine the psychometric properties of the diabetes eating problem survey revised ( deps - r ) in a large sample of young patients with type 1 diabetes , to establish norms , and to validate it against the eating attitudes test12 ( eat-12).research design and methodsa total of 770 children and adolescents aged 1119 years with type 1 diabetes completed the deps - r and the eat-12 . in addition , age- and sex - standardized bmi and hba1c data were obtained from the norwegian childhood diabetes registry . in addition to tests of validity , principal axis factoring was conducted to investigate the factor structure of the 16-item deps-r.resultsthe deps - r demonstrated satisfactory cronbach ( 0.89 ) and was significantly correlated with the eat-12 ( 0.65 ; p < 0.01 ) , indicating convergent validity . the mean ( sd ) deps - r scores were 11.0 ( 10.7 ) for the total sample and 7.7 ( 7.4 ) and 14.2 ( 2.4 ) for males and females , respectively.conclusionsthis study replicates and extends previous research demonstrating the psychometric properties of the abbreviated 16-item deps - r . findings support the utility of this important screening tool to identify disturbed eating in young patients with type 1 diabetes .

RESEARCH DESIGN AND METHODS Design Participants Procedure Measures Statistical analyses RESULTS Participant characteristics Internal consistency Construct validity Normative data Factor analysis CONCLUSIONS

PMC1538782

the determination of a biomolecule 's complete three - dimensional structure provides invaluable information about the molecule 's function , and how that function might be modulated . unfortunately , determining protein or nucleic - acid structures from the molecules themselves is difficult owing to physical impediments . likewise , accurate computational prediction of such structures from physical principles remains computationally intractable owing to the overwhelming number of degrees of freedom in the system . techniques that can determine constraints on the potential molecular conformations can dramatically improve the chances of determining structures with both measured and predictive methods . one possible method for predicting physical proximity is to examine large families of sequences that have presumably similar structures , and to catalog positional pairs that show correlation between the identities of the residues occupying them . this calculation produces a four - dimensional matrix of positions , identities , related positions and strengths of relationship . for a small rna molecule of 80 nt , this 4d matrix contains 160 000 values , while a small protein of 300 amino acids produces a cross - correlation matrix containing 39 690 000 values . since there is no single value or distinctly definable pattern amongst these values that signals a structural relationship , an abstraction that allows the expert researcher to visualize , interpret and query the matrix is clearly necessary ( ) . mavl / stickwrld was developed to visualize interpositional dependencies within nucleic acid and amino acid sequence alignments ( 1,2 ) . in this representation , a positional weight matrix representing the alignment is wrapped around a cylinder by placing spheres for each identity and position . the diameters of the spheres are proportional to the percentage frequency of the corresponding identity . the diameter of the sticks is based on the over - representation or under - representation of sequences sharing these identities as compared with a weight - matrix - based expectation for the sequences as a family . this visualization method allows the researcher to detect patterns of pairwise positional dependencies easily , and comment on possible structural implications of these observations . in this paper , we present a complete rewrite of mavl / stickwrld in java3d ( ) . the new implementation has three significant areas of improvement over the vrml version : enhanced real - time user interaction ; clustering of residues by aggregate physicochemical properties and availability of pre - calculated stickwrld wrlds for all families in the pfam database ( 3 ) . our java3d implementation leaves the computationally intensive calculation of the complete interpositional correlation matrix on the server , but moves the selection of features for display , to the client applet running on the user 's computer . it is no - longer necessary to completely re - compute the correlation matrix to change display preferences . therefore the user interface is no longer limited to a static graph with pre - applied statistical and display parameter choices . instead , the various stickwrld statistical parameters ( tr , the global over / underpopulation threshold ; pr , the per - edge overpopulation threshold ; nr , the per - edge underpopulation threshold ; and alpha , the edge - significance threshold ) , and display parameters such as residue coloring and grouping can be adjusted by the user on - the - fly . this allows the parameters to be adjusted to suit the complexity of the alignment being visualized , and the user can now toggle between coarse visualization parameters to quickly explore and locate interesting features of an alignment , and fine parameters to investigate detailed aspects of the relationship . to allow the system to more intuitively deal with the potentially weak relationships amongst poorly constrained sequences , this allows , for example , the conserved residue properties and interpositional requirements of distant homologs to be discovered , even in the absence of specifically conserved residues . residues can currently be grouped by hydropathy , charge and volume , and the relationship between these aggregate properties at each position visualized , just as the specific sequence identities can be . using this option in many protein families results in the discovery of correlated physical properties , even when the contributing residue identities fall below the significance threshold , or are obscured by other more dramatic individual - residue relationships . finally , we are interested in the distribution of the variety of interpositional relationships highlighted by mavl / stickwrld , amongst known sequence families . to facilitate access to this information , and to make it easier for researchers to examine popular sequence families , we have pre - computed stickwrld wrlds for the complete pfam database of sequence families . the pfam alignments , and the wrlds generated from them , are available directly from the mavl / stickwrld java interface . we currently house 7868 sequence families ( the average number of sequences per family is 23 and average sequence length is 227 ) from pfam , and we update the stickwrld database regularly . some interesting statistics have come out of our examination of this data collection : the average number of possible correlations per family is approximately 1 000 000 . on average , 5% of these display over / underpopulations > 10% of expected population ( tr > 0.10 ) . however , > 60% of those with tr > 0.10 have a significance better than 0.0001 . this strongly suggests that many of the relationships highlighted by mavl analysis are biologically relevant , rather than simple random outliers discovered by the massive number of correlations considered . the above improvements in the implementation result in fast , easy and accurate examinations of sequence families . enhanced user interaction and availability of pre - calculated stickwrld wrlds for pfam alignments provide fast and convenient analysis . grouping of the residues based on physicochemical properties supplies more information on conserved patterns within families . applying mavl / stickwrld to a typical protein domain results in improved understanding of the interacting residues , and the physical properties required to maintain structure or function . figure 1 shows stickwrld representations and corresponding three - dimensional protein structures for the pfam family of integrin alpha cytoplasmic regions ( pdb 1m8o shown ) . this family contains the short cytoplasmic region of integrin alpha chains , and has small , strongly conserved -helix , followed by a generally acidic region ( 4,5 ) . mavl / stickwrld analysis ( figure 1a ) suggests that there are two alternative preferred sequences within the family { r9 p10 p11 q12 e13 } or { y9 k10 m12}. that is , while the canonical structure contains an -helix , terminating in r9 and broken by prolines at p10 and p11 , there is an alternate sequence motif that contains neither p10 nor p11 , but instead a preferred tyrosine , lysine , methionine triplet at { 9 , 10 , 12}. a tutorial on reading the stickwrld diagrams produced by the java version is available from the mavl / stickwrld help - files page ( ) . furthermore , grouping of the residues by charge , to elucidate bulk - property - related propensities ( figure 1b , 1c ) reveals more molecular preferences of the distinct sequence subfamilies . the turn following the -helix of the cytoplasmic domain appears to be stabilized by either 5 residues following the pattern { 9 + , 10np , 11np , 12p , 13 } or 8 residues { 8 + , 9p , 10 + , 11 , 12np , 13np , 14p , 15 } ( + : positively charged , :negatively charged , p : polar , np : nonpolar ) there is also a preference in the first pattern for a slightly polar residue at 2 , and against a non - polar residue at this position . a high - resolution copy of figure 1 , as well as links to live versions of the java stickwrld diagram are available from the mavl / stickwrld help - files page ( ) . strongly conserved ( consensus ) residues of this small domain are colored and labeled in figure 1d , and participate in the 10-residue n - terminal -helix of the domain . acidic , and do not capture the sequence or property requirements , or suggest their involvement in stabilizing the hairpin . it is clear that the positively charged arginine and negatively charged glutamate are brought together by the hairpin , and can act in concert to stabilize the hairpin with the support of other polar and non - polar residues . while crystal or solution structures are not available for any non - proline - motif integrin alpha domains , we predict that the alternative positive residues at 8 and 10 , and negative residues at 11 and 15 will be found to interact similarly to stabilize the domain structure . mavl / stickwrld 's new java interface provides rapid exploration of alignment properties and insight into potential structural requirements that are embedded in the sequence identities . the analysis and visualization method has proven both intuitive and accurate for predicting likely structural features in protein and nucleic acid families for which representative crystal or solution structures are known . we are developing additional utilities to assist the researcher by providing automatic suggested partitions of sequence families into subgroups , and are actively extending our pre - computed analysis database so that researchers may mine other interesting structural features from the pfam families database . stickwrld graph representations of the integrin alpha cytoplasmic domain family alignments , and a corresponding domain solution structure . ( a ) shows interpositional correlations within the family in the form of a default stickwrld graph ; [ b ( detail ) and c ( overview ) ] show correlations obtained when residues are grouped by charge ( red positive , blue negative , cyan polar , tan slightly - polar , green non - polar , grey gap ) ; ( d ) illustrates the position of strongly conserved residues on the domain 's structure ( e ) displays strongly correlating residues based on mavl / stickwrld analysis of the aligned members of the domain .

the increasing availability of structurally aligned protein families has made it possible to use statistical methods to discover regions of interpositional dependencies of residue identity . such dependencies amongst residues often have structural or functional implications , and their discovery can supply valuable constraints that assist in the refinement of measured , or predicted molecular structure assignments . multiple alignment variation linker ( mavl ) and stickwrld [ w. ray ( 2004 ) nucleic acids res . , 32 , w59w63 ] were developed to analyze and visualize nucleic acid and protein alignments , to discover and illuminate position / location relationships to the user . the original system analyzed users ' data from a web - form submission and presented the user with a static vrml diagram describing their data . we are pleased to report that mavl / stickwrld has been completely redesigned and rewritten . mavl / stickwrld now functions as a platform - independent java applet , with real - time dynamic controls that enable much more intuitive exploration and interaction with the data . the system has also been upgraded to enable visualization of a range of aggregate residue properties , and an extensive database of pre - computed stickwrld diagrams based on pfam families is now available directly from the interface . the java stickwrld applet is available via the www at .

INTRODUCTION RESULTS AND DISCUSSION CONCLUSIONS AND FUTURE WORK Figures and Tables

PMC4020028

it is estimated that 80 million unexpected pregnancies yearly occur in the world of which 45 million end in abortion . in this direction , appropriate application of family planning is very helpful through reduction of mortality as a result of abortion , achievement to success in the promotion of maternal health , enhancement of women 's social position and overall social - economic development . the major causes of unexpected pregnancies are the failure in contraception methods and lack of selecting an efficient contraception method . on the other hand , appropriate and constants use of contraception methods are under the influence of having sufficient information about these methods and their side - effects . the best way to leave these problems out or to modify them is conducting counseling during the selection of a contraception method . appropriate counseling given by health services staffs can help to clients for select of the most efficient method and guarantee their achievement to their objectives in family planning and maternal health as well as the client 's satisfaction with the quality of these services through making a change in their awareness , skill and attitude toward pregnancy and contraception methods . therefore , it can be concluded that one of the basic principles to succeed in contraception methods is an appropriate family planning . previous qualitative research in family planning has introduced numerous obstacles , such as organizational and structural obstacles . mugisha and reynolds ( 2008 ) reported that organizational and structural factors such as availability of contraception methods , the related equipments and work overload are as effective elements on quality of family planning services . baraitser et al . ( 2003 ) in their study pointed out to lack of privacy , tiresome environment and unsuitable clients waiting room as the obstacles of clients participation in receiving family planning services . ( 2009 ) in their investigation on the obstacles in family planning services quality , reported that mismanagement and limitation of time act as the influencing factors . although qualitative research has detected these obstacles , these obstacles have not been studied with a proper sample size in a quantitative research in iran . detection of the most important and efficient obstacles , can speed up the initial steps to delete or modify these obstacles more efficiently and enhance the quality of family planning counseling . on the other hand , comparison of viewpoints in three groups of managers , staffs and clients the dissimilarity of these obstacles in viewpoints of the various individuals may lead to conflicts in their function either to delete or control these obstacles and eventually , result in failure of family planning counseling . therefore , in order to improve the quality of present counseling and to access the family planning goals and with regard to the importance of concurrent measurement of these viewpoints , the present study aimed to compare managers , staffs and clients viewpoints about organizational and structural obstacles in family planning counseling in health care centers in isfahan in 2012 . the present study is comparative descriptive cross - sectional one - step three - group study on 295 subjects including 59 managers , 110 staffs and 126 clients . a total of 20 health - care centers were selected through a lottery to recruit their staffs and clients . sampling was a census for staffs and convenient random sampling for a group of clients . inclusion criteria were married women aged 15 - 49 years who were using one of the contraception methods . the managers were selected through census sampling from 44 health - care centers as well as managers and family planning experts in provincial health centers and health centers number 1 and 2 in isfahan . the first section contained questions on managers , staffs and clients personal and fertility variables and the second section included a viewpoints survey questionnaire of organizational and structural obstacles in family planning . the viewpoints about organizational and structural obstacles in family planning were investigated by mean obtained score of answering 21 five - point likert scale questions in the questionnaire of viewpoint survey . the answers were scored as absolutely disagree ( grade 0 ) , disagree ( grade 1 ) , no idea ( grade 2 ) , agree ( grade 3 ) and absolutely agree ( grade 4 ) . organizational and structural obstacles were the obstacles such as lack of privacy , inadequate educational equipments and inadequate various supplies of contraceptives in health - care centers [ table 1 ] . content validity was used to confirm the validity of the questionnaire , prepared by referring to textbooks and valid articles . reliability of the questionnaire was confirmed through cronbach 's alpha test ( = 0.91 ) . data were collected through a self - report questionnaire in two groups of managers and staffs and self - report or questioning in the group of clients . data were analyzed by descriptive and inferential statistical methods one - way anova through spss . frequency distributions ( % ) of the responses to viewpoint surrey in managers , staffs and clients based on organizational and structural obstacles with regard to personal and fertility characteristics of the managers , there were 59 subjects ( 33 female and 26 male ) with a mean age of 43 5.5 years , with managerial experience of an official post for 10 6 years , of whom 79.7% were general physicians and 54.2% had two children . about 49.2% of the managers were relatively satisfied with continuing education programs concerning family planning counseling . with regard to personal and fertility characteristics in the group of staffs , there were 110 subjects with a mean age of 39.7 6.2 years with 13 6.7 years work experience in family planning counseling of whom 54.6% had bs of midwifery and 50.9% had two children . with regard to the staffs responses , mean daily number of clients referring to the center to receive counseling was calculated 10 6 and the staffs had spent 10 - 20 min for each counseling session . furthermore , 72.7% of the staffs were relatively satisfied with continuing education programs in relation with family planning counseling . with regard to personal and fertility characteristics of the clients , there were 126 subjects with a mean age of 29.7 5.8 years , 88.1% repetitive referrals , of whom 46.8% had education , lower than diploma , 92.1% were housewife and 56.1% had only child . about 41.3% of the clients reported the average time of waiting to receive family planning counseling as 10 - 20 min and 64.3% reported average length of time for each counseling session less than 10 min . on the other hand , 50.8% were relatively satisfied with the received family planning counseling in health - care centers . the obtained results with regard to subjects viewpoints reveal that the mean score of viewpoint about organizational and structural obstacles in family planning counseling in three groups of managers , staffs and clients were 49.60 16.40 , 49.50 17.15 and 48.30 13.15 respectively . one - way anova showed no significant difference in comparison of managers , staffs and clients viewpoints mean scores with regard to organizational and structural obstacles in family planning counseling ( p = 0.677 ) . as presented in table 2 , based on the obtained scores from organizational and structural obstacles questionnaire and their classification in five sub - groups , most of the managers ( 40.7% ) , staffs ( 48.2% ) and clients ( 56.3% ) reported the existence of organizational and structural obstacles in family planning counseling in moderate level . frequency distribution of viewpoint scores in three groups of managers , staffs and clients in relation with organizational and structural obstacles in family planning counseling table 1 shows that the frequency distribution of the responses to questions on organizational and structural obstacles are different in three groups of managers , staffs and clients . in the present study , most of the managers , staffs and clients reported that organizational and structural obstacles act as the obstacle in family planning process in a moderate level . in direction with the obtained results , akers et al . ( 2010 ) stated that there are numerous obstacles in family planning counseling from the side of health providers and health services system . in the present study , despite the agreed viewpoints of most of the managers and staffs with regard to staffs work overload and lack of adequate time for family planning counseling , most of the clients disagreed with this issue . research in quality of services and family planning centers reported that health providers are busy and this act as a factor for reduction of quality . this difference in viewpoints may be possibly due to the fact that clients did not observe so much services given by staffs to clients in their waiting time to assume they were working busily . staffs work overload from managers and staffs viewpoints can also be interpreted as spending a lot of time to record data in the files . therefore , the findings show the necessity of a clients appointment management system to relieve daily workload as well as running an electronic system to record the data to speed up provision of services . previous researches in relation with quality of family planning services and the quality of the centers providing these services have reported problems such as clients problems in receiving family planning services , staffs ignoring the clients and not spending adequate time on them despite having free time , staffs inappropriate behavior , long waiting time to receive family planning counseling , low interested and motivated staffs , lack of staffs commitment in the provision of family planning counseling properly , ignoring clients suggestions and desires during counseling and low experience of family planning counselors . in the present study , most of the managers , staffs and clients disagreed with the existence of these obstacles in family planning counseling . kols and sherman ( 1998 ) stated that clients may pretend being satisfied with the services as a result of pleasing the staffs , fear of missing services in future and cultural reasons . on the other hand , as the present study is quantitative while the studies from which the primary concepts were extracted were qualitative , it can be supposed that these problems also existed in the study population of the present study although most of the clients disagreed with the existence of such obstacles in family planning counseling process . , it may reveal the necessity of planning to reduce these problems , even in a low amount . in the other research on the quality of family planning services and the centers providing these services , reported factors such as inadequate various supplies of contraceptives in the health - care centers and limitations in the provision of some contraception methods despite being selected for the subjects in family planning counseling in all physical conditions for example absence of mense to insertion of intrauterine devices ( iud ) , lack of educational facilities and privacy as the factors to reduce the quality of services . these factors were the obstacles in conducting counseling from the viewpoint of most of the managers , staffs and clients in the present study . therefore , it is essential to modify the shortage of various supplies of contraceptives in health centers and educate health providers , prepare educational facilities and educate the staffs to use these facilities during family planning counseling as well as to provide a room for family planning counseling in health - care centers to respect clients privacy . in the present study , opposite to viewpoints of most of the staffs and managers , most of the clients preferred to refer to private health centers . it possibly shows that the clients accepted to tolerate higher costs to receive higher quality care in those centers . as mohammad - alizadeh et al . ( 2009 ) reported that clients prefer to refer to private centers due to low quality services of governmental centers . therefore , service providers should investigate the cause that makes the clients leave out of charge services in governmental centers and refer to other centers . with regard to viewpoints of most of managers concerning lack of sufficient information provision in the centers , most of the staffs and clients denied the existence of this problem as an efficient obstacle in family planning counseling . ( 2007 ) introduced this factor as a reducing element for quality of family planning services . it can be argued that this response from clients is as a result of their lack of awareness form the amount of word , the staffs may have denied this obstacle , due to supporting their position and their other colleagues and existence of their personal beliefs in the concept of adequacy of information provision . however , managers agreement with this issue can be due to factors such as lack of their trust in adequacy of information provided by the staffs , lack of their proper supervision on the manner of staffs services and the managers belief in staffs work overload and their disability to provide the information adequately . it seems that for detection of these obstacles more precisely , conducting more studies in relation with the evaluation of level and quality of transferred information to clients is essential . baraitser et al . ( 2003 ) argued that teenage clients were dissatisfied with the suitability of the waiting room in their family planning counseling . in addition , with regard to negative viewpoints of most of the managers and clients concerning unsuitability of the waiting room , most of the staffs accepted the existence of such obstacle in family planning counseling , which can be as a result of clients low expectation and preservation of managers prestige in position of the authorities to supervise the appearance and physical atmosphere of the centers . it is notable that the staffs as the persons attending the centers more than the managers and clients may detect problems in the centers , which need more attention . the other finding is agreement of the managers and the staffs on the fact that the staffs care making files for clients to respond to their problems and not provision of sexual counseling related to preconception methods , for which most of the clients disagreed . in qualitative study of mohammad - alizadeh ( 2008 ) , the clients referring to health centers complained of ignoring their sexual problems related to contraception methods and claimed that the staffs pay more attention to completing their medical file related to their problems . the clients dissatisfaction may be related to lack of clients expectations and respect to health providers , fear of responses to receive the services and their outcomes , not feeling comfortable to talk in relation with sexual subjects . on the other hand , it should be noted that acceptance of most of the managers , staffs and a number of clients concerning these obstacles revealed the existence of such problems in the health system and necessitates planning to solve these problems through making electronic clients files to provide them with the needed care and reduce waste of time and staffs concern for recording patients manually in order to have more time and peace to provide clients with services . in the present study , most of the staffs , opposite to other two groups , agreed that forbid to attendance of men in counseling sessions is an obstacle in family planning counseling process . ( 2008 ) reported the same limitation for men to attend the session during receiving family planning services . the reason for this difference is possibly in their viewpoint in not experiencing their spouses attendance due to working shift of the centers ( just mornings ) . therefore , in order to involve men in family planning counseling more , these problems should be solved through planning and educating the staffs to let women attend with their spouses in family planning counseling as the staffs accepted to have this obstacle in health - care centers . in general , the results of the study showed that the mean viewpoint score of the managers , employees , and clients in the field of organizational and structural obstacles have been different . the findings showed that organizational and structural factors are not considered so important by the clients as the health system planners believe . more investigation and administration of a need assessment are essential to detect the existing basic clients concerns through group discussion sessions with the presence of three major components in services provision receive system and all problems should not be related just to the health system .

background : organizational and structural obstacles are a group of major obstacles in achievement of appropriate family planning counseling . detection of these obstacles from the viewpoint of managers , staffs and clients who are key members in health services providing system is a major step toward appropriate planning to modify or delete this group of obstacles . the present study was conducted with the goal of comparing managers , staffs and clients viewpoints about organizational and structural obstacles in family planning counseling in health - care centers in isfahan in 2012.materials and methods : this is a cross - sectional one - step three - group comparative descriptive study conducted on 295 subjects including 59 managers , 110 staffs and 126 clients in medical health - care centers in isfahan in 2012 . managers and the staffs were selected by census sampling and the clients were recruited through convenient random sampling . the date collection tool was a researcher made questionnaire , which was designed in two sections of fertility and personal characteristics and viewpoint measurement . descriptive and inferential statistical test were used to analyze the data.results:the obtained results showed no significant difference between mean scores of viewpoints in three groups of managers , staffs and clients concerning organizational and structural obstacles in family planning counseling ( p = 0.677 ) . in addition , most of the managers , staffs and clients reported organizational and structural obstacles as the obstacles in the process of family planning in moderate level.conclusion:the results showed the necessity of health services managers planning to modify or delete organizational and structural obstacles especially the agreed obstacles from the viewpoint of managers , staffs and clients .

I M R D C

PMC3351598

myosin binding protein c ( also known as c - protein : mybp - c ; cardiac isoform abbreviated : cmybp - c ) was discovered in 1973 ( offer et al . 1973 ) and is located on 79 stripes of 43 nm spacing in each half of the a - band ( cross bridge bearing zone , c - region ) of the sarcomere in skeletal and cardiac muscles ( fig . 1 ) . to date three different mybpc proteins are known , each encoded by different genes ( mybpc 13 ) , where slow ( mybpc1 , 1141 aa ) and fast ( mybpc2 1141 aa ) twitch muscle isoforms are restricted to skeletal muscle tissues and whereas mybpc3 ( 1273 aa ) is expressed exclusively in cardiac myocytes ( furst et al . 1992 ; gautel et al . 1995 ; weber et al . 1993 ) . all mybpc molecules share common architectural features : they are composed of seven immunoglobulin domains ( ig ) and three fibronectin type iii domains ( fniii ) called c110 where a 105 amino acid myosin binding protein motif is localized between c1 and c2 . in addition , a proline and alanine rich ( pa ) domain is localized near the aminoterminus ( fig . 2 ) . domains c9c10 interact with titin and c10 interacts with light meromyosin ( lmm ) ( freiburg and gautel 1996 ) . the actin and s2 ( head region ) myosin heavy chain binding regions are located at the aminoterminus ( fig . 2 ) . skeletal muscle mybpc also interacts with nebulin , but this interaction is not well studied ( jin and wang 1991 ) ( for a review ( kontrogianni - konstantopoulos et al . 2009 ) ) . another novel interaction between the cardiac specific c0 domain and the regulatory light chain ( rlc ) has been analyzed by ratti et al . 2depicts the structure of mybpc3 as well as highlights important structural domains and indicates mybpc3 interacting proteins . please note : the number of phosphorylation sites localized in the mybpc motif is species dependent . ig immunoglobulin , p / a proline / alanine , fn fibronectin ) electron micrograph of rat cardiac muscle labelled with a mybpc antibody . 2008 ) ( with dr pradeep luther s kind permission ) depicts the structure of mybpc3 as well as highlights important structural domains and indicates mybpc3 interacting proteins . please note : the number of phosphorylation sites localized in the mybpc motif is species dependent . ig immunoglobulin , p / a proline / alanine , fn fibronectin ) in addition , domains in the mid - region ( c5c8 ) have been hypothesized to interact with one another , forming a trimeric collar that constrains the thick filament ( moolman - smook et al . also , a slightly different model of mybpc organisation within the sarcomere has been proposed by squire et al . these authors due to structural considerations and because domains c7c10 are also reported to interact with titin , which is unlikely to run other than axially along the myosin filament , propose a model whereby the carboxyterminal end of mybpc is aligned axially , which contrasts the collar alignment structure ( fig . 3).fig . 3summarizes the major differences between the mybpc models proposed by ( moolman - smook et al . 2003 ) ( b ) . please note in a mybpc forms a trimeric collar that constrains the thick filament ( moolman - smook et al . top : schematic diagram showing a single mybpc protein interacting with myosin ( top view ) , bottom : side view . whereas in b the carboxyterminal end of mybpc is aligned axially ( squire et al . 2003 ) . top view : a thick filament is represented along with six surrounding actin filaments ( in striated muscle ) , the broken circle represents the c0 domain in the mybpc3 isoform . transparent ghosts to indicate their position ( grey circles : mybpc3 with green indicating the p / a rich domain ; yellow / brown : myosin , dark grey : actin ; figures are from : ( squire et al . 2003 ) with kind permission from the authors and the publisher ( journal of molecular biology ) ) summarizes the major differences between the mybpc models proposed by ( moolman - smook et al . please note in a mybpc forms a trimeric collar that constrains the thick filament ( moolman - smook et al . top : schematic diagram showing a single mybpc protein interacting with myosin ( top view ) , bottom : side view . whereas in b the carboxyterminal end of mybpc is aligned axially ( squire et al . 2003 ) . top view : a thick filament is represented along with six surrounding actin filaments ( in striated muscle ) , the broken circle represents the c0 domain in the mybpc3 isoform . ghosts to indicate their position ( grey circles : mybpc3 with green indicating the p / a rich domain ; yellow / brown : myosin , dark grey : actin ; figures are from : ( squire et al . 2003 ) with kind permission from the authors and the publisher ( journal of molecular biology ) ) however three major differences exist between the cardiac and skeletal muscle isoforms : mybpc3 consists of an additional immunoglobulin domain ( c0 ) at its amino - terminus , the domain c5 contains a proline rich 25 residue insertion and several phosphorylation sites are species dependent localized in the myosin binding motif ( gautel et al . mybpc3 mutations were first reported in 1995 , which was an important discovery ( bonne et al . 2006 ) and depending on the population analyzed , mybpc3 mutations are found in up to 4050% of the genotyped hcm patients ( richard et al . to date about 200 different mybpc3 mutations have been reported ( marston 2011 ; schlossarek et al . mybpc3 mutations are associated with a slightly lower penetrance , later onset of disease and with milder forms of disease progression in comparison to other hcm causing mutations located for example in the beta myosin heavy chain ( myh7 ) gene ( niimura et al . however this general statement may not necessarily be true for all mybpc3 mutations and indeed some mybpc3 mutations are associated with a poor prognosis . for example a recently discovered deletion in intron 32 in mybpc3 ( nt 21348 - 21372 , accession no . u91629 ) , leading to a pre - terminal stop codon , has been found at a frequency of about 4% in india and south east asia , with significant impact on human heart failure ( dhandapany et al . 2009 ; waldmuller et al . 2003 ) . while this mutation has been initially described in hcm patients , it is important to note that this mutation is also associated with other types of cardiomyopathy such as dcm . other mybpc3 mutations primarily found in dcm patients have also been reported , for example the asn948thr missense mutation ( daehmlow et al . 2002 ) . in addition the mybpc3 arg502trp mutation with a frequency of about 2.4% is the most common hcm - causing mutation among individuals of european descent in the usa ( saltzman et al . however other mutations may be prevalent in different european populations , such as in the netherlands , where three different founder mutations are present : ( i ) the c.2373_2374insg mybpc3 which is present in the great majority of hcm patients ( up to 25% ) and where ( ii ) the c.2864_2865delct and ( iii ) the c.2827c > 2003 ; christiaans et al . 2010 ) . beside the important mutations in mybpc3 , mybpc1mutations are a cause of distal arthrogryposis type 1 ( da1 ) , a disease characterized by congenital contractures of the hands and feet ( gurnett et al . although by now mybpc3 mutations are well known causes of hcm and dcm including associated heart failure , the underlying molecular mechanisms are not well defined , some of which will be discussed in the next chapters . to gain more insight into the underlying molecular mechanisms , mybpc3 has been deleted in genetically altered mouse models by two independent groups . loss of this protein is not associated with any embryonic lethality and mybpc3 also is not essential for sarcomere formation but its absence results in profound eccentric hypertrophy in the homozygous animals ( carrier et al . hemodynamic analysis in the mice generated by the carrier group , where exons 1 and 2 have been deleted , revealed the presence of normal contractility but severe diastolic defects . in addition heterozyogous animals develop septal hypertrophy , a hallmark of hcm ( carrier et al . 2004 ) . however these animals were engineered so that they harbour a complete ablation of the gene and therefore are useful to identify basic mechanisms , but the overwhelming majority of human mutation carriers express mutant mrnas and probably proteins , which makes it difficult to relate these data directly to the situation in patients . therefore , in addition to the pure knockout models , wildtype mybpc3 and different mybpc3 mutants have been overexpressed in various models such as an amino - terminal truncated mybpc3 , which mimics a certain type of human mutations which lead to the loss of the carboxyterminal domains including the titin and myosin binding sites . overexpression of the mutant , but not the wildtype protein , caused major features of hcm including hypertrophy and an increase in calcium sensitivity ( yang et al . whereas above mentioned transgenes were well expressed at the mrna and protein levels , overexpression of a mybpc3 mutant lacking only the myosin binding domain resulted in the expression of only very modest levels of mutant protein ( i.e. about 5% ) which led to a mild hypertrophy and heart failure phenotype ( yang et al . two additional knock in mouse models have been engineered to carry mutations found in patients and which affect titin and myosin binding . interestingly animals homozygous for these mutations develop a dcm like phenotype with depressed contractility and hypertrophy ( mcconnell et al . another knock in mouse model was generated such that the mutant protein did not contain the aminoterminal myosin binding domain . the mutant protein was readily integrated into the sarcomeres of heterozygous and homozygous animals , was pka phosphorylatable and major structural defects could not be detected . however this mutation was associated with a significant increase in calcium sensitivity ( witt et al . an additional mouse knock in model , based on a g > a transition located on the last nucleotide of exon 6 and which was found in a patient with hcm , has been generated by lucie carrier s group . interestingly this mutation gives rise to three different mrnas : ( i ) missense mutation ( ii ) nonsense due to exon skipping , frameshift and premature stop codon and ( iii ) deletion / insertion as nonsense but with additional partial retention of a downstream intron which restores the reading frame and which leads to an almost full length protein . homozygous animals develop hypertrophy , interstitial fibrosis and decreased myocardial function whereas heterozygous animals do not have any obvious phenotype ( vignier et al . additional genetically altered mouse models have been generated to study mybpc3 phosphorylation , which will be discussed in the next chapter . human mybpc3 contains at least four phosphorylation sites which are localized inside the myosin binding motif ( serines 275 , 284 , 304 , with an additional phosphorylation site not unequivocally identified ) ( copeland et al . 2010 ) ) , the mouse myosin binding motif contains three to four sites ( serines 273 , 282 , 302 , ( 305 ) ) and five sites have been identified in the canine genome as well as three sites in the rat genome ( jia et al . these phosphorylation sites are targets of protein kinase a ( pka ; serines 273 , 282 , 302 ) ( gautel et al . 1995 ) , protein kinase c ( pkc ; serines 273 , 302 ) ( mohamed et al . 1998 ) , calmodulin dependent kinase ii ( camkii ; serine 302 ) ( gautel et al . 1995 ) , protein kinase d ( pkd ; serine 302 ) ( bardswell et al . 2010 ) and ribosomal s6 kinase ( rsk ; serine 282 ) ( cuello et al . 2011 ) . mybpc3 phosphorylation also has been studied in various transgenic mouse models , for example lines have been established where the phosphorylation sites ( ser273 , ser282 , and ser302 ) , along with two adjacent sites that could be potentially phosphorylated ( thr272 , thr281 ) , were converted to alanines . while overexpression of wildtype mybpc3 was able to rescue the mybpc3 null phenotype , the non - phosphorylatable mybpc3 was not ( sadayappan et al . 2005 ) . also a similar approach has been used to analyze mybpc3 phosphorylation by generating animals whereby only the three known phosphorylation sites were converted into alanines ( t3sa ) . again these animals showed , when crossed into the mybpc3 null background , in addition to hypertrophy systolic and diastolic defects , further supporting the notion that pka phosphorylation of mybpc3 is important for myocardial function ( tong et al . 2008 ) . these animals showed an increase in contractility and relaxation of about 22 and 25% , respectively . an increase in the phosphorylation of the remaining mybpc3 and other proteins such as troponin i and phospholamban was also observed ( yang et al . 2001 ) . the reverse experiment , i.e. overexpression of a phosphomimetic mybpc3 in a mybpc3 null background , has also been performed , which resulted in subtle changes in sarcomeric ultrastructure characterized by increased distances between the thick filaments which may indicate that phosphomimetic mybpc3 affects thick thin filament relationship . the phosphomimetic mybpc3 also prevented interaction with myosin heavy chain in vitro as analyzed by yeast two hybrid and pull down assays . this effect is difficult to explain , but it may well be that phosphomimetic mybpc3 prevents an increase of thick filament packing density which is associated with reduced calcium activated force generation . an alternative explanation could be that phosphorylated mybpc3 is protected from calpain ( see also later ) mediated proteolysis ( sadayappan et al . it is probably important to mention , that loss of mybpc3 phosphorylation also has been observed in failing human hearts and strategies to increase its phosphorylation may have cardio - protective effects ( copeland et al . 2006 ) . above mentioned studies have been intensified by generating mouse models overexpressing various single or double phosphomimetic or non phosphorylatable serines in the mybpc3 knockout background ( i.e. the cmybp - c , cmybp - c , cmybp - c ; on position s-273 , s-282 and s-302 , respectively ) . one major conclusion of these studies is that s-282 has a unique regulatory role in that its phosphorylation is critical for the subsequent phosphorylation of s-302 , but that all residues play a role in regulating the contractile response to -agonist stimulation ( sadayappan et al . 2011 ) . although there is now compelling evidence supporting the notion that mybpc3 phosphorylation modulates contractility by controlling the proximity of the myosin heads to actin , however the precise molecular mechanism remains unclear ( reviewed in ( barefield and sadayappan 2010 ; schlossarek et al . 2011 ) ) . in particular when using in vitro systems it was shown that mybpc3 phosphorylation can abolish the ability of mybpc3 to interact with the s2 region of the myosin heavy chain but may enhance mybpc3 interactions with the thin filament . vice versa dephosphorylation results in strong binding of mybpc3 to the myosin head , probably preventing its force generating strong interaction with actin ( kulikovskaya et al . however recent data also indicate that mybpc3 may act synergistically with the myosin rlc to enhance cross - bridge formation by altering the interaction of the myosin head with actin . it may well be that this interaction depends on phosphorylation of either mybpc3 or rlc and may well be able to provide another mechanism how phosphorylation of sarcomeric proteins may affect protein / protein interactions and kinetics of force development ( colson et al . although it is well known that the distance between thick and thin filaments is a major determinant of calcium sensitivity and that loss of mybpc3 is associated with increased calcium sensitivity , the precise molecular mechanism of how mybpc3 phosphorylation affects this system is unknown . part of this problem is that pka phosphorylation decreases calcium sensitivity via troponin i phosphorylation which leads to a decrease in tropinin c calcium sensitivity . however mybpc3 phosphorylation , which decreases calcium sensitivity , has no effect on interfilament spacing ( colson et al . future studies , based on various transgenic animals , will certainly help to answer this question . in general two different molecular mechanisms may account for the observed pathologic effects of any mutation : ( i ) poison peptide ( functional integration of a mutant protein ) ( ii ) haploinsufficiency ( loss of one allele ) . however , any mutation may also cause disturbances in the degradation of such a product , including its mrna . for example , the mrna might be degraded via nonsense mediated mrna decay or the protein may be degraded via the ubiquitin proteasome system ( ups ) with implications for protein degradation in general , including autophagy . most of the more than 600 known hcm causing mutations located in other sarcomeric protein genes are point mutations or single amino acid deletions ( van driest et al . 2004 ) , hence the poison peptide mechanism seems to be the likely mechanism for these mutations . in contrast , the most frequent type of mybpc3 mutation affects splice acceptor and donor sites or are deletions or insertions predicted to result in truncated mybpc3 proteins ( van driest et al . 2004 ) . however , multiple studies were unable to detect or document the presence of the predicted truncated mybpc3 molecules . for example van dijk and colleagues analyzed the c.2373dupg and the c.2864_2865delct mutations and found a significant decrease in mutant mybpc3 mrna . also they detected a significant loss of mybpc3 protein but were unable to detect the truncated proteins ( van dijk et al . marston and colleagues studied mybpc3 protein expression in two patients carrying the glu258lys and the arg502trp missense mutations in addition to seven other mutations which are predicted to lead to premature terminations and truncated proteins . however no truncated protein was detectable and in all samples studied significant lower amounts of mybpc3 protein was detected ( marston et al . another complex mutation where a t to a transition occurred on position 2604 together with a deletion of c at 2605 was predicted to lead to a truncated protein ( 1 - 868 + 13 nonsense amino acids with a premature stop codon in c7 ) was also studied in great detail , but no truncated mybpc3 protein could be detected ( jacques et al . 2008 ) . in summary , several different studies failed to detect truncated mybpc3 proteins in mybpc3 mutation carriers , which makes the poison peptide mechanism unlikely to occur in the studied mutations / individuals . also these studies documented loss of mybpc3 protein in mutations carriers , with only 6775% of the normal protein present , which indicates haploinsufficiency may contribute to the phenotype . myosin interaction and by binding to both proteins it may directly affect calcium sensitivity . by employing skinned myocytes from patients with hcm mutations , a variety of studies showed that mybpc3 mutations are associated with higher calcium sensitivity . however , these data may also result from low levels of troponin i ( tni ) phosphorylation present in the myectomy tissue rather than the mutation itself ( hoskins et al . nevertheless an increase in calcium sensitivity in myocardial samples obtained from patients affected by mybpc3 mutations is likely because removal of mybpc3 from myocardial samples under experimental conditions is associated with an increase in calcium sensitivity ( hofmann et al . 2003b ) and an increase in calcium sensitivity has also been shown in mybpc3 deficient myocardium ( rybakova et al . 2011 ) . calcium sensitivity depends on the rate of calcium binding to or calcium release from troponin c and kinetic studies suggest that for hcm causing mutations the rate of calcium binding to tnc is increased , but it remains to be elucidated whether this is a general phenomenon or whether other determinants of calcium sensitivity such as the tnc calcium dissociation rate may also be affected and whether this holds true for mybpc3 mutations ( dong et al . therefore , mybpc3 mutations may primarily increase calcium sensitivity ( gain of function ) which may cause faster cross bridge cycling ( hypercontractility ) , but which may also cause incomplete relaxation , a cause of diastolic dysfunction frequently observed in hcm . this concept also is supported by hemodynamic data obtained from mybpc3 deficient animals , where no systolic but severe diastolic dysfunction has been observed ( carrier et al . it might well be that mybpc3 mutations are primarily linked to an increase in calcium sensitivity , but it is difficult to link this event directly to the secondary effects such as myocardial hypertrophy including myofibrillar disarray , fatal arrhythmias and sudden cardiac death ( fig . 4 ) . one hypothesis proposes energy deficiency due to reduced thermal efficiency in hcm or another hypothesis states that troponin c functions as an intracellular calcium buffer or calcium store ( bers 2008 ) . an increase in calcium sensitivity could affect calcium transients , which indeed have been found to be increased in myh6 arg403gln knock in animals ( gao et al . an increase in calcium transients may also have effects on calcium dependent enzymes such as calcineurin , calmodulin dependent kinase , and protein kinase c all of which have been shown to be important for the initiation of myocardial hypertrophy ( kubis et al . 2003).fig . 4summary of possible pathologic events caused by a primary increase in calcium sensitivity , which has been shown to be present in various mybpc3 transgenic animal models as well as in patients affected by mutations in the mybpc3 gene . camkii calmodulin dependent kinase ii , pkc protein kinase c summary of possible pathologic events caused by a primary increase in calcium sensitivity , which has been shown to be present in various mybpc3 transgenic animal models as well as in patients affected by mutations in the mybpc3 gene . camkii calmodulin dependent kinase ii , pkc protein kinase c the hypothesis that sarcomeric hcm mutations lead to inefficient atp utilization was proposed by the watkins group and is an attractive model , because it is able to explain many different features found in hcm ( ashrafian et al . according to this theory a lower atp / adp + p ratio may contribute to energy depletion in critical compartments , which may affect calcium re - uptake and lead to an increase in calcium concentrations and thus activation of calcium dependent enzymes such as calcineurin . another consequence is the activation of adenosine monophosphate kinase ( ampk ) , which is also able to induce hypertrophy and yet another consequence is the increase in mitochondrial demands which may lead to an increase in reactive oxygen species , mitochondrial abnormalities and apoptosis all of which have been observed in various patients affected by hcm ( ishikawa et al . as pointed out above most mybpc3 mutations lead to haploinsufficiency but some missense mutations might escape targeted removal and might well be expressed in the myocardium . this might particularly be true for the reported aminoterminal mutations g5r , r35w and t59a in the human genome ( sarcomere protein gene mutation data base ) as well as for the a31p mutation observed in maine coon cats ( meurs et al . 2005 ) , all of which are linked to hcm . ratti and co - workers ( ratti et al . 2011 ) studied above mentioned missense mutations . while g5r had only mild effects , a31p could not be expressed as a soluble protein and t59a was not chosen as in many other species a threonine residue is substituted by an alanine and no extreme effects were expected , the r35w seemed to be important for binding to rlc . mybpc3 mutations by modulating calcium sensitivity may also have effects , either directly or indirectly , on mechanosensation and mechanotransduction . for example , changes in calcium transients caused either via an increase in calcium sensitivity or via inefficient atp usage , may have effects on calcium dependent enzymes which may in turn affect mechanosensory effects . for example , calcineurin mediated nfat and gata4 activation , protein kinase c mediated effects on mybpc3 itself or calmodulin kinase ii effects on phospholamban and or ryanodine receptor phosphorylation may contribute to changes in gene expression and myocardial remodelling . myocardial hypertrophy and remodelling itself may lead to changes in bio - mechanical properties of the heart , which feeds back to changes in intracellular signalling ( knll et al . the sarcomeric z - disc is a central nodal point for signalling ( knll et al . 2011a ) and changes in z - disc structure or composition may well affect its function . in this context , the e3 ubiquitin ligase atrogin 1 has been found to colocalize at the sarcomeric z - disc with a truncated mybpc3 which may have consequences for z - disc mediated signalling ( mearini et al . however it remains unclear whether above mentioned changes in intracellular signalling , if not alone able to cause effects , will sensitize the myocardium at predisposed locations to maladaptation . it also remains to be seen whether z - disc mediated apoptotic events play a role in mybpc3 related hcm ( knll et al . it remains also unclear , how mybpc3 mutations are linked to fibrosis as well to intracellular and cellular myofibrillar disarray . it might well be that fibrosis , which is probably an early event in hcm , causes myofibrillar disarray by displacing existing cardiac myocytes , but it remains unclear how intracellular disarray develops . in this context , myofibrillar disarray contributes certainly to inefficient energy use ( i.e. cardiac myocytes are not aligned properly ) . a recent study on hcm myocardial biopsies , including those from patients affected by mybpc3 mutations , supports the view that fibrosis is an early event and is present even before the onset of hypertrophy ( ho et al . inhibition of fibrosis , either via anti tgf antibodies or the angiotensin ii type 1 receptor antagonist losartan prevented onset of hypertrophy , non myocyte proliferation and fibrosis in genotype positive but hypertrophy negative ( pre - hypertrophic ) animals ( teekakirikul et al . 2010 ) . these data point as well to the importance of other cell types than cardiac myocytes which are inherent in the myocardium and which contribute significantly to the phenotype ( knll et al . 2011b ) . a novel link between an increase in myofibrillar calcium sensitivity and arrhythmias has been uncovered recently . an increase in calcium sensitivity led to a change in the shape of the ventricular action potentials in mice which results in shorter effective refractory periods , greater beat to beat variability of action potential durations and increased dispersion of ventricular conduction velocities at higher heart rates all of which may predispose to the occurrance of arrhythmias . these effects were greatest in hcm causing troponin t mutant animals and most importantly , these effects were reproduced when the calcium sensitizer emd57033 was used and they were reversible when blebbistatin , a calcium de - sensitizer , was employed . another important finding of this study is that the degree of myocardial hypertrophy does not correlate with the arrhythmia risk ( baudenbacher et al . other mechanisms may involve above mentioned energy depletion with consecutive effects on energy dependent ion exchanges ( ashrafian et al . 2003 ) , loss of cardiac myocytes via apoptosis , necrosis or autophagy which may lead to electric isolation of single cardiac myocytes and fibrosis ( teekakirikul et al . another important approach has been used by lucie carrier s group , when they analyzed the degradation process of mybpc3 . this group found that the e3 ubiquitin ligase atrogin 1 interacts with both , mutant ( a 32 kda mybpc3 truncated protein , based on a human mutation and which comprises only of domains c0 and parts of c1 termed m7t - cmybp - c ) and wildtype mybpc3 , but only the mutant mybpc3 was targeted for degradation . this makes atrogin 1 also a novel mybpc3 interacting protein , but whether the interaction of atrogin 1 and full length wildtype mybpc3 is physiologically relevant remains to be seen . interestingly atrogin 1 and m7t - cmybp - c co - localize at the sarcomeric z - disc , which points to the importance of this structure in protein degradation processes ( mearini et al . their data also indicated that muscle ring finger protein 1 ( murf1 ) regulates mybpc3 mrna and protein via a posttranscriptional mechanism ( mearini et al . also , calpain 1 , a ubiquitously expressed calcium dependent protease and which localizes to the sarcomeric z - disc and i - band via interactions with titin , interacts with mybpc3 as well and might contribute to mybpc3 turnover ( jiang et al . 2002 ; kontrogianni - konstantopoulos et al . 2009 ) . in addition , the lysosomal inhibitor bafilomycin a1 caused an increase in truncated mybpc3 proteins , which points to the possible involvement of autophagy in mybpc3 related degradation processes . as briefly mentioned above , domains c5c8 have been hypothesized to interact with one another , forming a trimeric collar that constrains the thick filament . interestingly , mutations r654h and n755k , both are hcm causing and located in c5 , decreased the affinity to c8 about 2-fold and by at least 10-fold , respectively ( moolman - smook et al . disturbances of intra- mybpc3 interactions by mutations are a completely novel approach to explain the complex phenotype observed in genetically altered animal models as well as in human patients . mybpc3 mutations like the majority of all other cardiomyopathy causing mutations are associated with incomplete , age and gender dependent penetrance . powerful epigenetic and environmental factors are thought to have a major impact on the phenotype , which also implies the possibility of effective therapeutical interventions . if increased calcium sensitivity is the primary event which leads to hcm in mybpc3 mutation carriers then calcium desensitizers might be able to influence positively disease progression , which has been shown in animal models ( baudenbacher et al . however dcm is associated with decreased calcium sensitivity and precise calibration of calcium sensitivity is certainly important and needs to be monitored properly , if applied in therapy . another although still very experimental approach is to use short oligonucleotides to intervene in mrna processing such that exon skipping events can be used therapeutically to prevent the synthesis of pathologic mrnas or to use sirnas / mirnas to suppress pathologic mrnas calcium antagonists such as diltiazem have been successfully used to suppress hcm in the r403q alpha mhc transgenic mouse ( semsarian et al . 2002 ) as well as in a mouse model carrying the tnt - i79 n mutation ( westermann et al . . however it will be important to find out , whether mybpc3 mutation positive patients will respond appropriately to this type of treatment . 2010 ) as well as parvalbumin overexpression in a glu180gln tropomyosin animal model rescued the phenotype in both of these lines , which points to the possibility of manipulating the calcium metabolism in order to treat the disease ( coutu et al . however while phospholamban ablation in muscle lim protein deficient ( minamisawa et al . 1999 ) and in glu180gly tropomysin transgenic animals ( alves et al . 2011 ) is favourable , ablation of the very same gene in mybpc3 transgenic animals is not ( song et al . it remains to be determined whether these differences are due to the well known differences between human and mouse physiology or whether these differences reflect differences in the underlying molecular mechanisms . another possibility might be to intervene at the level of energy metabolism via perhexiline which shifts substrate utilization away from free fatty acids to carbohydrates by inhibiting the enzyme carnitine palmitoyl transferase . perhexiline improved cardiac energetics , normalized exercise diastolic dysfunction and increased exercise capacity in patients ( abozguia et al . it remains also to be seen whether moderate physical activity in mybpc3 mutation carriers is favourable , as suggested by animal experimentation ( konhilas et al . indeed anti - apoptotic gene expression has been observed when animals were subjected to limited physical exercise ( konhilas et al . also calcineurin inhibition may have favourable effects as suggested by animal experimentation ( sussman et al . 1998 ) , but application of available calcineurin inhibitors such as cyclosporine a and tacrolimus , at doses needed to affect calcineurin activity in the heart , is associated with significant side effects such as hypertension , nephro - toxicity and diabetes , which precludes their application in human individuals . another way to inhibit hypertrophy is to use statins ( 3-hydroxy-3-methyglutarylcoenzyme a reductase inhibitors ) , which act via reducing membrane bound ras and thus reducing perk44/42 and erk1/2 activation which reduced hcm related symptoms in a r403q beta mhc transgenic rabbit model ( patel et al . however human pilot studies based on these animal experiments remained disappointing ( bauersachs et al . therefore it remains to be determined whether this approach is not applicable in general or whether a genotype phenotype specific analysis will identify patient subgroups more susceptible to this type of treatment . although mybpc3 has been the subject of intense research for almost over four decades , our understanding of its function in physiology and patho - physiology is still limited . however , mybpc3 mutations are a major cause of human cardiomyopathy and associated heart failure , with some disease causing mutations having frequencies of up to 4% in various populations . this may explain major features observed in patients such as the hypercontractile phenotype , changes in calcium transients , myocardial hypertrophy , the defect in relaxation and effects on remodelling including the development of myofibrillar disarray as well as the link to live threatening arrhythmias ( fig . future research will focus on the identification of pathways leading from a single mybpc3 mutation to the complex disease phenotype in patients . although challenging and certainly difficult to achieve , this approach will undoubtedly result in the development and design of patient specific , novel therapies . inducible pluripotent stem cells ( ips ) , gene therapy approaches , whole genome sequencing and determination of the explicit genotypes , as well as medicinal chemistry will have to be combined to increase our knowledge in this field .

myosin binding protein c ( mybpc ) is a crucial component of the sarcomere and an important regulator of muscle function . while mutations in different myosin binding protein c ( mybpc ) genes are well known causes of various human diseases , such as hypertrophic ( hcm ) and dilated ( dcm ) forms of cardiomyopathy as well as skeletal muscular disorders , the underlying molecular mechanisms remain not well understood . a variety of mybpc3 ( cardiac isoform ) mutations have been studied in great detail and several corresponding genetically altered mouse models have been generated . most mybpc3 mutations may cause haploinsufficiency and with it they may cause a primary increase in calcium sensitivity which is potentially able to explain major features observed in hcm patients such as the hypercontractile phenotype and the well known secondary effects such as myofibrillar disarray , fibrosis , myocardial hypertrophy and remodelling including arrhythmogenesis . however the presence of poison peptides in some cases can not be fully excluded and most probably other mechanisms are also at play . here we shall discuss mybpc interacting proteins and possible pathways linked to cardiomyopathy and heart failure .

Introductiondomain structure and binding partners Implication in human disease Animal models Phosphorylation None Implications for therapy Summary

PMC2933120

thyroid cancer is the most common malignant tumor of the endocrine system ; approximately 37,200 new cases were expected to occur in the united states in 2009.1 in the city of so paulo , brazil , 1207 and 6004 cases of thyroid cancer in males and females , respectively , were identified from 1997 to 2003.2 according to some studies , the increase in the incidence of thyroid cancer can be explained by a higher frequency of early tumor detection due to the use of more sophisticated diagnostic techniques.3,4 thyroid carcinomas that are derived from follicular epithelium can be classified into well - differentiated carcinomas ( including papillary and follicular carcinomas ) , poorly differentiated carcinomas and undifferentiated ( or anaplastic ) carcinomas , based on well - established clinical findings and histological criteria.5 however , despite standardized criteria and nomenclature , variations exist in the histological classification of thyroid tumors among different observers . this disagreement is greater for encapsulated follicular thyroid tumors ( adenoma , follicular carcinoma and some cases of the follicular variant of papillary carcinoma ) , in which the histological diagnosis is prone to subjective and discordant interpretations among pathologists.6 - 8 histological findings may not be sufficient to establish a precise diagnosis and , consequently , to predict the clinical courses of these cases . objective criteria and the identification of markers that permit better characterization of thyroid tumors are therefore required.9 n - myc downstream - regulated gene 1 ( ndrg1 ) is a member of the ndrg gene family and encodes a 43-kd protein ( ndrg1 ) with 394 amino acids.10 ndrg1 is located on human chromosome 8q24 and has been recognized as a gene whose mutation is associated with a demyelinating neuropathy called charcot - marie - tooth disease , type 4d.11 ndrg1 is ubiquitously expressed in human tissues , and its messenger rna has been detected in a variety of tissues , such as the digestive and respiratory tracts , liver , pancreas , kidneys , reproductive organs , placenta , skeletal muscle , heart , and brain.10,12 immunohistochemical studies have shown that the ndrg1 protein is mainly expressed in the epithelial cells of different tissues , whereas no expression could be demonstrated in mesenchymal or endothelial cells.12 other members of the ndrg family ( ndrg2 , ndrg3 and ndrg4 ) are homologous to the ndrg1 gene . however , in contrast to ndrg1 , these genes most likely exert tissue - specific functions , as they are only expressed in certain types of tissues.13 ndrg1 protein expression is known to be induced by a variety of physiological and pathological stimuli . expression of this protein is associated with cell growth arrest and terminal cell differentiation , as observed in squamous epithelial cells of the more superficial layers of the epidermis.12 during embryogenesis , ndrg1 expression is repressed by n - myc and c - myc during cell proliferation phases.14 conversely , ligands such as vitamin d and retinoic acid , which bind to transcription factors involved in cell differentiation , inhibit growth and induce cell differentiation and ndrg1 expression.15 other factors , such as an increase in intracellular calcium concentration , a reduction in glucose concentration , hypoxia , dna damage and neoplasms , are also associated with ndrg1 expression.16 heavy metals ( such as nickel ) induce cellular hypoxia and the expression of various genes that are responsive to hypoxia , including ndrg1.17,18 ndrg1 has also been characterized as a mediator of p53-dependent , anti - oncogenic functions . demonstrated that the p53-induced ndrg1 expression reduces cell proliferation in metastatic pulmonary cancer cells.19 however , the role of ndrg1 in tumor progression and the formation of metastases is controversial . some studies have suggested that ndrg1 overexpression reduces the metastatic potential of tumor cells,20,21 whereas others have associated its increased expression with less differentiated or more metastatic aggressive tumors and a poor prognosis.22,23 in the present study , we analyzed the quantitative immunohistochemical expression of the ndrg1 protein in normal thyroid glands and benign and malignant thyroid lesions . we also investigated the correlation between ndrg1 protein expression and clinical - pathological variables in cases of primary thyroid carcinoma . to our knowledge , this is the first study to analyze ndrg1 protein expression in benign and malignant thyroid lesions . paraffin blocks from 225 patients , including 62 cases of nodular goiter ( ng ) , 53 cases of follicular adenoma ( fa ) , 41 cases of classical papillary thyroid carcinoma ( ptc ) , 31 cases of the follicular variant of papillary thyroid carcinoma ( fv - ptc ) , and 36 cases of follicular carcinoma ( fc ) were selected from the archives of the department of pathology , university of so paulo medical school ( comprising the period from 2000 to 2006 ) and the department of pathology , a. c. camargo hospital ( comprising the period from 1984 to 2001 ) . histological diagnoses were made according to the classification of thyroid tumors proposed by the who.5 when available , paraffin blocks of lymph node metastases from thyroid carcinomas ( m - tc ) were also selected and included 17 cases of metastatic ptc , 5 cases of metastatic fv - ptc , and 1 case of metastatic fc . the patient age ranged from 15 to 88 years ( mean : 48.4 years old ) , and 184 ( 81.8% ) patients were female . data regarding the tnm stage24 and age , metastasis , and extent and size ( ames ) death risk criteria25 were obtained from the clinical records of patients with thyroid carcinoma ( ptc , fv - ptc and fc ) . the median time of clinical follow - up and the interval for recurrence for patients with thyroid carcinoma was 53.5 months ( range : 1 to 175 months ) and 18.0 months ( range : 2 to 48 months ) , respectively . no clinical follow - up data were available for eight patients ( six with fc , one with ptc and one with fv - ptc ) . during this period , 16 cases of recurrence ( 4 followed by death ) and 4 cases of death due to disseminated metastatic disease were observed . all deaths occurred in the group of patients with fc , and four patients were alive but still had diseases ( two with ptc and two with fc ) . this study was approved by the ethics committee for the analysis of research projects of the university of so paulo medical school and the research ethics committee of a. c. camargo hospital . slides were prepared for the tissue microarray ( tma ) from the selected blocks , stained with hematoxylin - eosin and examined under a binocular light microscope ( nikon , eclipse e100 ) for the selection of representative areas of the lesion . the areas of interest in the slides were stained with indian ink and compared to the corresponding areas in the paraffin blocks , which were also stained with indian ink . using a tissue microarrayer ( beecher instruments , silver springs , md , usa ) , the areas of interest in each block were punctured with a 1-mm diameter needle , and cylindrical fragments were transferred in an ordered fashion to a recipient paraffin block ( tma block ) , as described previously.26 for the detailed identification of each cylindrical fragment , a map was constructed in an excel spreadsheet to permit the exact localization of each case . the tma block contained 265 thyroid cases ( one core per case ) , corresponding to fragments of normal thyroid tissue ( nt , n = 18 ) , ng ( n = 62 ) , fa ( n = 53 ) , ptc ( n = 41 ) , fv - ptc ( n = 31 ) , fc ( n = 36 ) , and m - tc ( n = 24 , including 17 fragments of ptc metastases , 5 fv - ptc metastases , and 2 fc metastases ) . a total of 120 histological 5-m - thick sections were cut from each tma block . the slides were covered with a layer of paraffin to prevent oxidation and stored in a freezer at 20c . slides were left overnight in an oven at 56c , followed by deparaffinization in xylene , graded alcohol , tap water and distilled water . heat - induced antigen retrieval was performed using a domestic pressure cooker ( nigro , model eterna 41/2 l , brazil ) with a boiled 0.01 m sodium citrate buffered solution ( ph 6.0 ) for 4 min and cooled under running water , as described previously.27 endogenous peroxidase activity was quenched with 3% hydrogen peroxide for 20 min . the antibody used was purchased from santa cruz biotechnology ( ndrg1 n-19 , catalog sc-19464 , santa cruz , ca , usa ) . the optimal dilution was defined using a well - known positive sample that was tested before it was used on tma sections . the antibody was diluted 11000 in 0.01 m phosphate - buffered saline ( pbs ) , ph 7.4 , with 0.1% sodium azide ( sigma , catalog s8032 , st . louis , mo , usa ) and 1% bovine serum albumin ( sigma , catalog a9647 , usa ) to reduce background staining and incubated overnight at 4c in a moist chamber . the staining procedure was performed using the labeled streptavidin - biotin method ( lsab+ system - hrp , dakocytomation , catalog k0690 , carpinteria , ca , usa).28 slides were incubated for 30 min at 37c with the link , washed with pbs and incubated for another 30 min at 37c with streptavidin . the slides were developed with 60 mg 3,3-diaminobenzidine tetrahydrochloride ( sigma , catalog d5637 , st louis , mo , usa ) , 1% dimethyl sulfoxide ( sigma , catalog d5879 , st . louis , mo , usa ) and 0.06% hydrogen peroxide in pbs for 5 min and counterstained with harris 's hematoxylin , dehydrated and mounted with entellan neu ( merck , catalog 1.07961 , damstadt , germany ) . cytoplasmic ndrg1 protein expression was analyzed quantitatively using a computer image capture system ( automated cellular imaging system - acis iii , k0690 ; dako ) . next , parameters were established regarding the staining intensity of ndrg1-immunostained thyroid follicular cells and unstained stromal ( fibroblasts and endothelial cells ) cells ( blue area ) . between two and five circular areas per core first , we calculated the integrated optical density ( iod ) , which is related to the amount ( density ) of the antigen.29 a numerical value corresponding to the iod for each circular area was obtained by multiplying the staining intensity by the area of positive staining ( brown area ) . then , the iod was normalized to the tissue area : the numerical iod value was divided by the total circular area ( sum of the positively stained brown area and unstained blue area).30 for each core , the final numerical value corresponded to the mean value of the corrected iods of the two to five circular areas analyzed . cores presenting more than 50% tissue loss were excluded from the analysis . finally , the mean of the final numerical values obtained for the cores present in each of the two slides was calculated for each case . box plots were constructed for the different thyroid lesions using the results of the quantitative analysis of ndrg1 immunohistochemical expression . these groups were compared using the kruskal - wallis and mann - whitney tests . for cases with a thyroid carcinoma diagnosis ( ptc , fv - ptc or fc ) , the association between the quantitative immunohistochemical expression of ndrg1 and the clinical - pathological variables ( age , tumor size , tnm stage and ames risk classification ) was determined using a student 's t - test . paraffin blocks from 225 patients , including 62 cases of nodular goiter ( ng ) , 53 cases of follicular adenoma ( fa ) , 41 cases of classical papillary thyroid carcinoma ( ptc ) , 31 cases of the follicular variant of papillary thyroid carcinoma ( fv - ptc ) , and 36 cases of follicular carcinoma ( fc ) were selected from the archives of the department of pathology , university of so paulo medical school ( comprising the period from 2000 to 2006 ) and the department of pathology , a. c. camargo hospital ( comprising the period from 1984 to 2001 ) . histological diagnoses were made according to the classification of thyroid tumors proposed by the who.5 when available , paraffin blocks of lymph node metastases from thyroid carcinomas ( m - tc ) were also selected and included 17 cases of metastatic ptc , 5 cases of metastatic fv - ptc , and 1 case of metastatic fc . the patient age ranged from 15 to 88 years ( mean : 48.4 years old ) , and 184 ( 81.8% ) patients were female . data regarding the tnm stage24 and age , metastasis , and extent and size ( ames ) death risk criteria25 were obtained from the clinical records of patients with thyroid carcinoma ( ptc , fv - ptc and fc ) . the median time of clinical follow - up and the interval for recurrence for patients with thyroid carcinoma was 53.5 months ( range : 1 to 175 months ) and 18.0 months ( range : 2 to 48 months ) , respectively . no clinical follow - up data were available for eight patients ( six with fc , one with ptc and one with fv - ptc ) . during this period , 16 cases of recurrence ( 4 followed by death ) and 4 cases of death due to disseminated metastatic disease were observed . all deaths occurred in the group of patients with fc , and four patients were alive but still had diseases ( two with ptc and two with fc ) . this study was approved by the ethics committee for the analysis of research projects of the university of so paulo medical school and the research ethics committee of a. c. camargo hospital . slides were prepared for the tissue microarray ( tma ) from the selected blocks , stained with hematoxylin - eosin and examined under a binocular light microscope ( nikon , eclipse e100 ) for the selection of representative areas of the lesion . the areas of interest in the slides were stained with indian ink and compared to the corresponding areas in the paraffin blocks , which were also stained with indian ink . using a tissue microarrayer ( beecher instruments , silver springs , md , usa ) , the areas of interest in each block were punctured with a 1-mm diameter needle , and cylindrical fragments were transferred in an ordered fashion to a recipient paraffin block ( tma block ) , as described previously.26 for the detailed identification of each cylindrical fragment , a map was constructed in an excel spreadsheet to permit the exact localization of each case . the tma block contained 265 thyroid cases ( one core per case ) , corresponding to fragments of normal thyroid tissue ( nt , n = 18 ) , ng ( n = 62 ) , fa ( n = 53 ) , ptc ( n = 41 ) , fv - ptc ( n = 31 ) , fc ( n = 36 ) , and m - tc ( n = 24 , including 17 fragments of ptc metastases , 5 fv - ptc metastases , and 2 fc metastases ) . a total of 120 histological 5-m - thick sections were cut from each tma block . the slides were covered with a layer of paraffin to prevent oxidation and stored in a freezer at 20c . slides were left overnight in an oven at 56c , followed by deparaffinization in xylene , graded alcohol , tap water and distilled water . heat - induced antigen retrieval was performed using a domestic pressure cooker ( nigro , model eterna 41/2 l , brazil ) with a boiled 0.01 m sodium citrate buffered solution ( ph 6.0 ) for 4 min and cooled under running water , as described previously.27 endogenous peroxidase activity was quenched with 3% hydrogen peroxide for 20 min . the antibody used was purchased from santa cruz biotechnology ( ndrg1 n-19 , catalog sc-19464 , santa cruz , ca , usa ) . the optimal dilution was defined using a well - known positive sample that was tested before it was used on tma sections . the antibody was diluted 11000 in 0.01 m phosphate - buffered saline ( pbs ) , ph 7.4 , with 0.1% sodium azide ( sigma , catalog s8032 , st . louis , mo , usa ) and 1% bovine serum albumin ( sigma , catalog a9647 , usa ) to reduce background staining and incubated overnight at 4c in a moist chamber . the staining procedure was performed using the labeled streptavidin - biotin method ( lsab+ system - hrp , dakocytomation , catalog k0690 , carpinteria , ca , usa).28 slides were incubated for 30 min at 37c with the link , washed with pbs and incubated for another 30 min at 37c with streptavidin . the slides were developed with 60 mg 3,3-diaminobenzidine tetrahydrochloride ( sigma , catalog d5637 , st louis , mo , usa ) , 1% dimethyl sulfoxide ( sigma , catalog d5879 , st . louis , mo , usa ) and 0.06% hydrogen peroxide in pbs for 5 min and counterstained with harris 's hematoxylin , dehydrated and mounted with entellan neu ( merck , catalog 1.07961 , damstadt , germany ) . cytoplasmic ndrg1 protein expression was analyzed quantitatively using a computer image capture system ( automated cellular imaging system - acis iii , k0690 ; dako ) . next , parameters were established regarding the staining intensity of ndrg1-immunostained thyroid follicular cells and unstained stromal ( fibroblasts and endothelial cells ) cells ( blue area ) . between two and five circular areas per core first , we calculated the integrated optical density ( iod ) , which is related to the amount ( density ) of the antigen.29 a numerical value corresponding to the iod for each circular area was obtained by multiplying the staining intensity by the area of positive staining ( brown area ) . then , the iod was normalized to the tissue area : the numerical iod value was divided by the total circular area ( sum of the positively stained brown area and unstained blue area).30 for each core , the final numerical value corresponded to the mean value of the corrected iods of the two to five circular areas analyzed . cores presenting more than 50% tissue loss were excluded from the analysis . finally , the mean of the final numerical values obtained for the cores present in each of the two slides was calculated for each case . box plots were constructed for the different thyroid lesions using the results of the quantitative analysis of ndrg1 immunohistochemical expression . these groups were compared using the kruskal - wallis and mann - whitney tests . for cases with a thyroid carcinoma diagnosis ( ptc , fv - ptc or fc ) , the association between the quantitative immunohistochemical expression of ndrg1 and the clinical - pathological variables ( age , tumor size , tnm stage and ames risk classification ) was determined using a student 's t - test . all statistical analyses were performed using spss software , version 15.0 ( spss inc . , ndrg1 protein expression was observed in epithelial ( follicular ) cells , with no staining in stromal or endothelial cells . the positive cases showed moderate - to - strong cytoplasmic ndrg1 immunoreactivity ( figure 1 ) . for each case with a thyroid lesion and nt , the numerical values obtained by the quantitative analysis of the immunohistochemical expression of ndrg1 are reported as means and standard deviations ( table 1 ) . the quantitative expression of ndrg1 was higher in carcinomas compared to nts and ngs , with higher expression levels in ptc and m - tc ( p < 0.001 ) ( figure 2 ) . when analyzed together , the quantitative expression of ndrg1 was higher in the group of malignant lesions ( ptc , fv - ptc , fc , and m - tc ) compared to the group of benign thyroid lesions ( ng and af ) ( p = 0.043 ) ( figure 3 ) . the association between the quantitative immunohistochemical expression of ndrg1 and the clinical - pathological variables was analyzed in cases of primary thyroid carcinoma ( ptc , fv - ptc and fc ) . in this group of tumors , the quantitative expression of ndrg1 was significantly higher in patients who were aged 45 years or older ( p = 0.019 ) , at an advanced tnm stage ( stages iii and iv ) ( p = 0.007 ) , and in an ames high - risk group ( p = 0.012 ) ( table 2 ) . to our knowledge , this is the first study to analyze the immunohistochemical expression of the ndrg1 protein in a large number of benign ( ng and fa ) and malignant ( ptc , fv - ptc , fc , and m - tc ) thyroid lesions . cangul also studied the immunohistochemical expression of ndrg1 in a variety of human tumors ( including breast , kidney , lung and prostate carcinomas , and melanoma and glioblastoma multiforme ) and reported higher ndrg1 protein expression in tumors compared to normal tissue.18 in the colon , wang et al . observed increased ndrg1 expression in carcinomas compared to adenomas and normal colon mucosa.31 reis et al . analyzed 213,636 transcripts that were derived from normal and tumor tissues of the oral cavity , larynx , pharynx and thyroid using the open reading frame expressed sequence tags ( orestes ) technique . three ( zrf1 , rap140 and ndrg1 ) of the 250 potential markers selected in that study were analyzed by quantitative rt - pcr in oral cavity and laryngeal samples . the authors detected an increase in the levels of ndrg1 mrna in 50% of oral cavity tumors.32 in contrast , bandyopadhyay et al . observed lower ndrg1 immunohistochemical expression in breast carcinoma but strong expression in normal mammary lobules.33 the role of the ndrg1 protein in tumor progression and metastasis formation is still controversial and is likely to be tissue - specific . several studies have shown that a decrease in ndrg1 protein expression is associated with a more advanced tumor stage and lower survival rates . in prostate carcinomas , lower immunohistochemical expression of ndrg1 was associated with a gleason grade > 7 and poorly differentiated tumors . according to the authors , 70% of localized prostate tumors expressed ndrg1 , whereas only 25% of metastatic tumors were positive for this marker.21 in breast cancer , 60% of patients with bone metastases presented with reduced ndrg1 expression , with survival being lower in patients whose tumors did not express ndrg1.33 in esophageal squamous cell carcinoma , reduced ndrg1 expression was associated with more invasive tumors and a more advanced tnm stage . in addition , a lower survival rate was observed in patients with low ndrg1 expression compared to those with high expression.34 a less differentiated histological grade , more advanced pathological stage and lower overall survival were correlated with reduced immunohistochemical expression of ndrg1 in pancreatic ductal adenocarcinoma.35 we found that increased immunohistochemical expression of ndrg1 was correlated with a more advanced tnm stage ( stages iii and iv ) and an ames high - risk category in patients with thyroid carcinoma ( ptc , fv - ptc , and fc ) . an association between increased ndrg1 expression and more aggressive tumors and poor prognosis has been reported in other studies . chua et al . observed that increased ndrg1 expression in hepatocellular carcinoma was associated with a more advanced tumor stage ( stages iii and iv ) , larger tumors and poorly differentiated tumors , according to the edmondson - steiner histological classification . in their study , patients whose tumors presented increased ndrg1 protein expression showed lower overall survival compared to those with low ndrg1 levels.22 in cervical adenocarcinoma , increased immunohistochemical expression of ndrg1 was correlated with a larger tumor diameter , greater depth of stromal invasion , the presence of angiolymphatic invasion , a larger number of lymph node metastases , poorly or moderately differentiated tumors and poor prognosis , as demonstrated by lower progression - free and overall survival rates.23 some studies have suggested that ndrg1 is a metastasis suppressor gene . guan et al . observed lower ndrg1 expression in cell lines derived from colon cancer metastases compared to cell lines derived from primary colon cancer . inducing ndrg1 expression in metastatic cell lines , the authors observed that neoplastic cells expressed markers related to cell differentiation of the colon epithelium , such as cea and e - cadherin.20 in vivo studies have shown that cell lines derived from colon and prostate cancers that were transfected with ndrg1 and injected into mice produced a smaller number of hepatic and pulmonary metastases , respectively , than control lines.20,21 however , in human colorectal carcinoma samples , wang et al . demonstrated increased ndrg1 protein expression in primary tumors with metastases to the lymph nodes compared to those without metastases ( non - metastatic carcinoma ) . the authors concluded that higher ndrg1 expression was associated with a higher probability of lymph node metastasis . within this context , according to the authors , ndrg1 could be a gene that is involved in tumor progression and the promotion of metastases of colorectal carcinoma.31 the present study demonstrated an increase in the immunohistochemical expression of ndrg1 in primary and metastatic thyroid carcinomas compared to nt , ng , and fa . we also observed an association between ndrg1 expression and a more advanced tnm stage and an ames high - risk category in patients with thyroid carcinoma ( ptc , fv - ptc , and fc ) . more detailed studies are necessary to better define the role of ndrg1 in tumorigenesis and thyroid tumor progression , including the investigation of this protein in poorly differentiated or anaplastic thyroid carcinomas .

objectives : the aim of this study was to examine the expression of the n - myc downstream - regulated gene 1 protein in benign and malignant lesions of the thyroid gland by immunohistochemistry.introduction:n-myc downstream - regulated gene 1 encodes a protein whose expression is induced by various stimuli , including cell differentiation , exposure to heavy metals , hypoxia , and dna damage . increased n - myc downstream - regulated gene 1 expression has been detected in various types of tumors , but the role of n - myc downstream - regulated gene 1 expression in thyroid lesions remains to be determined.methods:a tissue microarray paraffin block containing 265 tissue fragments corresponding to normal thyroid , nodular goiter , follicular adenoma , papillary thyroid carcinoma ( classical pattern and follicular variant ) , follicular carcinoma , and metastases of papillary and follicular thyroid carcinomas were analyzed by immunohistochemistry using a polyclonal anti- n - myc downstream - regulated gene 1 antibody.results:the immunohistochemical expression of n - myc downstream - regulated gene 1 was higher in carcinomas compared to normal thyroid glands and nodular goiters , with higher expression in classical papillary thyroid carcinomas and metastases of thyroid carcinomas ( p < 0.001 ) . a combined analysis showed higher immunohistochemical expression of ndrg1 in malignant lesions ( classical pattern and follicular variant of papillary thyroid carcinomas , follicular carcinomas , and metastases of thyroid carcinomas ) compared to benign thyroid lesions ( goiter and follicular adenomas ) ( p = 0.043 ) . in thyroid carcinomas , n - myc downstream - regulated gene 1 expression was significantly correlated with a more advanced tnm stage ( p = 0.007 ) and age , metastasis , tumor extent , and size ( ames ) high - risk group ( p = 0.012).conclusions : thyroid carcinomas showed increased immunohistochemical n - myc downstream - regulated gene 1 expression compared to normal and benign thyroid lesions and is correlated with more advanced tumor stages .

INTRODUCTION MATERIALS AND METHODS Samples Construction of the tissue microarray Immunohistochemistry Quantitative immunohistochemical evaluation Statistical analysis RESULTS DISCUSSION CONCLUSIONS

PMC4718487

extra - articular hip arthroscopy has been recently used for the treatment of various conditions such as subspine impingement , gluteus medius / minimus tears , ischiofemoral impingement , sciatic entrapment and proximal hamstring repair . many of these procedures involve the peritrochanteric or subgluteal space . as potential indications for extra - articular hip arthroscopy expand , some of the major knowledge gaps include minimally invasive approaches for the treatment of hip dysplasia , acetabular retroversion with posterior insufficiency , severe femoral anteversion and retroversion , and osteitis pubis ( arguably the most common form of athletic pubalgia ) . in general , all of these procedures offer less invasive approaches to more established open surgeries ( i.e. open peri - acetabular osteotomy ( pao ) , open proximal femoral osteotomy ( pfo ) , open pubic symphysis curettage ) , thereby enabling potential outpatient or short - stay hospitalization , quicker rehabilitation , less blood loss and improved cosmesis . these are advanced endoscopic surgical procedures meriting familiarity with the surgical anatomy and significant experience with hip arthroscopy . the indications for these procedures are the same as for their open equivalent surgeries and are described in each corresponding section , as are the complications . the purpose of this instructional course lecture is to introduce endoscopy - assisted pao ( eapao ) , closed derotational pfo ( cpfo ) and endoscopic pubic symphysectomy ( eps ) as potential options for the less invasive treatment of these conditions . endoscopy - assisted peri - acetabular osteotomy eapao has significant potential to improve outcomes and safety in patients with dysplasia ( retroverting pao ) or acetabular retroversion with posterior insufficiency ( anteverting pao ) . pao is associated with a significant complication rate [ 6 , 7 ] and endoscopic visualization of the posterior column and ischial osteotomies may reduce the incidence of iatrogenic direct sciatic nerve injury ( including neurotmesis ) , intra - articular fracture or osteotomy , posterior column fracture or discontinuity and acetabular osteonecrosis . although an endoscopic triple osteotomy has been developed , we endeavor to enhance the bernese pao which preserves posterior column functional integrity , thereby facilitating early ambulation with minimal osteosynthesis of the reoriented acetabular fragment . development of this procedure is at the cadaveric stage and uses a mini - open [ 911 ] rather than standard ilioinguinal approach . concurrent arthroscopy ( in contrast to endoscopy ) can diagnose and treat a majority of central compartment pathology ( e.g. chondral flaps , labral tears ) in dysplasia [ 12 , 13 ] and may prevent unwarranted pao in cases of worse than anticipated chondral injury or osteoarthosis via staged or immediate total hip arthroplasty . peripheral compartment arthroscopy permits assessment of dynamic interaction between the reoriented acetabular rim and the proximal femur , often after concurrent arthroscopic femoroplasty , as many patients with dysplasia ( and retroversion ) have associated cam femoroacetabular impingement ( fai ) . this may improve the accuracy of 3d intra - operative acetabular reorientation ( minimizing under- or over - correction ) and facilitate confirmation of sufficient stabilization ( typically with percutaneous screw fixation ) . perhaps most significant , patients with developmental dysplasia of the hip ( ddh ) or acetabular retroversion with posterior insufficiency that desire hip arthroscopy as a minimally invasive surgery may now have a more biomechanically appropriate yet less invasive option ( eapao ) , that may reduce the number of failed hip arthroscopies [ 15 , 16 ] . furthermore , we envision eapao as a logical progression toward fully endoscopic pao ( epao ) . supine hip arthroscopy under general anesthesia is performed as an initial diagnostic and therapeutic step , followed by mini - open eapao ( fig . 1 ) and concluding with arthroscopic dynamic testing . in the supine position , any intra - articular pathology is either treated or a determination may be made that the severity and/or extent of chondral damage exceeds that that can reasonably expected to benefit from acetabular reorientation , perhaps opting for hip arthroplasty . note the completed iliac osteotomy and a portion of the arthroscope ( lower right ) which provides endoscopic guidance for the posterior column osteotomy . note the completed iliac osteotomy and a portion of the arthroscope ( lower right ) which provides endoscopic guidance for the posterior column osteotomy . a mini - open modified heuter approach permits muscle - sparing dissection of the interval between sartorius and tensor fascia lata ( tfl ) . avoiding the lateral femoral cutaneous nerve , the fascia lata is incised in line with the skin incision followed by blunt dissection around the medial aspect of the tfl within its incised aponeurotic sheath . medial retraction of the sartorius and deeper rectus femoris reveals the reflected head of the rectus femoris as it overlays the hip capsule . ischial osteotomy is performed with a straight osteotome positioned in the infracotyloid fossa . during this osteotomy , the sharp tip of the osteotome is endoscopically visualized with a 70 standard length arthroscope from the anterolateral portal ( fig . endoscopy of the posterior peritrochanteric region ( subgluteal space ) without any hip distraction enables visualization , neurolysis and mobilization of the sciatic nerve , which may be followed proximally and distally with blunt dissection via a switching stick from the posterolateral portal . if more proximal neurolysis or mobilization is required , endoscopic ligation and transection of the crossing vessels from the inferior gluteal artery may be performed . monopolar rf with intermittent activation times of < 10 s in a setting of sufficient fluid flow permits safe soft tissue dissection . if endoscopy reveals the osteotome tip approaching the sciatic nerve , the ostetome may be redirected and/or the sciatic nerve may be gently retracted . fig . 2.supine endoscopic view from anterolateral portal of the right sub - gluteal space of cadaveric specimen during ischial osteotomy during eapao . note the sharp tip of the osteotome in proximity to the gently retracted sciatic nerve . supine endoscopic view from anterolateral portal of the right sub - gluteal space of cadaveric specimen during ischial osteotomy during eapao . note the sharp tip of the osteotome in proximity to the gently retracted sciatic nerve . the pubic and iliac osteotomies are then performed , followed by the posterior column osteotomy made with endoscopic assistance . without changing portals , arthroscopic inflow the visualized sciatic nerve may again be gently retracted to avoid inadvertent injury ( fig . 3 ) . sometimes osteoclasis of a small bony bridge is performed between adjacent ends of the ischial and posterior column osteotomies permitting mobilization of the acetabular fragment . the pubic osteotomy is made close to the acetabulum to avoid bony obstruction to desired medial acetabular translation ( shown fluoroscopically as a medial shift of the teardrop ) . during the pubic or posterior column cuts , arthroscopic visualization of the central compartment under moderate hip traction permits detection / prevention of this complication . 3.supine endoscopic view from anterolateral portal during posterior column osteotomy demonstrating the sharp tip of the osteotome in proximity to the sciatic nerve . sciatic nerve retraction is being performed with a switching stick via the posterolateral portal . supine endoscopic view from anterolateral portal during posterior column osteotomy demonstrating the sharp tip of the osteotome in proximity to the sciatic nerve . desired acetabular reorientation is confirmed via fluoroscopy and/or intra - operative ap pelvic radiograph followed by percutaneous screw fixation . care is taken to avoid inadvertent retroversion from over - correction , under - correction or insufficient medialization of the acetabular fragment . repositioning of the acetabular fragment may be performed if indicated or small regions of anterior pincer fai may be seamlessly treated with rim trimming . we have no outcomes on this evolving procedure as it has only been performed on cadaveric specimens to date . proximal femoral osteotomy has been useful in the treatment of axial ( derotation ) and longitudinal deformities ( varus / valgus , flexion / extension ) . closed osteotomy using an intramedullary saw permits derotation osteotomies for severe proximal femoral retroversion ( which may cause cam fai that persists despite femoroplasty ) and severe anteversion ( which may cause anterior hip instability or posterior fai . ) . internal fixation via intramedullary locked nailing provides a load - sharing device for early weight - bearing . moreover , recent work suggests that there is potential for some degree of angulatory correction . adjunctive hip arthroscopy aids pre- and post - osteotomy assessment of altered hip dynamics while permitting detection / treatment of intra - articular pathology . hip arthroscopy under general anesthesia is performed via an anterolateral viewing portal with a 70 arthroscope and a modified mid - anterior working portal . under hip distraction , diagnostic and therapeutic hip arthroscopy is performed , followed by arthroscopic dynamic testing to assess the amount of secondary cam fai from pathologic femoral retroversion ( fig . 4.supine arthroscopic image of left hip immediately prior to cpfo confirming ongoing cam impingement on arthroscopic anterior impingement testing despite significant previous femoroplasty . supine arthroscopic image of left hip immediately prior to cpfo confirming ongoing cam impingement on arthroscopic anterior impingement testing despite significant previous femoroplasty . a fluoroscopic c - arm device is positioned between the legs so as to enable anteroposterior and lateral projections of the entire operative femur . parallel lateral - based steinmann pins are placed on each side of the proposed osteotomy . the proximal pin is placed through the anterolateral portal into the anterior aspect of the greater trochanter ( to avoid intramedullary nail obstruction ) and the distal pin in the transcondylar region . the anteroposterior location of the latter is not critical because the rod does not extend to this level . a 3-cm vertical incision is made proximal to the greater trochanter with subsequent dissection to its apex . apical trochanteric pin placement and proximal femoral entry are established under bi - plane fluoroscopic guidance . an intramedullary saw ( winquist saw ; biomet , warsaw , in ) is selected to match the anticipated maximal external diameter of cortical bone at a level 56 cm distal to the lesser trochanter . with the saw blade retracted behind the protective cam - shaped tip , antegrade intramedullary insertion is achieved . once confirmed in the desired intramedullary position , the saw blade is progressively protracted by clockwise rotation of a proximal - based external dial and axial saw rotation performed in incremental fashion until the closed transverse osteotomy is completed ( fig . clean transverse osteotomy without significant cortical spikes that might impede desired derotation or bony apposition . the saw blade is then fully retracted behind the protective cam by continuing to dial in the same clockwise direction ( until the dial reads 5.fluoroscopic images of intramedullary saw ( red arrow ) before ( left ) and after ( right ) saw blade deployment and completion of transverse subtrochaneric osteotomy . fluoroscopic images of intramedullary saw ( red arrow ) before ( left ) and after ( right ) saw blade deployment and completion of transverse subtrochaneric osteotomy . a reamed intramedullary rod is then partially inserted across the osteotomy site and controlled internal rotation of the distal segment is performed . ( in the case of excessive femoral anteversion , external derotation is performed . ) to assess sufficient derotation , divergence of the parallel - placed pins is viewed from a distal - based axial perspective . an angular guide ( blade plate guide ; synthes ) is used to measure the relative angular degree of rotation ( fig . once desired derotation is achieved , the intramedullary rod is fully inserted and percutaneous proximal screw placement is performed under fluoroscopic guidance . distal interlocked screw fixation is performed once desired axial alignment and bony apposition are confirmed . 6.photograph from axial perspective during derotational correction of severe retroversion deformity over proximally fixated femoral rod . photograph ( left ) during derotation with 30 internal rotation of distal segment using an ao angle guide referencing off of initial parallel guide pins ( right ) . photograph from axial perspective during derotational correction of severe retroversion deformity over proximally fixated femoral rod . photograph ( left ) during derotation with 30 internal rotation of distal segment using an ao angle guide referencing off of initial parallel guide pins ( right ) . repeat hip arthroscopy is performed to confirm impingement - free internal rotation to 30 with flexion adduction internal rotation testing . once satisfied with the rotational correction of the femoral deformity , foot alignment in both hip and knee extension , as well as hip and knee flexion are checked to ensure the absence of any significant compensatory tibial rotational deformity . severe bilateral retrotorsion in a young man caused ongoing symptomatic cam fai despite previous arthroscopic surgeries with substantial femoroplasties . he underwent staged proximal femoral derotational osteotomies using the aforementioned technique , was discharged home weight - bearing as tolerated on crutches after overnight hospitalization and demonstrated radiographic union at 3 months with improved gait ( pre - operative out - toeing , post - operative normal foot progression ) and symptoms at 12 and 15 months ( fig . 7 ) . 7.post-operative radiographs following cpfo of right femur at 15 months and left femur at 12 months . post - operative radiographs following cpfo of right femur at 15 months and left femur at 12 months . athletic osteitis pubis ( op ) is one of the more common causes of athletic pubalgia that has an often successful but prolonged conservative treatment course and 510% failure rate . of several surgical options including wedge resection , arthrodesis , extraperitoneal retropubic synthetic mesh placement and pubic symphyseal curettage , open curettage has been shown to be effective in athletes and is arguably less invasive than some of the other surgeries [ 21 , 22 ] . a mini - open curettage has recently been introduced , but is done via a 57 cm pfannenstiel incision . indeed , the constrained range of motion in the hip with fai is thought to cause increased transfer stress to the pubic symphysis . although treatment of co - afflicted patients may be done with either fai or op surgery in patients that fail conservative measures , surgical treatment of both conditions offers the best outcomes . eps is an attractive alternative to open or mini - open pubic symphyseal curettage that nicely complements athletes that undergo concurrent arthroscopic surgery for unilateral or bilateral fai . moreover , more patients with athletic op may opt for this less invasive outpatient procedure rather than suffer with a typically prolonged conservative treatment course . following arthroscopic or mini - open surgery for fai ( e.g. acetabuloplasty , labral refixation and femoroplasty ) and after redraping and sterile preparation of the pubic region , outpatient dual - portal endoscopic surgery is performed in the supine lithotomy position under hypotensive general anesthesia . an indwelling urethral catheter is used not only because of the longer cumulative operative time needed for all procedures but also for bladder decompression to minimize risk of iatrogenic damage . 8) : one 2 cm proximal to the palpable superior border of the pubic symphysis ( suprapubic portal ) and one directly anterior to the mid - level of the pubic symphysis ( anterior portal ) . the anterior and superior aspects of the pubic symphysis are endoscopically visualized with a 30 arthroscope after initial removal of overlying bursal tissue . after demarcating the area of planned resection on the anterior surface of the pubic symphysis with an rf probe and meticulous hemostasis enabling low arthroscopic pump pressures at or below 40 mm hg , pubic symphysectomy is performed with a 4 mm round burr ( fig . if present , a posterosuperior bone spur is resected . then , burr resection proceeds from anterior ( superficial ) to posterior ( deep ) under endoscopic visualization with intermittent fluoroscopic guidance . removal of the burr sheath aids access to the deeper ( posterior ) pubic symphysis . a retractable sheath burr ( retractable sheath hip burr , smith and nephew , andover , ma ) is also an option and may aid visualization by preserving controlled fluid outflow via a retracted but retained sheath . endoscopic resection of the anterior capsule , pubic symphyseal fibrocartilage and subchondral end - plates is performed while preserving the posterior and thick arcuate ( inferior ) ligaments . final posteroinferior resection is done with the burr in the suprapubic portal , optimizing burr access to this region ( fig . associated adductor longus tendinopathy or tears and even a torn rectus abdominus attachment may be treated via this approach . an unhooded or retractable sheath burr may facilitate resection of the deeper ( posterior ) fibrocartilage and hyaline endplates without violating the posterior or inferior capsuloligamentous structures . 10.the suprapubic portal enables burr access to the posteroinferior pubic symphysis to complete the procedure . an unhooded or retractable sheath burr may facilitate resection of the deeper ( posterior ) fibrocartilage and hyaline endplates without violating the posterior or inferior capsuloligamentous structures . the suprapubic portal enables burr access to the posteroinferior pubic symphysis to complete the procedure . post - operative rehabilitation includes initial weight - bearing as tolerated with two crutches ( 12 weeks ) and early exercise cycling with minimal resistance . in contrast to our standard post - operative fai surgery protocol ( i.e. cycling on post - operative day 1 ) , patients undergoing endoscopic pubic symphysectomy typically are able to begin this within the first week . gradual advancement to running is permitted at approximately 3 post - operative months and return to sport at 5 months , realizing that the typically concurrent unilateral or bilateral fai surgery may exert rate - limiting influence . in a multicenter case series , we report encouraging early outcomes in seven patients with symptomatic fai and op that underwent concurrent fai surgery and eps . although one patient underwent pubic symphysis arthrodesis for unresolved pain without radiographic instability , overall clinical improvement was demonstrated via visual analogue scale for pain and non - arthritic hip score . endoscopy - assisted peri - acetabular osteotomy has potential to improve safety and outcomes for patients with dysplasia or acetabular retroversion with posterior insufficiency . closed derotational femoral osteotomy with adjuctive hip arthroscopy may offer a less invasive alternative to the treatment of severe femoral anteversion and retroversion .

beyond the recent expansion of extra - articular hip arthroscopy into the peri - trochanteric and subgluteal space , this instructional course lecture introduces three innovative procedures : endoscopy - assisted periacetabular osteotomy , closed derotational proximal femoral osteotomy and endoscopic pubic symphysectomy . supportive rationale , evolving indications , key surgical techniques and emerging outcomes are presented for these innovative less invasive procedures .

INTRODUCTION SURGICAL PROCEDURE CLOSED PROXIMAL FEMORAL OSTEOTOMY SURGICAL TECHNIQUE ENDOSCOPIC PUBIC SYMPHYSECTOMY Surgical Technique CONCLUSIONS CONFLICT OF INTEREST STATEMENT

PMC1914253

the physical stimuli that represent the model input variables are : physical velocity of monitor in space m ; velocity of the image ( grating ) on the monitor r ; and eye velocity in space e. the psychophysical constants of the model are : the weber fractions for the difference between retinal and reference signals w , and for the difference between two retinal velocity signals w ; and a stimulus - dependent gain factor g for the visual perception of velocities . let \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \theta { \left ( { x , t } \right ) } $ $ \end{document } be a function defined by : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \theta { \left ( { x , t } \right ) } = 0{\text { if } } { \left| x \right| } < t\quad { \text{and}}\quad \theta { \left ( { x , t } \right ) } = x - t $ $ \end{document } otherwise . the perceived velocity of the monitor in space is related to the difference between the retinal velocity of the monitor vmon / ret = e m , and the reference signal vref which is equal to e for a still observer and to e + vhead / space for a moving observer : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \hat{v}_{{{\text{mon / space } } } } = \theta { \left ( { v_{{{\text{ref } } } } - v_{{{\text{mon / ret } } } } { \text { , jnd}}_{1 } } \right ) } , $ $ \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \text{jnd}}_{1 } = - { \text{sign}}(v_{{{\text{mon / ret } } } } ) \,w{\kern 1pt } { \sqrt { v_{{{\text{ref } } } } ^{2 } + v_{{{\text{mon / ret } } } } ^{2 } } } . $ $ \end{document}the perceived velocity of the grating in space is related to the difference between the retinal velocity of the grating vgrat / ret e ( m + r ) , and the reference signal vref : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \hat{v}_{{{\text{grat / space } } } } = \theta { \left ( { v_{{{\text{ref } } } } - v_{{{\text{grat / ret } } } } { \text { , jnd}}_{2 } } \right ) } , $ $ \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \text{jnd}}_{2 } = - { \text{sign}}(v_{{{\text{grat / ret } } } } ) \,w{\kern 1pt } { \sqrt { v_{{{\text{ref } } } } ^{2 } + v_{{{\text{grat / ret } } } } ^{{\text{2 } } } } } . $ $ \end{document}the perceived velocity of the grating relative to the monitor is related to the difference between the two perceived velocities in space , using a jnd based on the difference between the two retinal signals involved . these are assumed to be : the retinal velocity of the monitor vmon / ret = e m ; and the velocity difference between the image of the monitor and the grating within it vdelta = (m r ) . thus : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \hat{v}_{{{\text{grat / mon } } } } = \theta { \left ( { \hat{v}_{{{\text{grat / space } } } } - \hat{v}_{{{\text{mon / space } } } } { \text { , jnd}}_{3 } } \right ) } , $ $ \end{document}where \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \text{jnd}}_{3 } = - { \text{sign}}(\hat{v}_{{{\text{mon / space } } } } { \text{)}}\,w_{\delta } \,{\sqrt { v_{{{\text{mon / ret } } } } ^{2 } + v_{{{\text{delta } } } } ^{2 } } } . $ $ \end{document}this value is then to be factored by a stimulus - dependent gain g to model the experimentally measured perceived velocity of the grating on the monitor . note that the model is deterministic and treats jnd s as signed values , the sign of which is defined as opposite to that of the perceived velocity of the monitor or grating in space . however , since we think of a jnd as intrinsic noise , it should be an interesting challenge to translate the model in more probabilistic terms .

when a slowly moving pattern is presented on a monitor which itself is moved , the pattern appears to freeze on the screen ( mesland and wertheim in vis res 36(20):33253328 , 1996 ) even if we move our head with the monitor , as with a head mounted display ( pavard and berthoz in perception 6:529540 , 1977 ) . we present a simple model of these phenomena , which states that the perceived relative velocity between two stimuli ( the pattern and the moving monitor ) is proportional to the difference between the perceived velocities of these stimuli in space , minus a noise factor . the latter reflects the intrinsic noise in the neural signals that encode retinal image velocities . with noise levels derived from the literature the model fits empirical data well and also predicts strong distortions of visually perceived motion during vestibular stimulation , thus explaining both illusions as resulting from the same mechanism .

Mathematical formulation of the model

PMC1751541

cells are complex systems whose physiology is governed by an intricate network of molecular interactions ( mis ) of which a relevant subset are protein protein interactions ( ppis ) . signal transduction pathways and transcriptional regulation are typical examples of such biological processes mediated by ppi . the mi database ( mint , ) was designed to collect experimentally verified ppis in a binary or complex representation . over the past four years , mint has undergone a profound reorganization of both the data model and the database structure , and has dramatically increased the number of stored interactions . intact is an open source database designed for the storage , presentation and analysis of mis ( 1 ) ( schema available at ) . the main advantages of adopting the intact model lie in its ability to represent protein complexes and other types of molecules as interaction participants , and in the ease with which new features and toolkits for data storage , representation and analysis can be added . in addition mint , from now on , will be compatible with all the upgrades and tools developed by the intact consortium . mint is based on the open source postgresql database management system ( ) . all the data can be accessed as java objects through the intact api by using ojb ( ) as the object - relational mapping tool . the web application is based on the struts framework ( ) running on the tomcat servlet container ( ) and the apache server ( ) . since mint was first reported ( 2 ) the number of curated entries has grown significantly . given the new database structure , binary and n - ary interactions can now be represented . the number of binary interactions has increased > 20-fold ( figure 1 ) . as of september 2006 , more then 95 000 physical interactions involving 27 461 proteins from 325 organisms are stored in mint ( figure 2 ) . although , 90% of the interactions stored in the database are the result of large scale , genome wide experiments , the value of mint resides in the high number of curated articles , each of which reports a small number of interactions . this is reflected in the steady increase of curated articles that is mainly due to the curation of publications describing low - throughput experiments ( figure 1 ) . the mint curation team consists of two full - time and one part - time curators . this is not sufficient to capture all the interaction information steadily reported in research articles . thus , we have chosen to focus our efforts on consistently curating all the issues of febs letters ( since january 2005 ) and embo journal and embo reports ( since january 2006 ) . this choice was made in agreement with the other members of the international molecular - interaction exchange consortium ( imex ) , including dip ( 3 ) , intact ( 1 ) , mpact ( 4 ) and bind ( 5 ) . imex aims at avoiding work overlaps , at sharing the curation workload and at exchanging completed records on mi data . the graph on the left represents the growth in the number of interactions stored in mint . the pie charts represent the number of interactions stored in mint for the different species . since january 2006 , the syntax and the semantics for data representation have been provided by the proteomics standards initiative - molecular interaction ( psi - mi 2.5 ) standards . the psi workgroup develops and maintains a common data standard allowing users to retrieve all relevant data from different data providers and to perform comparative analysis ( 6 ) . each stored interaction represents , according to the psi - mi standards , a physical interaction , a direct interaction or a co - localization . all the database records created before january 2005 underwent a drastic quality control performed by the new mint curation staff composed of phd level curators . all the previous entries were re - curated according to the new psi - mi standard . entries that could not be updated according to psi - mi standards were deleted from the database in order to maintain a high quality dataset . the mint curation reference manual is being developed in collaboration with the other imex partners and is available at . the new data submission html forms benefit from an improved automatic check based on curation rules . this ensures that mandatory fields are filled and that annotated ranges or residues are consistent with the protein length reported by uniprot . in addition , for the purpose of ensuring high fidelity annotation , every new entry derived from low - throughput experiments undergoes a further validation step performed by a different curator before release to the public . the new web - based interface includes a number of improvements and enhancements allowing a more efficient database exploration . most notably , the query can be based on protein or gene names , uniprot keywords or identifiers of external databases : uniprotkb , pdb , ensembl , flybase , sgd , wormbase , omim , huge , pubmed and reactome . it is also possible to query species specific datasets ( mammalian , saccharomyces cerevisiae , caemorhabaditis elegans , drosophila melanogaster , viruses ) . finally , a sequence similarity search ( blast ) can also be performed to search for proteins which are homologous to the query protein . the query results are displayed in a table showing in the left frame a summary of the protein features reported in uniprot and , in the right frame , the list of the interaction partners curated in mint . the interactions can be displayed graphically by an enhanced version of the mint viewer , a java applet derived from the applet graph ( ) . the viewer represents the interactions by lines ( edges ) and nodes ( proteins ) , and assigns the nodes a size proportional to the protein 's molecular weight and a color which depends on the species . the graph displayed by the viewer can be expanded and edited interactively by moving or deleting nodes . proteins linked to omim are now highlighted in red . in order to attribute a reliability index to the reported interactions , we have also assigned each interaction a confidence level , based on the experimental detection method and experimental conditions . the results of the analysis performed in the mint viewer can be captured in different formats ready for export : psi1.0-xml , psi2.5-xml , flat - file , osprey . mint is now also complemented by homomint ( 7 ) , an inferred human protein interaction network where interactions discovered in model organisms ( and collected in mint ) are mapped onto the corresponding human orthologs . through the mint web pages a web service allows direct computational access so as to freely retrieve interaction networks in different formats : flat - file , psi1.0-xml , psi2.5-xml . it is also possible to download specific subsets of the database based on the taxonomy of the interactors .

the molecular interaction database ( mint , ) aims at storing , in a structured format , information about molecular interactions ( mis ) by extracting experimental details from work published in peer - reviewed journals . at present the mint team focuses the curation work on physical interactions between proteins . genetic or computationally inferred interactions are not included in the database . over the past four years mint has undergone extensive revision . the new version of mint is based on a completely remodeled database structure , which offers more efficient data exploration and analysis , and is characterized by entries with a richer annotation . over the past few years the number of curated physical interactions has soared to over 95 000 . the whole dataset can be freely accessed online in both interactive and batch modes through web - based interfaces and an ftp server . mint now includes , as an integrated addition , homomint , a database of interactions between human proteins inferred from experiments with ortholog proteins in model organisms ( ) .

INTRODUCTION DATABASE STRUCTURE DATA GROWTH DATABASE CURATION DATA ACCESS AND DISTRIBUTION

PMC5209258

over one third of u.s . children are overweight or obese putting them at higher risk for adverse health outcomes . food intake must balance with energy expenditure and growth demands in order for children to maintain a healthy body weight . complex neural regulatory feedback systems monitor available energy stores in the body in order to prompt feeding behaviors to match energy needs . while these homeostatic mechanisms play a critical role in maintaining energy balance , non - homeostatic ( hedonic ) pathways can also drive consumption of highly palatable foods . such foods are known to activate the dopaminergic mesolimbic pathway that is responsible for detecting rewarding stimuli and motivating behaviors to repeat exposure to those stimuli . this pathway is also involved in classical conditioning , i.e. a learning process where a reward - related stimulus can lead to anticipation and motivation for that reward . our current obesogenic environment is replete with food - related stimuli , or food cues , that may activate reward pathways and motivate overconsumption . the food industry spends $ 1.79 billion marketing primarily energy - dense , nutrient - poor foods to u.s . children under 11 years old , resulting in an average viewing of 15 tv ads per day or 5,500 over each year . given the high prevalence of exposure , it is important to understand whether tv food ads prompt excessive caloric consumption in children . randomized studies assessing whether tv food advertising affects consumption in children have had mixed results . some have shown significantly higher consumption when children view food ads compared to non - food ads . for example , harris et al . showed 118 children , ages 711 years , two minutes of food or non - food ads embedded in a 14-minute cartoon and provided crackers to consume while watching the show . children who viewed the food ads consumed an average of 28.5 g ( 133 kcals ) more than those shown the non - food ads , even though the crackers were not advertised during the session . others have not observed a main effect of food ad exposure on consumption ; however , several of these studies reported effects of food ad exposure in subsets of participants ( e.g. boys and children with maternal encouragement to be thin ) , or when looking at specific foods ( e.g. celebrity - endorsed foods ) . genetic factors likely interact with environmental drivers of eating behavior and could affect how individuals respond to environmental cues to eat . a common variant in the fat mass and obesity associated ( fto ) gene was the first genetic factor to be associated with common obesity in large genome - wide association studies . while the biological mechanism is yet unknown pediatric studies suggest that fto may decrease satiety responsiveness and lead to excess consumption . interestingly , one study ( n=24 ) examined fto rs9939609 in relation to brain response to food images in adult men . the authors reported that , for the participants in a fasted state , fto homozygous high - risk participants had a significantly greater response to food vs. nonfood images in brain reward regions compared to homozygous low - risk participants . this past research motivated our hypothesis that children with the fto rs9939609 high - risk allele would have heightened susceptibility to excess consumption after viewing food ads . in this study , we tested the effect of food ad exposure on cued eating among children enrolled in a randomized trial and further explored whether a common variant in fto modified that effect . we recruited 200 children through community fliers and a contact list from children s hospital at dartmouth between july 2013 and february 2015 ( figure 1 ) . inclusion criteria included age 9 or 10 years , english fluency , absence of food allergies / restrictions , and absence of health conditions / medication use that may impact appetite or attention span . caregivers and children provided written consent and assent , respectively , and dartmouth s committee for the protection of human subjects approved all study protocols . to limit the analysis to unrelated children , one sibling from each of 21 sibling pairs in addition , four children were excluded because they did not report satiety after lunch , and three were excluded because of protocol violations ( i.e. , health condition potentially affecting appetite , caregiver interaction with child during experiment ) . there were no significant differences between included and excluded children in terms of baseline covariates or consumption ( data not shown ) . children and one parent were schedule for a study appointment at 11:30 am or 12:30 pm . children were instructed to eat a normal breakfast , but not to eat for the two hours prior to the appointment . during the appointment , children were provided lunch with their choice of main dish ( macaroni and cheese , pizza bites , or chicken nuggets with ketchup ) , along with string cheese , carrots and dressing , apple slices , bread , butter , milk , and water . meals were balanced on macronutrients and contained 552704 kcals of carbohydrates , 315405 kcals of fat , and 152188 kcals of protein . foods were pre - and post - weighed , and nutrient labels and the usda national nutrient database for standard reference were used to calculate caloric consumption . after lunch , each child was asked to assess his / her satiety with a 5-point likert scale ranging from i am very hungry to i am very full . children who reported , i am a little hungry were excluded from the analysis . after lunch , all children viewed a 34-minute tv show ( figure it out ! , nickelodeon ) that included 7.7 minutes of either food or toy ads , along with 3.1 minutes of neutral ads . our outcome measure was caloric consumption after self - reported satiety , i.e. , eating in the absence of hunger ( eah ) , during the experimental exposure . we provided four snack foods during the experimental exposure : gummy candy ( 546 kcals ) , cookies ( 692 kcals ) , chocolate ( 1000 kcals ) , and cheese puffs ( 536 kcals ) . food was pre- and post - weighed , and product nutrition information was used to calculate caloric consumption . buccal cell swabs were collected before lunch and stored at room temperature with desiccant capsules ( isohelix , kent , u.k . ) . dna was isolated using ddk-50 isolation kits ( isohelix , kent , u.k . ) . genotyping for rs9939609 was conducted with real - time pcr and taqman chemistry using the 7500 fast real - time instrument ( primers and instrument from thermo fisher scientific ( waltham , usa ) ) . all samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates . we measured children s weight ( to the nearest 0.1 kg ) and height ( to the nearest 0.5 cm ) , using a digital scale and stadiometer ( model 597kl , seca , hamberg , germany ) . we calculated body mass index ( bmi ) percentile using u.s . center for disease control ( cdc ) 2000 age- and sex - specific distributions . < 95 percentile and obese was defined as 95 percentile . estimated daily energy requirement ( eer ) was calculated according to institute of medicine guidelines using child s sex , measured height and weight , and caregiver - reported daily average physical activity . caregivers answered , how much time does your child spend doing physical activity such as running around , climbing , biking , dancing , swimming , playing sports , etc . ? separately for school or weekend days . a single weighted average was created and categorized as low active for 30<60 , active for 60<120 , and very active for 120 min / day . caregivers reported their child s race and ethnicity , their highest level of education , their spouse s highest level of education , and their household income category . caregivers also reported their child s typical number of hours spent watching tv or movies on a weekend day and school day , and responses were used to create a single weighted average . parental eating restriction was calculated as an average of caregiver responses to the restriction subscale questions of the child feeding questionnaire , e.g . , answered on a scale of : 1=disagree , 2=slightly disagree , 3=neutral , 4=slightly agree , and 5=agree ) . we compared participant characteristics by study condition using unpaired , 2-tailed t - tests for continuous measures and x or fisher s exact tests for categorical measures , as appropriate . next , we examined unadjusted associations between participant characteristics and caloric consumption during the lunch and eah phases using linear regression ; consumption during the eah phase was computed for total foods and separately for foods that were and were not advertised during the experiment . we then estimated the effect of the experimental condition on eah for total foods , advertised food , and non - advertised foods separately using multivariable linear regression adjusted for eer and all covariates related to eah at the p < 0.10 threshold . we did not include sex and bmi percentile as covariates because they were used to calculate eer ; however , we conducted a sensitivity analysis to determine whether adding those variables to the final models influenced findings . to address whether the fto rs9939609 genotype modified the effect between food ad exposure and eah , we included a multiplicative interaction term between the exposure and genotype in the adjusted models and used a wald test to determine the significance of the interaction term . to assess the robustness of our findings , we repeated the final models after excluding participants who were above the 90 percentile for eah consumption ( > 840 kcals ) . we also performed analyses stratified by sex and weight status , because some previous studies found interactions between food ad exposure and these variables on consumption . we conducted all analyses using sas 9.4 ( sas institute , cary , usa ) . we recruited 200 children through community fliers and a contact list from children s hospital at dartmouth between july 2013 and february 2015 ( figure 1 ) . inclusion criteria included age 9 or 10 years , english fluency , absence of food allergies / restrictions , and absence of health conditions / medication use that may impact appetite or attention span . caregivers and children provided written consent and assent , respectively , and dartmouth s committee for the protection of human subjects approved all study protocols . to limit the analysis to unrelated children , one sibling from each of 21 sibling pairs in addition , four children were excluded because they did not report satiety after lunch , and three were excluded because of protocol violations ( i.e. , health condition potentially affecting appetite , caregiver interaction with child during experiment ) . there were no significant differences between included and excluded children in terms of baseline covariates or consumption ( data not shown ) . children and one parent were schedule for a study appointment at 11:30 am or 12:30 pm . children were instructed to eat a normal breakfast , but not to eat for the two hours prior to the appointment . during the appointment , children were provided lunch with their choice of main dish ( macaroni and cheese , pizza bites , or chicken nuggets with ketchup ) , along with string cheese , carrots and dressing , apple slices , bread , butter , milk , and water . meals were balanced on macronutrients and contained 552704 kcals of carbohydrates , 315405 kcals of fat , and 152188 kcals of protein . foods were pre - and post - weighed , and nutrient labels and the usda national nutrient database for standard reference were used to calculate caloric consumption . after lunch , each child was asked to assess his / her satiety with a 5-point likert scale ranging from i am very hungry to i am very full . children who reported , after lunch , all children viewed a 34-minute tv show ( figure it out ! , nickelodeon ) that included 7.7 minutes of either food or toy ads , along with 3.1 minutes of neutral ads . our outcome measure was caloric consumption after self - reported satiety , i.e. , eating in the absence of hunger ( eah ) , during the experimental exposure . we provided four snack foods during the experimental exposure : gummy candy ( 546 kcals ) , cookies ( 692 kcals ) , chocolate ( 1000 kcals ) , and cheese puffs ( 536 kcals ) . food was pre- and post - weighed , and product nutrition information was used to calculate caloric consumption . buccal cell swabs were collected before lunch and stored at room temperature with desiccant capsules ( isohelix , kent , u.k . ) . dna was isolated using ddk-50 isolation kits ( isohelix , kent , u.k . ) . genotyping for rs9939609 was conducted with real - time pcr and taqman chemistry using the 7500 fast real - time instrument ( primers and instrument from thermo fisher scientific ( waltham , usa ) ) . all samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates . we measured children s weight ( to the nearest 0.1 kg ) and height ( to the nearest 0.5 cm ) , using a digital scale and stadiometer ( model 597kl , seca , hamberg , germany ) . < 95 percentile and obese was defined as 95 percentile . estimated daily energy requirement ( eer ) was calculated according to institute of medicine guidelines using child s sex , measured height and weight , and caregiver - reported daily average physical activity . caregivers answered , how much time does your child spend doing physical activity such as running around , climbing , biking , dancing , swimming , playing sports , etc . ? separately for school or weekend days . a single weighted average was created and categorized as low active for 30<60 , active for 60<120 , and very active for 120 min / day . caregivers reported their child s race and ethnicity , their highest level of education , their spouse s highest level of education , and their household income category . caregivers also reported their child s typical number of hours spent watching tv or movies on a weekend day and school day , and responses were used to create a single weighted average . parental eating restriction was calculated as an average of caregiver responses to the restriction subscale questions of the child feeding questionnaire , e.g . , answered on a scale of : 1=disagree , 2=slightly disagree , 3=neutral , 4=slightly agree , and 5=agree ) . we compared participant characteristics by study condition using unpaired , 2-tailed t - tests for continuous measures and x or fisher s exact tests for categorical measures , as appropriate . next , we examined unadjusted associations between participant characteristics and caloric consumption during the lunch and eah phases using linear regression ; consumption during the eah phase was computed for total foods and separately for foods that were and were not advertised during the experiment . we then estimated the effect of the experimental condition on eah for total foods , advertised food , and non - advertised foods separately using multivariable linear regression adjusted for eer and all covariates related to eah at the p < 0.10 threshold . we did not include sex and bmi percentile as covariates because they were used to calculate eer ; however , we conducted a sensitivity analysis to determine whether adding those variables to the final models influenced findings . to address whether the fto rs9939609 genotype modified the effect between food ad exposure and eah , we included a multiplicative interaction term between the exposure and genotype in the adjusted models and used a wald test to determine the significance of the interaction term . to assess the robustness of our findings , we repeated the final models after excluding participants who were above the 90 percentile for eah consumption ( > 840 kcals ) . we also performed analyses stratified by sex and weight status , because some previous studies found interactions between food ad exposure and these variables on consumption . we conducted all analyses using sas 9.4 ( sas institute , cary , usa ) . the analysis included 172 children who were equally distributed across study conditions ( table 1 ) . approximately half of the children were male , and they were mostly white ( 86% ) and non - hispanic ( 97% ) . twenty - three percent of children were overweight or obese , which is slightly lower than the new hampshire rate of 26% . the mothers of the children were generally highly educated with 78% obtaining at least a college degree . children watched an average ( sd ) of 1.4 ( 1.0 ) hours of tv per day . baseline characteristics were balanced across experimental conditions with the exception of eer , which was 145 kcals higher in the toy vs. food arm of the study ( p = 0.03 ) . the frequency of fto rs9939609 genotype frequencies ( 36% tt , 48% at , and 16% aa ) were similar to those of other studies and were consistent with hardy - weinberg equilibrium ( x test p value = 0.93 ) . there was a strong relationship between the fto genotype and adiposity ; the rate of overweight / obesity was 18% among low - risk ( tt ) children compared to 44% among the highest - risk ( aa ) children ( p < 0.01 ) . in our sample , 21% of heterozygotes were overweight / obese , a rate similar to that for homozygous low - risk participants ( p = 0.68 ) . the fto genotype was not associated with any other child , caregiver or household characteristic at the p < 0.05 significance level ( table s3 ) . participants across both experimental conditions consumed an average ( sd ) of 453 ( 185 ) kcals during lunch . being male , having a higher bmi , and having a higher eer were associated with higher caloric consumption at lunch ( table 2 ) . participants consumed an additional 482 ( sd : 274 ) kcals during the eah phase . baseline characteristics associated with greater total eah consumption were being male , increased bmi percentile , eer and parental eating restriction ( table 2 ) . there was a statistically significant main effect of the food vs. toy ad exposure on the consumption of the food advertised during the session ; children exposed to food ads consumed , on average , 44 additional calories of gummy candy than children exposed to toy ads ( p = 0.02 ) . there was no main effect of experimental condition on total consumption or on foods not advertised during the experiment . in analyses adjusted for eer and parental eating restriction ( table 3 ) , the association between food ad exposure and consumption of the advertised food remained similar ( = 48 kcals , p = 0.01 ) . there were no main effects for total consumption ( p = 0.21 ) or consumption of foods not advertised ( p = 0.98 ) . we conducted a bonferonni correction of the significance level for the 3 hypothesis tests of consumption conducted ( total food , advertised food , non - advertised food ) and the association between food ad exposure and consumption of advertised food was still significant at the p < 0.017 level . in a sensitivity analysis that also included sex and bmi percentile in the final models , findings also remained unchanged when the analysis was restricted to individuals below the 90 percentile of eah consumption . there was a significant interaction between the fto rs9939609 genotype and food ad exposure with advertised food consumption ( p for interaction = 0.02 ) ( figure 2 ) . the magnitude of the association between food ad exposure and consumption increased linearly with each additional risk allele ; the estimate ( 95% ci ) for the tt , at , and aa genotypes were 3 ( 64 , 59 ) , 59 ( 4 , 115 ) , and 125 ( 16 , 233 ) kcals , respectively . stratum - specific estimates also increased linearly when considering total foods rather than only the advertised food , though the estimates were not significant , nor was the interaction . there were no significant interactions between participant sex or weight status with food ad exposure on consumption ( data not shown ) . in this randomized study , we observed a significant interaction between the fto rs9939609 genotype and food ad exposure on the consumption of a recently advertised food . our results suggest that the fto obesity - risk allele may confer children with a predisposition to heightened consumption in response to food cues . although we did not find evidence of a generalized effect of food ad exposure on overall cued eating , we did find that exposure to food ads influenced the consumption of a recently advertised food . during just 34 minutes of tv viewing , children who viewed a show with embedded food ads , including one ad for gummy candy , ate an average of 48 more kcals of gummy candy than children who viewed toy ads . moreover , that consumption occurred immediately after children reported eating lunch to satiety , reflecting excessive intake . the implications of such findings are concerning given the frequent exposure that children have to tv food ads and that the majority of television food advertising is for energy - dense , nutrient poor foods . food cues such as those present in food advertising are thought to drive non - homeostatic pathways of food consumption via their incentive - motivational properties acquired via classical conditioning . the nucleus accumbens , part of the dopaminergic reward pathway of the brain , is the likely functional interface between motivational food cues and consumptive behaviors , and functional neuroimaging studies have observed activation of the nucleus accumbens in response to food advertisements . in addition , studies also suggest that the neural reward response to food cues is greater for participants with fto rs9939609 obesity risk alleles , independent of adiposity . fto rs9939609 may regulate dopamine ( d2)-dependent reward learning , so the increased responsiveness to food cues may be a result of heightened prior conditioning . we hypothesize that genetic differences in the neural reward response to food cues underlies our observed behavioral findings ; however , further research is needed to better understand genetic differences in the effect of food cues on overconsumption . ten studies performed by five unique research groups have explored measured food consumption in children during or after viewing tv food ads ( systematically reviewed by boyland in 2016 ) . of these studies , a series of school - based experiments in the u.k . found that children consumed more after viewing a tv program proceeded by 810 food ads compared to toy ads . while compelling , the non - naturalistic presentation of ads in a single block before the show may have suggested the study goals to participants and thereby influenced behavior . however , two other studies presented the ads during more naturalistic commercial breaks , as we did in our study , and showed increased consumption related to food ad exposure . the remaining five studies did not find a main effect of food advertising exposure on consumption . the fact that the advertising effect was only observed for an advertised food differs from the majority of previous studies on cued eating that have demonstrated that the effect of advertising extends to non - advertised foods , a beyond - brand effect . unlike our study , however , most of those previous studies only provided participants with foods that were not advertised during the experimental session and did not also provide them the choice of an advertised food . only one other study provided participants with the choice between an advertised and non - advertised food ; in that study , exposure to an ad for a celebrity - endorsed potato chip increased consumption of that specific chip , but did not impact consumption of chips with a generic label . like our study , that study also did not observe a significant difference in consumption of the non - advertised food across study condition . we do not deem our study findings a contradiction of a beyond - brand effect , but consider them evidence of a preference for consuming advertised food when provided , a behavior that was not captured in most previous studies . the specificity of our food ad effect could also relate to the particular characteristics of the gummy candy , such as macronutrient composition , that differ from those of the other provided foods ( cookies , chocolate , cheese puffs ) . in addition , while only one ad for the gummy candy was shown , six of the 20 ads shown were for candy and those ads may have also influenced the consumption of the gummy candy . future research is necessary to better understand the observed specificity of the advertising effect on consumption . the implications of our findings for weight gain are unclear given that we did not find a significant difference in total caloric consumption related to ad exposure , though we did observe a positive trend for the association . given the high inter - individual variability in total consumption , our study may have been underpowered to test the effect of food ad exposure on this outcome . unlike four of the five studies that found a significant main effect , our study did not measure consumption in the same children under both conditions . while a within - participant design may have been more powerful , we chose not to use such a design because of our concerns that participant awareness of study goals could influence their behavior . we posited that children would be more likely to remain nave to the study goals when they were randomized to a single experiment condition . a larger study will be necessary to more definitively assess food ad exposure s effect on total consumption . our finding that parental eating restriction of child eating was positively related to total consumption recapitulate results from other groups . alternatively , parents may impose more restrictive feeding practices in response to a child s tendency to overeat . this study has the strength of controlling for initial satiety level , thereby enabling us to measure eah . indeed , a surprising finding was that children consumed approximately the same number of calories during the eah and lunch phases , suggesting the inability of children to regulate caloric intake when presented with highly palatable foods . through this eah paradigm , we were able to demonstrate that recent food ad exposure prompted children to consume a recently advertised food even when they were full . our study was limited in that it measured one instance of cued eating in a laboratory setting , and it is unknown whether children compensate for increased short - term intake by modifying long - term intake , thus mitigating any effects on excess weight gain . also , the generalizability of our laboratory - based findings to the home environment is unknown . furthermore , studies also suggests that tv ads prompt children to request the purchase of advertised foods , which may relate to an increased availability of those foods at home . thus , it is plausible that exposure to tv food ads among children at home may indeed relate to cued eating . while tv is still a primary mechanism for advertising to children , food companies are increasingly using other marketing tactics . for example , advergames , internet games that promote brand recognition , have been shown to increase short - term caloric consumption in children . in addition , the use of celebrity endorsements and character tie - ins is concerning and warrants further research . our study was also limited by its examination of a single genetic obesity risk factor , rs9939609 . this polymorphism has shown one of the strongest associations with child obesity , however , so understanding potential mechanisms of its action are of both scientific and public health importance . this is also one of the first studies to examine genetic predisposition to reactivity to food cues and the first examination of this research area in children . our study can not rule out the possibility that unmeasured confounders , like other genetic loci related to excess consumption , were unbalanced between study arms and could have contributed to the association we report . future , larger studies are necessary to study multiple genetic obesity risk factors related to food cue reactivity . in this randomized experimental trial , exposure to tv food ads was associated with increased caloric consumption of a recently advertised food in children who had already eaten a meal to satiety , and that association was modified by the fto rs9939609 obesity - risk allele . future research is needed to understand the neurological mechanism underlying these associations and whether other genetic risk factors also influence reactivity to food cues . given the high exposure that children have to ads marketing unhealthy foods , the observed cued eating may have a substantial impact on children s dietary choices .

background / objectiveexposure to food advertisements may cue overeating among children , especially among those genetically predisposed to respond to food cues . we aimed to assess how television food advertisements affect eating in the absence of hunger among children in a randomized trial . we hypothesized that the fat mass and obesity associated gene ( fto ) rs9939609 single nucleotide polymorphism would modify the effect of food advertisements.subjects/methodsin this randomized experiment , 200 children aged 910 years old were served a standardized lunch and then shown a 34-minute television show embedded with either food or toy advertisements . children were provided with snack food to consume ad libitum while watching the show and we measured caloric intake . children were genotyped for rs9939609 and analyses were conducted in the overall sample and stratified by genotype . a formal test for interaction of the food ad effect on consumption by rs9939609 was conducted.results172 unrelated participants were included in this analysis . children consumed on average 453 ( sd=185 ) kcals during lunch and 482 ( sd=274 ) kcals during the experimental exposure . children who viewed food advertisements consumed an average of 48 kcals ( 95% ci : 10 , 85 ; p=0.01 ) more of a recently advertised food than those who viewed toy advertisements . there was a statistically significant interaction between genotype and food advertisement condition ( p for interaction = 0.02 ) , where the difference in consumption of a recently advertised food related to food advertisement exposure increased linearly with each additional fto risk allele , even after controlling for bmi percentile.conclusionsfood advertisement exposure was associated with greater caloric consumption of a recently advertised food , and this effect was modified by an fto genotype . future research is needed to understand the neurological mechanism underlying these associations .

Introduction Subjects and Methods Participants Preload Lunch Food Advertisement Exposure Eating in the Absence of Hunger FTO rs9939609 Genotyping Covariates Statistical Analysis Results Discussion Conclusion Supplementary Material

PMC4667650

animals : female and male c57bl/6n mice were purchased from japan slc , inc . the animals used for the experiments were bred in a laboratory at the department of animal science at kobe university , under a 12-hr light / dark cycle at 2124c and 4060% humidity . a laboratory diet ( lab mr stock ; nihon nosan co. , yokohama , japan ) and filtered water were available ad libitum . this experiment was approved by the institutional animal care and used committee ( permission number : 24 - 10 - 03 ) and carried out according to the kobe university animal experimentation regulation . , osaka , japan ) was based on the dose associated with the lowest observed adverse effect level ( loael ) [ 200 ng / kg body weight ( bw ) ] [ 11 , 12 ] . the volumes for oral administration were adjusted to 25 l/30 g bw of sesame oil . female mice in proestrus were mated 1:1 with males overnight , and females that had a vaginal plug on the following morning were designated as being at e0.5 . vehicle or tcdd ( 20 , 200 , 2,000 or 5,000 ng / kg bw ) was orally administered on e8.5 . these groups were defined as the control , t20 , t200 , t2000 and t5000 groups , respectively . tissue preparation : at the time of necropsy , all dams were deeply anesthetized with diethyl ether . they were then fixed in 4% paraformaldehyde in 0.1 m phosphate buffer overnight at 4c , dehydrated through a graded series of ethanol followed by xylene and embedded in paraffin . coronal serial sections of 10 m thickness were then cut and mounted on a glass slide ( platinum pro ; matsunami glass ind . , ltd . , kishiwada , japan ) , and a series of semi - serial sections was made by collection at 100-m intervals ( one of every 10 tissue sections ) . cresyl fast violet staining : after deparaffinization and rehydration , the sections were stained with 0.1% cresyl fast violet solution for 5 min . they were then placed in distilled water and a graded series of ethanol for appropriate bleaching of dye , dehydrated with ethanol and coverslipped with eukitt ( o. kindler , gmbh , freiburg , germany ) . immunohistochemistry and immunohistoplanimetry : the combination of blocking agents and antibodies used for the detection of each protein by immunohistochemistry is listed in table 1table 1.the combination of blocking agents and antibodies used for immunohistochemistrydetectionblocking reagentprimary antibodysecondary antibodygfapblocking one histo(nacalai tesque , inc . , kyoto , japan)mouse monoclonal antibody against gfap(ne1015 ; 1:1,000)(merck , kgaa , darmstadt , germany)histofine max - po ( m)(histofine simplestain system)(nichirei bioscience , inc . , tokyo , japan)pcnablocking reagent a and b(nichirei bioscience , inc.)mouse monoclonal antibody against pcna(na03 ; 1:100)(merck , kgaa)histofine max - po ( m)(nichirei bioscience , inc.)dcxblocking one histo(nacalai tesque , inc.)goat polyclonal antibody against dcx(sc-8066 ; 1:100)(santa cruz biotechnology , inc . , dallas , tx , u.s.a.)horseradish peroxidase - conjugated antigoat igg mouse igg ( ap186p ; 1:100)(merck , kgaa)gfap : glial fibrillary acidic protein , pcna : proliferating cell nuclear antigen , dcx : doublecortin .. the sections were deparaffinized and rehydrated and were heated at 121c for 20 min in 10 mm sodium citrate buffer ( ph 6.0 ) for antigen retrieval . after cooling , they were immersed in absolute methanol and 0.5% h2o2 for 30 min each at room temperature ( rt ) to quench the endogenous peroxidase activity . the specimens were incubated with each blocking agent for 1 hr at rt and then with each primary antibody for 18 hr at 4c ( table 1 ) . after washing with phosphate buffered saline ( pbs ) , each secondary antibody was reacted for 1 hr at rt ( table 1 ) . the excess antibodies were rinsed in pbs , and the immunoreactivities were detected by incubation with 3,3-diaminobenzidine solution ( envision+ kit / hrp [ dab ] ; dako , glostrup , denmark ) . the sections were counterstained lightly with hematoxylin . finally , they were dehydrated and cleared through an ethanol - xylene series and coverslipped with eukitt ( o. kindler , gmbh ) . gfap : glial fibrillary acidic protein , pcna : proliferating cell nuclear antigen , dcx : doublecortin . immunohistoplanimetry : coronal sections containing the hippocampus stained immunohistochemically were observed under a light microscope ( nikon , corp . , the granular immunoreactivities of glial fibrillary acidic protein ( gfap ) and proliferating cell nuclear antigen ( pcna)-positive cells were counted in 3 sections per 100 m . statistical analysis : statistical analysis was performed with excel statistics 2012 for windows ( ssri , co. , ltd . , values were considered statistically significant if p<0.05 . the tukey - kramer or steel - dwass test after one - way anova analysis was used to determine differences between groups . body and brain weights : no significant differences in bw or brain weight were found between the control and tcdd - exposed groups ( data not shown ) . the dg at e18.5 was immature , and the granular cell layer could not be clearly distinguished from the molecular layer and polymorphic layer based on its morphology ( fig . ( a e ) the cell density in the dg was decreased in the t5000 compared with the control group , whereas no obvious changes were observed in the shape or somatic size of cells ( e ) . ( f j ) the fibrous immunoreactivities of gfap were detected , but were decreased in the t5000 group ( j ) . ( k o ) the numbers of pcna - positive cells were smaller in the t5000 ( o ) than the other groups ( k n ) . ( p t ) the intensity of dcx staining did not differ between the control and tcdd - exposed groups . mol : molecular layer ; gcl : granule cell layer ; pia : pia mater ; bar=50 m . ) . the cell density in the dg appeared to be decreased slightly in the t5000 group compared with the control group , whereas no obvious changes were observed in the shape or somatic size of cells . however , no notable differences in the hippocampal fimbria were found between the control and tcdd - exposed groups ( fig . 2 . representative histology and immunohistochemistry in the hippocampal fimbria in the hippocampus at e18.5 . ( a e ) no notable differences were found between the control and tcdd - exposed groups based on cresyl fast violet staining . ( f j ) the fibrous and granular immunoreactivities of gfap were observed , and the latter was reduced in the t5000 group ( j ) . lv : lateral ventricle ; bar=50 m ( inset : 20 m ) . ) . ( a e ) the cell density in the dg was decreased in the t5000 compared with the control group , whereas no obvious changes were observed in the shape or somatic size of cells ( e ) . ( f j ) the fibrous immunoreactivities of gfap were detected , but were decreased in the t5000 group ( j ) . ( k o ) the numbers of pcna - positive cells were smaller in the t5000 ( o ) than the other groups ( k n ) . ( p t ) the intensity of dcx staining did not differ between the control and tcdd - exposed groups . mol : molecular layer ; gcl : granule cell layer ; pia : pia mater ; bar=50 m . . ( a e ) no notable differences were found between the control and tcdd - exposed groups based on cresyl fast violet staining . ( f j ) the fibrous and granular immunoreactivities of gfap were observed , and the latter was reduced in the t5000 group ( j ) . immunohistological findings : the fibrous immunoreactivities of gfap were detected in the cell body and process of neural stem cells ( nscs ) and astrocytes in the dg . gfap - immunoreactive nscs and astrocytes were localized in the molecular layer , granular cell layer and next to the pia mater ( fig . , the fibrous and granular gfap immunoreactivities were observed in the cell body and process of nscs and astrocytes ( fig . the granular immunoreactivities of gfap appeared to be reduced in the t5000 group , and in fact , the number of them was significantly decreased ( figs . 3.the results of immunohistoplanimetry for the number of pcna - positive cells in the dg ( a ) and the granular immunoreactivities of gfap in the hippocampal fimbria ( b ) . ( a ) the number of pcna - positive cells was decreased in all tcdd - exposed groups and significantly reduced in the t20 , t200 and t5000 groups . ( b ) the number of the granular immunoreactivities of gfap was significantly decreased in the t5000 group . the number of pcna - positive cells was decreased in all tcdd - exposed groups and significantly reduced in the t20 , t200 and t5000 groups ( figs . 1k1o and 3b ) . doublecortin ( dcx ) immunoreactivity was detected in axons and dendrites of the immature neurons . the intensity of dcx staining did not differ between the control and tcdd - exposed groups ( fig . the results of immunohistoplanimetry for the number of pcna - positive cells in the dg ( a ) and the granular immunoreactivities of gfap in the hippocampal fimbria ( b ) . ( a ) the number of pcna - positive cells was decreased in all tcdd - exposed groups and significantly reduced in the t20 , t200 and t5000 groups . ( b ) the number of the granular immunoreactivities of gfap was significantly decreased in the t5000 group . this study demonstrated maternal tcdd exposure in c57bl/6n mice disrupted the fetal hippocampal development at e18.5 . to our knowledge , this is the first in vivo study reporting the effect of maternal exposure to tcdd on the dg and the hippocampal fimbria in fetal mice in which the decreases of the gfap immunoreactivities and the number of pcna positive cells in the dg , and the reduction of the number of granular gfap immunoreactivities in the hippocampal fimbria were shown . these results suggest that the cumulative dioxins in fetus mediated via the placenta already affect the cells in the dg and the hippocampal fimbria in the fetal period and result in an adverse effect on the development of the hippocampus . neurons and glial cells in the dg derive from a pseudostratified neuroepithelium of ectodermal origin during early embryonic development . at around e910 in mice , cortical neurogenesis begins , and neuroepithelial cells begin to differentiate into radial glia ( rg ) , which are nscs and express gfap . the rg generates neurons directly or indirectly through neural precursor cells ( npcs ) . in the present study , the gfap immunoreactivities were reduced in the dg of the t5000 group at e18.5 , and the number of pcna - positive cells was significantly reduced in the dg of the t20 , t200 and t5000 groups at e18.5 . moreover , the cell density in the dg was decreased in the t5000 group compared with the control group . these results suggest that tcdd exposure impairs nscs , npcs or granular cells , resulting in a disruption of neuronal development in the fetal dg . tcdd exposure is known to affect cell proliferation via the activation of mitogen - activated protein kinases ( mapks ) , such as erk or jnk , and the induction of p21 or p27 , which are involved in the cell cycle [ 3 , 22 , 33 , 38 ] . moreover , tcdd also inhibits dna synthesis in rat primary hepatocytes , and the proliferation of primary npcs is arrested in the g1 phase of the cell cycle by tcdd exposure [ 18 , 25 ] . considering that the ahr is present in proliferating nscs and npcs in vivo , tcdd exposure likely altered the proliferation of nscs or npcs in the present study , resulting in a reduction in the number of pcna - positive cells . another possibility is that the number of cells in the hippocampus was reduced through the promotion of apoptosis . during the developmental period , a surplus of new neurons is produced , and the inappropriate neurons are excluded by apoptosis [ 7 , 31 ] . as a result , the net number of neurons is properly retained . it has been reported that ahr - mediated oxidative stress generated by the induction of cytochrome p450 enzymes may be an upstream event in the apoptosis cascade . in addition , tcdd exposure has been shown to increase apoptosis of granule neuron precursor cells in the developing cerebellum . in this study , it is possible that the mechanism for regulating the number of cells in the hippocampus was disrupted via tcdd - induced promotion of nsc , npc or granular cell apoptosis . in the hippocampus , astrocytes and nscs express an astroglial intermediate filament , gfap [ 4 , 49 ] . immunoreactivities of gfap were observed fibrously and granularly in the hippocampal fimbria at e18.5 . the former is considered as the cell processes of astrocytes and nscs and the latter as the branching point of the cell process . the number of granular gfap immunoreactivities was significantly decreased in the t5000 group , which may indicate the delay of astrogenesis . during embryonic development , rgs give rise to neurons first and glial cells later . at the end of embryonic development , the basic helix - loop - helix genes hes1 and hes5 are known notch signaling genes , and hes1 and hes5 keep nscs undifferentiated during early development and promote differentiation into glial cells . these data suggest that the toxicity of tcdd mediated via the ahr disrupts the maintenance of nscs at the point of their differentiation into astrocytes , resulting in the induction of developmental delay of astrogenesis in the hippocampal fimbria . the hippocampal fimbria is mainly composed of a band of efferent axons that forms part of the cerebral fornix . ca3 subcortical efferents in the hippocampal fimbria support the acquisition of contextual fear . it is known that astrocytes surrounding the synapses participate in neurotransmission and that astrocytes are also an important component in glutamate uptake and metabolism . therefore , astrocytes are also considered to support neural activity in the hippocampal fimbria . these facts suggest that the developmental delay of astrocytes by tcdd exposure disrupts neuronal activity in the hippocampal fimbria . in adult mice , new neurons are produced in the subgranular zone ( sgz ) of the dg . unlike in fetal mice , radial astrocytes in the adult sgz play a role as the primary precursors of new neurons in the adult hippocampus and increased in sgz differentiation into granular cells at 14 weeks . neurogenesis in the dg becomes persistent throughout postnatal life and is regulated by behavior and the environment . the hippocampus is functionally engaged in learning and memory , and newborn cells are increased by hippocampal - dependent learning tasks [ 41 , 47 ] . therefore , it is suggested that neurogenesis exerts an influence on learning and memory . it has been reported that in utero and lactational exposure to dioxin deficit the fear memory of male offspring in adulthood , and latency in the active avoidance learning was longer in the tcdd exposed male offspring in the 4144 postnatal day [ 13 , 30 ] . considering these reports , the effects of tcdd observed in the fetal period , such as the decrease in the numbers of gfap- and pcna - positive cells , may persist into adulthood , or neurogenesis in the dg may be negatively affected by tcdd exposure - mediated lactation . based on the present data , we conclude that maternal tcdd exposure has adverse impacts on nscs , npcs , granular cells or astrocytes in the dg or hippocampal fimbria , resulting in a disturbance of neuronal development in future generations of mice . it is possible that these effects remain until adulthood , and so , whether the influences of tcdd toxicity on the developing hippocampus persist and impair learning and memory in adulthood is needed to be examined as a further study .

dioxins are widespread persistent environmental contaminants with adverse impacts on humans and experimental animals . behavioral and cognitive functions are impaired by 2,3,7,8-tetrachlorodibenzo - p - dioxin ( tcdd ) exposure . tcdd exerts its toxicity via the aryl hydrocarbon receptor ( ahr ) , a ligand - activated transcription factor . the hippocampus , which plays important roles in episodic memory and spatial function , is considered vulnerable to tcdd - induced neurotoxicity , because it contains the ahr . we herein investigated the effects of tcdd toxicity on hippocampal development in embryonic mice . tcdd was administered to dams at 8.5 days postcoitum with a single dose of 20 , 200 , 2,000 and 5,000 ng / kg body weight ( groups t20 , t200 , t2000 and t5000 , respectively ) , and the brains were dissected from their pups at embryonic day 18.5 . immunohistochemical analysis demonstrated that the glial fibrillary acidic protein ( gfap ) immunoreactivities in the dentate gyrus ( dg ) were reduced in the t5000 group . granular gfap immunoreactivity was observed in the hippocampal fimbria , and the number of immunoreactive fimbria was significantly decreased in the t5000 group . the number of proliferating cell nuclear antigen ( pcna)-positive cells was decreased in all tcdd - exposed groups and significantly reduced in the t20 , t200 and t5000 groups . together , these results demonstrate that maternal tcdd exposure has adverse impacts on neural stem cells ( nscs ) , neural precursor cells ( npcs ) and granular cells in the dg and disrupts the nsc maintenance and timing of differentiation in the hippocampal fimbria , which in turn interrupt neuronal development in future generations of mice .

MATERIALS AND METHODS RESULTS DISCUSSION

PMC4175237

patellofemoral pain syndrome ( pfps ) is a common orthopedic disease , and often induces patella pain during climbing and long - distance running1 . the results of a previous study indicate that athletes have high risks of knee overuse2 . the quadriceps supplies the power of dynamic patellar movement , and the vastus medialis oblique ( vmo ) and vastus lateralis ( vl ) enable the patella to stabilize during tracking3 . a lack of muscle strength in the vmo decreases the medial muscular tension the patellar and causes the muscle imbalance to increase patellar maltracking4 . the ideal ratio of the vmo to vl is 1:1 , but many pfps patients have had a low ratio for both muscles in electromyography studies5 . some studies indicated that increasing the muscle strength of the vmo is a useful method of preventing pfps6 , 7 . some study results indicated that specific vmo exercise training can effectively prevent and reduce the incidence of pfps7 , 8 . the open kinetic chain is a movement in which the distal end of the extremity is not fixed to a relatively stable surface . in the closed kinetic chain , movement of a joint can not occur without causing predictable movements in the other joints of the extremity9 . a closed kinetic chain exercise for the knee joint can cause quadriceps and hamstring co - contraction to reduce displacement and improve joint stability , but this will increase the intra - articular pressure10 . this exercise can cause quadriceps contracture , and this is similar to the muscle activity recruitment occurring during weight - bearing in the gait11 . open kinetic chain exercise uses a lower amount of weight loading for pfps patients than closed kinetic chain exercise . the results of some studies show that closed kinetic chain exercise has a significant therapeutic effect for pfps patients11,12,13 . however , these studies often focused on the pain decrease and ignored discussing the effect of vmo muscle activity during the exercise training . sling exercise therapy ( set ) is a new training method for athletes and orthopedic patients utilized in recent years14 . because of its convenience and practicality , set has become more and more common in rehabilitation clinics and fitness training centers15 . however , studies about the effects of using set with open and closed kinetic chains on vmo muscle training in pfps patients are rare . we followed the theories about open and closed kinetic chain exercises to design two exercises using set and explore the vmo and vl muscle activity . to our knowledge , this is the first study to investigate this theme , and we think that the results of this study are important for pfps patients as well as physical therapists and athletic trainers providing therapeutic exercise . this study was a cross - over study and was approved by the institutional review board of china medical university and hospital . we informed all participants about the experimental process in detail and then obtained their informed consent before the study . we recruited healthy female college students and randomly assigned them to the two set exercises , comprising sling open chain knee extension ( socke ) exercise and sling closed chain knee extension ( sccke ) exercise ( fig . a redcord suspension system ( redcord trainer , record , staub , norway ) was used to train the quadriceps muscle by one athletic trainer . the two exercises were performed for 10 min , and 3 repetitions of maximum force were completed in this period . the socke exercise used set to suspend the knee and maintain knee flexion at 60 degrees . the sccke exercise used set to suspend the ankle and maintain the hip in full extension . we asked the individual to extend the knee to strengthen the concentric contraction of the quadriceps . these exercises were designed to improve the strength of the vmo for application in the field of sports medicine . scottsdale , az , usa ) was fixed to the lateral knee joint , which was the axis of the goniometer , and the stationary and movable arms were tied to the lateral midline of the thigh and shank . the range of motion of the knee was monitored , and the vmo and vl muscle activity was collected by electromyography by one examiner . socke ( a ) and sccke ( b ) exercises electromyography ( myotrace 400 , noraxon usa inc . , scottsdale , az , usa ) was used to calculate the maximal voluntary contraction ( mvc ) . the vl electrodes were placed on the line from the anterior superior iliac spine to the superolateral boarder of the patella and 10 cm from the patella . the vmo electrodes were placed at a distance of 4 cm from the superior side of the patella along a line inclined 50 that ran parallel to the line from the anterior superior iliac spine to the superolateral boarder of the patella16 . in the electromyography signal processing , the sampling frequency was set to 1,000 hz . we used a band - pass filter of 40 to 400 hz to reduce external noise and performed full - wave rectification . then , setting the root mean square at 100 ms smoothed the signal17 . finally , we set the amplitude normalization at 300 ms and normalized the different movement data by transforming mvc into mvc% with the following formula : mvc% = ( mean mvc / maximum force of the resistance test ) 100% , chicago , il , usa ) to compare the activations of the of vmo and vl . the wilcoxon test was used to compare the differences in the mvo% values of the vmo and vl between the sccke and socke exercises . the consistencies of activation of the vmo and vl for 3 repetitions of maximum contraction of one exercise within each individual were analyzed by using the intraclass correlation coefficient ( icc ) . seven healthy college students ( age = 21.3 0.6 ; weight = 51.3 6.3 kg ; height = 161.5 4.8 cm ) were recruited and performed 3 repetitions of maximum contraction for each exercise . the icc for activation of the vmo and vl for 3 repetitions of maximum contraction was 0.91 0.23 , and there were no significant differences in the socke and sccke exercises among the 3 repetitions of maximum contraction . table 1table 1.mvc results of the seven participantsnosocke exercisesccke exercisevmo ( % ) vl ( % ) vmo ( % ) vl ( % ) 198.9 2.484.4 2.379.9 3.363.2 1.3289.8 3.189.4 3.193.7 3.298.4 2.8360.6 3.586.3 4.278.6 2.671.2 2.3499.6 3.798.1 3.882.5 3.581.5 1.4573.3 3.289.9 2.782.2 3.386.2 3.3696.5 2.677.1 3.392.1 4.170.1 2.1785.4 1.478.2 2.990.7 3.274.4 3.2socke , sling open chain knee extension ; sccke , sling close chain knee extension exercise ; vmo , vastus medialis oblique ; vl , vastus lateralis shows that 5 participants ( nos . 1 , 2 , 4 , 6 , and 7 ) had higher mvc% values for the vmo than for the vl during the socke exercise . five participants ( nos . 1 , 3 , 4 , 6 , and 7 ) had higher mvc values for the vmo than for the vl during the sccke exercise . the mean mvc% values for the vmo ( 86.30 14.61 ) and vl ( 86.20 7.25 ) during the socke exercise were higher than those for the vmo ( 85.67 6.27 ) and vl ( 77.85 11.81 ) during the sccke exercise . no significant differences in mvc% values for the vl and vmo were found between the exercises ( p > 0.05 ) . however , the mvc% values for the vmo and vl during the socke exercise were higher than during the sccke exercise . the mvc% of the vl was higher than that of the vmo during both exercises . we also found that the ratio of the vmo to vl was 1.0 0.19 during the socke exercise and 1.11 0.15 during the sccke exercise . socke , sling open chain knee extension ; sccke , sling close chain knee extension exercise ; vmo , vastus medialis oblique ; vl , vastus lateralis this study compared the vmo and vl muscle activities during the sccke and socke exercises . our results showed that both exercises had a recruitment effect on the vmo muscle . in addition , the socke exercise had higher mvc% values for the vmo and vl than the sccke exercise . many studies have used closed kinetic chain and weight - bearing exercises , e.g. , double - leg squat and lunge exercise , to improve the vmo strength5 , 18 , 19 . their results showed that these exercises can significantly increase the activation of the vmo and vl . some studies showed that closed kinetic chain exercises can cause greater activation in the vmo than in the vl5 , 6 , 19 . however , combining closed kinetic chain exercise with weight - bearing exercise often provides a large increase in pulling strength , and increases the intra - articular pressure . we found that the using set in the sccke exercise can also cause greater activation in the vmo than in the vl . set can reduce the effect of body weight on the knee intra - articular pressure and can be used to train knee extension with non - weight bearing . the sccke exercise may be useful and helpful in training vmo activity for pfps patients . we also found the socke exercise to be more effective in activating the vmo than the sccke exercise . some studies reported that open kinetic chain exercise has little effect on ptps rehabilitation , because the activation of the vmo was not enough to improve patellar tracking20 , 21 . however , our study results showed that use of set in the socke exercise can increase the muscle activity of the vmo by more than that of the vl . we thought suspension of the knee by set would decrease the postural stability during the sccke exercise . this can challenge the stability of the trunk core muscles to facilitate knee extensor contracture . so , our study results showed that the socke exercise , which easily causes quadriceps muscle contraction , can be more effective in training the vmo than the sccke exercise . a previous electromyography study showed that the ideal ratio of the vmo to vl was 1:1 in knee extension exercise for the asymptomatic knee joint5 . in our study , the ratios of the vmo to vl in the socke and sccke exercises were over the ideal ratio of 1:1 . the socke exercise is more suitable training the vmo and vl of pfps patients than the sccke exercise because it has an approaching ideal vmo to vl ratio . this means that the signals detected for muscle fibers were the same for the socke and sccke exercises . we found that large muscle fibers were recruited for vmo activity during the socke exercise , and the ratio of the vmo to vl was 1.11:1 . previous studies showed high ratios of the vmo to vl at knee extension from 60 to 180 degrees during isokinetic open chain exercise21 , 22 . we used set to suspend the lower extremity and maintain extension of the knee from 60 to 180 degrees during the socke and sccke exercises . furthermore , our results showed that both exercises can recruit vmo activity , presenting ratios of the vmo to vl higher than 1:1 . so , both exercises can improve the vmo muscle contraction of pfsp patients , and the beneficial effect on vmo to vl ratio of the socke exercise is better than that of the sccke exercise . first , the healthy individuals in this study did not have pain and symptoms related to the patella and did not conform to the muscle activity of a ptps patient . second , the small sample size , 7 participants only , means that the findings can not be generalized to all ptps patients . so , we suggest that a larger sample of symptomatic ptps patients is required in a future study .

[ purpose ] the muscle strength of the quadriceps muscle is critical in patellofemoral pain syndrome . the quadriceps muscle supplies the power for dynamic patellar movement , and the vastus medialis oblique ( vmo ) and vastus lateralis ( vl ) enable the patella to stabilize during tracking . we followed the theories about open and closed kinetic chain exercises to design two exercises , sling open chain knee extension ( socke ) exercise and sling closed chain knee extension ( sccke ) exercise . the purpose of our study was to research the changes in quadriceps muscle activity during both exercises . [ methods ] electromyographic analysis was used to explore the different effects of the two exercises . the mvc% was calculated for the vmo and vl during exercise for analysis . [ results ] we found that the mean mvc% values of the vmo and vl during the socke exercise were higher than those during the sccke exercise . the ratio of the vmo to vl was 1.0 0.19 during the socke exercise and 1.11 0.15 during the sccke exercise . [ conclusions ] the socke exercise is targeted at quadriceps muscle training and has a recruitment effect on the vmo . the beneficial effect of the socke exercise is better than that of the sccke exercise .

INTRODUCTION SUBJECTS AND METHODS RESULTS DISCUSSION

PMC3197442

the media was prepared using 10% fbs ( 16140 - 071- gibco ) in dmem / f-12 ( 1x ) , liquid 1:1 ( 10565 - 042- invitrogen ) with 0.6 % agar solution purified , granulated ( 1.01614.1000- emd ) . for the preparation of media 5ml of fbs ( 16140 - 071- gibco ) was added to 45ml of dmem / f-12 ( 1x ) , liquid 1:1 ( 10565 - 042- invitrogen ) making final volume of 50ml . the agar solution was cool down to 37c temperature by keeping it into the water bath . we used equal volume of media from step 1.2 and 1.3 and prepared stock solution . the ratio of 0.6 % agar ( 0.5ml ) and 10% fbs - d - mem / f-12 media ( 0.5ml ) was 1:1 , making the total volume of 1 ml in each well of 6 well plates . glioblastoma multiforme ( gbm ) tissues were received immediately after the surgery from department of pathology . the tissue was transferred to patri - plate using forceps carefully and washed with ice - cold 5ml 1xpbs for 3 times . serial sections of the specimens were cut from the dissected samples to create tumor blocks ( approximate 10 mm in diameter ) with a surgical blade ( feather-2976#10 ) and forcep ( fisher scientific ) . tumor blocks were then injected with either dmso ( 5% ) or tmz ( 2.5 nm ) and incubated for 16 hours at 37 c in humidified air containing 5% co2 . ( 5% ) or tmz was injected 3 times in tumor blocks at different places for consistent treatment . the drug was injected using insulin syringe 1ml 0.37x12.7 mm 28g1/2 ( comfort point-26027 ) . after washing the blocks were fixed with 10ml of 10 % v / v formalin for 24 hours ( ricca chemical company ) in 50 ml tubes ( basix-5539802 ) and processed for paraffin embedded 4m sections . the formalin fixed section was placed in beaker on the stir plate with " no heat " and processed through the following solutions for 30 minutes in each solution . 30% ethanol , 50% ethanol , 75% ethanol , 80% ethanol , 95% ethanol , 100% ethanol , and xylene . the tissue was blotted on paper towels and placed in melted paraffin ( 58 to 60 c , fisher paraplast paraffin ) for 30 minutes . the tissue was embedded in molds using surgipath blue ribbon paraffin , embedded tissue was cooled to room temperature . xylene for 3x5 minutes ( 3 times for 5 minutes ) , 100% ethanol for 3x5 minutes , 95% ethanol for 1x5 minutes , 70% ethanol for 1x5 minutes , rinse in running tap water for 3 minutes . antigen retrieval with heat induced epitope retrieval immerse slides in 1x citrate buffer ( thermo scientific - ap9003 - 500 ) diluted in distilled water in a glass beaker . boil for 15 minutes on a hot plate ( make sure sections don"t fall off the slide ) . cool the solution for 30 minutes at room temperature . rinse the slides with 1x pbs for 3x5 minutes . inhibition of internal peroxide immerse the slides in methanol ( fisher scientific - a-452 - 4 ) with 0.3% hydrogen peroxide ( fisher scientific- bp2633 - 500- diluted in distilled water ) in a glass beaker for 15 minutes . rinse in 1x pbs for 3x5 minutes . blocking cover the tissues with 10% normal goat serum . transfer the slides in a humid box and incubate for 1 hour at room temperature . primary antibody sections were incubated overnight at 4c with primary antibody at following concentrations : human specific caspase-3 ( 1:1,000 , r&d systems , af835 ) , ki67 ( 1:1 , dako , 15626 ) diluted with 1x pbs . secondary antibody reaction cover the tissues with 2 - 3 drops of hrp labeled secondary antibody ( envision systems ) . detection develop for the chromogen dab kit ( vector laboratories - sk-4100 ) for detection of primary antibody following the manufacturer 's protocol . counter staining immerse the slides with hematoxylin ( 10 - 15 seconds , make sure don"t overrun dab signal ) . dehydration immerse the slides in following order , 70% ethanol for 5 minutes , 95% ethanol for 5 minutes , 100 % ethanol for 3x5 minutes , xylene for 3x5 minutes . cover slip the slides with permount mounting reagent ( fisher scientific - sp-15 - 100 ) . images were taken using olympus fluorescence microscope ( dp-72).3.11 ) . in all experiments , specific labeling the patients underwent the first surgery without prior chemotherapies including temozolomide ( tmz ) . the t1-weighted image of mri with gadolinium enhancement in figure-1a demonstrated an enhanced tumor in the right frontal lobe before surgery . the surgical tissues were sent to the department of pathology for the clinical diagnosis purpose , and the remaining specimens were processed to the tissue procurement under the approved institutional review board ( irb ) protocol at the ohio state university medical center . hematoxylin and eosin ( h&e ) staining demonstrated the presence of necrosis , pseudopallisading cells , and microvascular proliferation ( figure 1-c ) . of note , tumor explants following incubation without tmz up to 48 hours maintained the cytoarchitecture of gbm .in contrast , with incubation for 72 hours or longer , we noticed the increased number of condensed nuclei in the specimens , suggesting some of the tumor cells starting to undergo apoptosis . as a result , tumor tissues following longer incubation contained patchy regions that lost tumor cells , which were preferentially observed at and around necrotic areas ( data not shown ) . in order to investigate if these tumor explant samples can reliably be utilized for the purpose of drug efficacy test , we tested the effect of tmz treatment a recent study indicated that intratumoral injection of tmz has more potent effect on growth control of malignant glioma than that of the systemic administration of this drug . following incubation for 16 hours , these explants were embedded with paraffin and serial sections were prepared for staining . immunohistochemistry of tmz - treated gbm tissues demonstrated a substantial reduction of ki-67-positive tumor cells in comparison with the control samples . in turn , immunohistochemistry with an apoptosis marker , caspase-3 , did not yield any significant difference between tmz - treated glioma specimens and the control samples ( figure-3 ) . treatment effect with tmz was further characterized by combining this explant assay together with either in vitro culture or flow cytometry . specifically , we sought to determine the effect on stem cell - like tumor cells ( scltc ) . therefore , following intratumoral treatment with tmz , we performed sphere forming assay and flow cytometry of these tumor explants . the tmz - treated specimens were dissociated into individual single cells and these single cells were seeded in a low density ( 1 cell per microliter or lower ) in 96-well plates in serum - free medium supplemented with bfgf and egf . in the control group , given that sphere formation is a property of scltc , alterations in the number of tumor spheres by a drug treatment indicates the effect on scltc . similarly , flow cytometry of the dissociated tumor explants with a cell surface marker , cd133 , was carried out to verify the effect on scltc . if scltc in heterogeneous tumor cells in gbm are selectively eradicated by a drug treatment , one might predict that flow cytometry should detect decrease of the cd133-positive fraction by treatment ( data not shown ) . figure-2b shows dissection of tumor block into 10 mm small pieces with the help surgical blade . immunohistochemistry of gbm tissue blocks injected with dmso or tmz with activated caspase-3 and ki67 . the media was prepared using 10% fbs ( 16140 - 071- gibco ) in dmem / f-12 ( 1x ) , liquid 1:1 ( 10565 - 042- invitrogen ) with 0.6 % agar solution purified , granulated ( 1.01614.1000- emd ) . for the preparation of media 5ml of fbs ( 16140 - 071- gibco ) was added to 45ml of dmem / f-12 ( 1x ) , liquid 1:1 ( 10565 - 042- invitrogen ) making final volume of 50ml . the agar solution was cool down to 37c temperature by keeping it into the water bath . we used equal volume of media from step 1.2 and 1.3 and prepared stock solution . the ratio of 0.6 % agar ( 0.5ml ) and 10% fbs - d - mem / f-12 media ( 0.5ml ) was 1:1 , making the total volume of 1 ml in each well of 6 well plates . glioblastoma multiforme ( gbm ) tissues were received immediately after the surgery from department of pathology . the tissue was transferred to patri - plate using forceps carefully and washed with ice - cold 5ml 1xpbs for 3 times . serial sections of the specimens were cut from the dissected samples to create tumor blocks ( approximate 10 mm in diameter ) with a surgical blade ( feather-2976#10 ) and forcep ( fisher scientific ) . tumor blocks were then injected with either dmso ( 5% ) or tmz ( 2.5 nm ) and incubated for 16 hours at 37 c in humidified air containing 5% co2 . 0.1ml of dmso ( 5% ) or tmz was injected 3 times in tumor blocks at different places for consistent treatment . the drug was injected using insulin syringe 1ml 0.37x12.7 mm 28g1/2 ( comfort point-26027 ) . after washing the blocks were fixed with 10ml of 10 % v / v formalin for 24 hours ( ricca chemical company ) in 50 ml tubes ( basix-5539802 ) and processed for paraffin embedded 4m sections . the formalin fixed section was placed in beaker on the stir plate with " no heat " and processed through the following solutions for 30 minutes in each solution . 30% ethanol , 50% ethanol , 75% ethanol , 80% ethanol , 95% ethanol , 100% ethanol , and xylene . the tissue was blotted on paper towels and placed in melted paraffin ( 58 to 60 c , fisher paraplast paraffin ) for 30 minutes . the tissue was embedded in molds using surgipath blue ribbon paraffin , embedded tissue was cooled to room temperature . xylene for 3x5 minutes ( 3 times for 5 minutes ) , 100% ethanol for 3x5 minutes , 95% ethanol for 1x5 minutes , 70% ethanol for 1x5 minutes , rinse in running tap water for 3 minutes . antigen retrieval with heat induced epitope retrieval immerse slides in 1x citrate buffer ( thermo scientific - ap9003 - 500 ) diluted in distilled water in a glass beaker . boil for 15 minutes on a hot plate ( make sure sections don"t fall off the slide ) . cool the solution for 30 minutes at room temperature . rinse the slides with 1x pbs for 3x5 minutes . inhibition of internal peroxide immerse the slides in methanol ( fisher scientific - a-452 - 4 ) with 0.3% hydrogen peroxide ( fisher scientific- bp2633 - 500- diluted in distilled water ) in a glass beaker for 15 minutes . rinse in 1x pbs for 3x5 minutes . blocking cover the tissues with 10% normal goat serum . transfer the slides in a humid box and incubate for 1 hour at room temperature . primary antibody sections were incubated overnight at 4c with primary antibody at following concentrations : human specific caspase-3 ( 1:1,000 , r&d systems , af835 ) , ki67 ( 1:1 , dako , 15626 ) diluted with 1x pbs . secondary antibody reaction cover the tissues with 2 - 3 drops of hrp labeled secondary antibody ( envision systems ) . put slides in a humid box and incubate for 1 hour at room temperature . detection develop for the chromogen dab kit ( vector laboratories - sk-4100 ) for detection of primary antibody following the manufacturer 's protocol . counter staining immerse the slides with hematoxylin ( 10 - 15 seconds , make sure don"t overrun dab signal ) dehydration immerse the slides in following order , 70% ethanol for 5 minutes , 95% ethanol for 5 minutes , 100 % ethanol for 3x5 minutes , xylene for 3x5 minutes . cover slip the slides with permount mounting reagent ( fisher scientific - sp-15 - 100 ) . images were taken using olympus fluorescence microscope ( dp-72).3.11 ) . in all experiments , specific labeling the patients underwent the first surgery without prior chemotherapies including temozolomide ( tmz ) . the t1-weighted image of mri with gadolinium enhancement in figure-1a demonstrated an enhanced tumor in the right frontal lobe before surgery . the surgical tissues were sent to the department of pathology for the clinical diagnosis purpose , and the remaining specimens were processed to the tissue procurement under the approved institutional review board ( irb ) protocol at the ohio state university medical center . hematoxylin and eosin ( h&e ) staining demonstrated the presence of necrosis , pseudopallisading cells , and microvascular proliferation ( figure 1-c ) . thus , these tumors were histopathologically diagnosed as gbm . of note , tumor explants following incubation without tmz up to 48 hours maintained the cytoarchitecture of gbm .in contrast , with incubation for 72 hours or longer , we noticed the increased number of condensed nuclei in the specimens , suggesting some of the tumor cells starting to undergo apoptosis . as a result , tumor tissues following longer incubation contained patchy regions that lost tumor cells , which were preferentially observed at and around necrotic areas ( data not shown ) . in order to investigate if these tumor explant samples can reliably be utilized for the purpose of drug efficacy test , we tested the effect of tmz treatment a recent study indicated that intratumoral injection of tmz has more potent effect on growth control of malignant glioma than that of the systemic administration of this drug . following incubation for 16 hours , these explants were embedded with paraffin and serial sections were prepared for staining . immunohistochemistry of tmz - treated gbm tissues demonstrated a substantial reduction of ki-67-positive tumor cells in comparison with the control samples . in turn , immunohistochemistry with an apoptosis marker , caspase-3 , did not yield any significant difference between tmz - treated glioma specimens and the control samples ( figure-3 ) . treatment effect with tmz was further characterized by combining this explant assay together with either in vitro culture or flow cytometry . specifically , we sought to determine the effect on stem cell - like tumor cells ( scltc ) . therefore , following intratumoral treatment with tmz , we performed sphere forming assay and flow cytometry of these tumor explants . the tmz - treated specimens were dissociated into individual single cells and these single cells were seeded in a low density ( 1 cell per microliter or lower ) in 96-well plates in serum - free medium supplemented with bfgf and egf . in the control group , given that sphere formation is a property of scltc , alterations in the number of tumor spheres by a drug treatment indicates the effect on scltc . similarly , flow cytometry of the dissociated tumor explants with a cell surface marker , cd133 , was carried out to verify the effect on scltc . if scltc in heterogeneous tumor cells in gbm are selectively eradicated by a drug treatment , one might predict that flow cytometry should detect decrease of the cd133-positive fraction by treatment ( data not shown ) . figure-2b shows dissection of tumor block into 10 mm small pieces with the help surgical blade . immunohistochemistry of gbm tissue blocks injected with dmso or tmz with activated caspase-3 and ki67 . there is a gap between the drug efficacy in the current pre - clinical experimental models and the efficacy in patients . more specifically , in the brain tumor research field , novel and reliable methods are required that would help filling the existing gap between the drug evaluation with the current methods and the efficacy in patients . the described assay in this study is an additional asset , if not a solution , to facilitate filling the discrepancy of the experimental data and outcome of affected patients . in vitro cell cultures preferentially expand certain tumor cell types regardless of the culture conditions , and represent only a subpopulation of the entire tumor . in addition , genetic and phenotypic transformation of the artificial cell expansion occurs and is inevitable with the long - term cell cultures . one of the major hurdles to treat malignant glioma is the heterogeneity of tumor cells , both within a single tumor and between tumor samples . therefore , selective enrichment of a certain population of tumor cells , regardless of one type or another , may not be an appropriate means to determine efficacy of any chemotherapeutic agents on heterogeneous tumor cells . any animal model of brain tumors derived from a subpopulation of tumor cells shed lights on drug efficacy on a subpopulation , but not the entire tumor . several limitations , on the other hand , still remain in this tumor explant method . malignant tumor cells are considered to acquire resistance to most , if not all , therapies over time , initial control of the short - term tumor cell growth may not be reflected by the long - term patient prognosis , as was recently reported with an anti - angiogenic agent , bevacizumab . thus , improvement of the protocol for this explant assay to preserve tissues for a longer period is required with further investigations . another question is a specific effect of a tested drug on scltc in the tumor . given that scltc are relatively resistant to the current therapies for malignant glioma , identification of novel anti - cancer drugs that potently eradicate scltc we currently seek to combine this explant assay with the subsequent in vitro experiments , such as neurosphere forming assay ( data not shown ) . we expect to learn more about the effects , if any , of a drug candidate on scltc through these combined assays . lastly , using small blocks of tumor samples may not reflect the entire tumor cell populations , as is the case with the conventional tumor cell lines or primary cultures from surgical specimens . these issues aside , preserving tumor stroma , including the vascular niche , is helpful in characterizing the environmental factors for tumor cells . therefore , this assay may have potential to evaluate any therapeutic strategies under a more physiologically relevant condition . here , we established an assay for drug efficacy testing with explants of surgical specimens of gbm . in fact , with the tested surgical specimens , we found that a direct injection of tmz reduces proliferation in the gbm samples . this tissue explant method is theoretically applicable to other solid cancers and provides asset to determine drug efficacy on a patient 's tumor , which will hopefully help us avoiding another failure in clinical trials for cancers .

the current therapies for malignant glioma have only palliative effect . for therapeutic development , one hurdle is the discrepancy of efficacy determined by current drug efficacy tests and the efficacy on patients . thus , novel and reliable methods for evaluating drug efficacy are warranted in pre - clinical phase . in vitro culture of tumor tissues , including cell lines , has substantial phenotypic , genetic , and epigenetic alterations of cancer cells caused by artificial environment of cell culture , which may not reflect the biology of original tumors in situ . xenograft models with the immunodeficient mice also have limitations , i.e. , the lack of immune system and interspecies genetic and epigenetic discrepancies in microenvironment . here , we demonstrate a novel method using the surgical specimens of malignant glioma as undissociated tumor blocks to evaluate treatment effects . to validate this method , data with the current first - line chemotherapeutic agent , temozolomide ( tmz ) , are described . we used the freshly - removed surgical specimen of malignant glioma for our experiments . we performed intratumoral injection of tmz or other drug candidates , followed by incubation and analysis on surgical specimens . here , we sought to establish a tumor tissue explant method as a platform to determine the efficacy of novel anti - cancer therapies so that we may be able to overcome , at least , some of the current limitations and fill the existing gap between the current experimental data and the efficacy on an actual patient 's tumor . this method may have the potential to accelerate identifying novel chemotherapeutic agents for solid cancer treatment .

Protocol 1. Preparation of media 2. Tissue processing 3. Immunohistochemistry 4. Representative Results: Discussion Disclosures

PMC2106837

zebrafish exhibits many qualities that are essential in a good genetic model : relatively small size for vertebrates , high fecundity , reasonably short generation time , low maintenance costs , amenability to large - scale saturating mutagenesis screening , availability of mutants , genetic maps , and a sequenced genome . however , the lack of some classical tools in genome manipulation has been a serious drawback . in recent years , several transposable elements from heterologous hosts ( tc3 , mariner , tol2 , sleeping beauty , frog prince , and ac / ds ) have been successfully applied in zebrafish [ 1 - 6 ] . all of these ' cut - and - paste ' transposon vectors are designed to operate as two component systems : a non - autonomous element that inserts into the genome of the host and a transposase that catalyzes transposition of the non - autonomous element . a non - autonomous element can carry a cargo inserted between the two end sequences that are required in cis for transposition . the transposase is usually supplied in the form of mrna by microinjection into fertilized eggs to induce transposition of the non - autonomous element . the ease of microinjection in fish is advantageous ; the injected transposase mrna is degraded some hours after injection , and new insertions of the non - autonomous element in the genome remain immobilized . the choice of many transposon vectors provides zebrafish biologists with a plethora of possibilities , but it also raises the issue of which to use and when . the tc3 element from caenorrhabditis elegans and the mariner ( mos1 ) element from drosophila mauritiana however , since the initial reports , no further developments using these transposons have been described in the literature . two transposable elements of fish origin , tol2 from medaka ( a member of the hat [ hobo / ac / tam3 ] superfamily ) and sleeping beauty ( a synthetic member of the tc1/mariner superfamily ) , have both become widely used in the past few years ( table 1 ) [ 7 - 12 ] . recently , a transposable system from plants has been added to this arsenal . the modified maize ac / ds elements are effective transformation vectors and produce high genomic ds transposition and re - transposition rates in zebrafish ( table 1 ) . reported performance of various transposable elements in zebrafish the combined size of 5 ' and 3 ' cis sequences of the element . the size of the nontransposon dna fragment confined between the 5 ' and 3 ' cis sequences ( excluding the letter ) . all transposon - mediated transgenesis data were produced in an essentially similar experimental setup . in each case the transposon dna and the transposase rna were co - injected into fertilized zebrafish eggs . germline transgenesis was calculated as the percentage of founders that produced green fluorescent protein ( gfp)-positive offspring among the total number of founders screened ( shown in brackets ) . except for a few cases , indicates that no reporter gene was used ; transgenic offspring was identified using polymerase chain reaction ( pcr ) . '' indicates that the number included those expressing gfp reporter and those that were pcr - positive but did not express detectable amounts of gfp reporter . in these reports the transposase rna was injected into fertilized eggs of a transgenic fish carrying a single transposon insert in its genome . the genomic re - transposition rates were calculated as the number of founders that produced offspring with novel enhancer trap patterns distinct from the pattern of the founder . , it appears that sleeping beauty produces lower transgenesis rates and is more sensitive to size of cargo fragments compared with tol2 and ac / ds ( table 1 ) . the tol2 and ac / ds systems produce the highest transgenesis rates reported to date , and they are capable of carrying large cargo fragments without significant reduction in activity . both systems can generate multiple insertions that are advantageous for insertional mutagenesis . on the other hand , working with multiple insertion lines and maintaining them can be cumbersome . furthermore , highly active transposons can undergo multiple excision - insertion events , leaving behind the untagged footprints and genomic rearrangements . it is surprising that despite a huge phylogenetic distance between hosts , the ac / ds system performs as well in zebrafish as in plants . moreover , transposition activity of ac / ds in fish is comparable to that of the fish - derived member of the hat superfamily tol2 ( table 1 ) . the ac / ds system has been utilized in many plant species , yeast , and now in vertebrates , which is the widest host range demonstrated for any transposon . these facts strongly suggest that members of the hat superfamily are probably the most versatile cut - and - paste transposons , and can be broadly utilized in genetic manipulation of various organisms . this makes hat elements the best candidates for introduction into new species that do not yet have established transgenesis and insertional mutagenesis techniques . different insertion preferences produced by different transposable elements can allow better distribution of insertions throughout the genome . the absence of cross - activation between different transposons permits independent sequential use of several elements within the same animal and can be useful for various applications . for example , one can envision using one transposon to generate transgenic reporter lines for any given cell type of interest , and these lines can subsequently be mutagenized using a different transposon to create a bank of mutations affecting that particular cell type . the simplicity and the ease of use , and the ability to carry complex cargo fragments , combined with high cargo capacity , makes transposons superior to retroviral vectors for fish transgenesis . vertebrate genes contain disproportionately large introns compared with exons . therefore , most random insertions would not directly disrupt coding sequences . in some cases such insertions can be mutagenic by affecting the regulatory sequences , causing mis - expression , or they may result in aberrant splicing or premature termination of transcription . however , such events often cause hypomorphic mutations , and the null alleles are assumed to occur rarely . several approaches have been proposed to select for insertions within genes and to enhance the chances of disrupting gene function . a classic gene trap vector ( sometimes referred to as 5 ' gene trap ) harbors a splice acceptor site upstream of a promoterless reporter . when inserted into an intron of a transcribed gene it can cause abnormal fusion transcripts and expression of the reporter gene under regulation of the promoter of the gene into which it is inserted . because gene trap vectors target introns , they are effective in species with large introns such as vertebrates . however , the rate of alternative splicing through the splice acceptor sequence of the gene trap cassette can be insufficient to prevent fully the synthesis of the original transcript , resulting in generation of hypomorphic alleles or no detectable effect on gene function . multiple splice acceptor sequences and multiple transcription terminator sequences can be introduced into gene trap vectors to improve their mutagenicity and tagging efficiency . another drawback of 5 ' gene trap is that only insertions in transcriptionally active genes are selected . genes that are expressed at low levels or are not expressed during the stages observed in the screen remain undetected even if a tagged gene is successfully inactivated by the gene trap . to circumvent this , polya trap vectors have been designed to tag genes regardless of their transcription status . a basic polya trap vector ( sometimes termed 3 ' gene trap ) generally harbors a promoter driving the transcription of a reporter gene , which has no polya signal but a downstream 3 ' splice donor sequence . such reporters normally produce unstable transcripts , which after successful splicing are polyadenylated using polya signals of the tagged gene . this strategy combines the mutagenic capacity of 5 ' gene trap with the high trapping capacity of polya trap vectors . the ' gene - breaking ' transposon vector developed by sivasubbu and coworkers harbors a 5 ' mutagenicity cassette and a 3 ' polya trap cassette in the same transposon vector . the 5 ' mutagenicity cassette produces strong termination of transcription by combining an effective splice acceptor sequence with a polya signal of ocean pout antifreeze protein . to date , only a few examples of successful gene inactivation using gene trap vectors have been reported in zebrafish . unbiased systematic studies using a statistically significant number of tagging events are required to estimate the actual mutagenic ability of the various gene trap designs and to compare it with the mutagenicity of transposon insertions carrying simple reporters or enhancer traps . transposon vectors can also be designed to screen for gain - of - function mutations by random activation and/or over - expression of genes . in these screens , usually referred to as ' activation tagging ' or ' modular mis - expression ' , transposons are equipped with enhancer or promoter sequences that can induce transcription of the endogenous gene adjacent to the insert . several laboratories have begun testing these tools in zebrafish , but there are no published reports yet . if a transposon insertion residing inside an intron is found to be nonmutagenic , then such a transposon can potentially be re - mobilized in order to produce more insertions in the same gene or to generate flanking deletions . various transposons preferentially re - transpose to nearby chromosomal sites ( for example ac / ds in plants , p - element in drosophila , and sleeping beauty in mouse ) . several elegant approaches utilize this ability of transposons to inactivate closely linked genes ( figure 1 ) . ( a ) regional mutagenesis using gene trap elements ( for simplicity , only a 5 ' gene trap is illustrated ) . here a ' jumper ' element carrying a selection marker ' a ' ( for example , green fluorescent protein under regulation of a constitutive promoter ) is inserted between an open reading frame of a marker gene ' b ' ( for example , red fluorescent protein ) and a suitable promoter . when the jumper element is excised , the expression of the ' b ' is switched on . animals carrying an empty donor site and retaining the jumper element can be analyzed by polymerase chain reaction ( not shown ) . ( c ) regional mutagenesis from a launch pad combined with site - specific recombination system ( cre / lox in this case ) . the system is a modification of the method shown in part b but the carrier and jumper elements both carry loxp sites . after local re - transposition of the jumper element the region between the loxp sites is deleted or inverted according to the orientation of loxp sites using cre recombinase . ( d ) selecting flanking deletions using flanking marker recombination ( from the method of p induced male recombination in drosophila ; see text for references ) . this approach requires two closely linked markers ( a and b ) around the donor site . the transposon is usually retained at one side of the deletion . this approach can detect the same events as the methods shown in parts c and d but no additional markers are required . the animals that harbor deletion events can be identified by loss of one flanking marker , whereas retention of the other marker shows presence of the donor site . because not all offspring from a founder will harbor re - transpositions , it is beneficial to have a selection scheme for the transposition events . one simple approach is to use a genomic insertion of a gene trap transposon as a donor , and select for gene trap events ( figure 1a ) . a similar selection principle was successfully utilized in the mouse using the sleeping beauty ( sb ) transposon by keng and coworkers . they used two unique donor sites containing multiple concatemeric copies of the sb element , a feature that ensured high re - transposition rates . the reporter gene carried by the sb element in these donor sites was silenced , and its expression was activated when re - transpositions caused gene trap events . the authors demonstrated high efficiency of this approach for region - specific saturation mutagenesis , producing insertions in all genes within a 4 megabase region surrounding the donor site . the selection scheme shown in figure 1a can only detect transposition events that cause detectable reporter gene expression . a more effective strategy for selecting re - transposition events uses a combination of two selection markers : one to detect the excision events and another to retain the re - transposed element ( figure 1b ) . a ' carrier ' element harbors a ' jumper ' element and an excision marker . the ' carrier ' is used to generate insertions in the genome that are subsequently used as the donor sites for transposition of the ' jumper ' element . in plant genetics , such donor sites , usually called ' launch pads ' , have successfully been used to saturate specific regions of the genome with insertions . because zebrafish exons are small , the mutagenesis efficiency of this approach is expected to be low . arming the jumper element with an additional ' another possible approach combines the local re - transposition from a ' launch pad ' with a site - specific recombination system such as cre / lox or flp / frt ( flipase recombination enzyme / flipase recognition target ) in order to produce flanking deletions or inversions ( figure 1c ) . in this method , the carrier and the jumper elements both harbor loxp sites . after the local re - transposition of the jumper element , a fragment between the loxp sites is deleted or reversed according to the relative orientation of the loxp sites . in plants this approach was demonstrated using a combination of the cre / lox system , t - dna as the carrier , and ds element as the jumper [ 33 - 35 ] . in zebrafish , there are at least three heterologous transposon systems that can be used in various combinations with each other . tol2 and ac / ds can both be used as carrier elements because of their large insert capacity . upon mobilization , a transposable element can generate deletions , inversions , and other rearrangements around the donor site . when two insertions of the same transposon are found at different sites on the same chromosome , deletions and inversions of the region between the two insertions can be recovered . two trans - heterozygous insertions ( located at different positions on homologous chromosomes ) have also been used to generate deletions in drosophila . p - element insertions are frequently used as starting - points to generate flanking deletions in drosophila by screening for male recombination events [ 39 - 41 ] or ' imprecise excision ' events . the former strategy ( figure 1d ) generally relies on the lack of male meiotic recombination in drosophila . in this approach , recombination between two flanking markers in the male germline occurs only when the p - element undergoes a transposition process called ' hybrid element insertion ' , which causes frequent deletions . in zebrafish , meiotic recombination in males is also suppressed relative to that of female meiosis , especially near centromeres , but the rate of suppression is unlikely to be sufficient for effective application of this strategy . however , it is not known whether similar recombination events occur in fish and what is the frequency of long deletions . when a transposable element is excised , the double - strand break generated during the excision is sometimes repaired imprecisely , generating flanking deletions or other rearrangements . although , the actual mechanism of ' imprecise excision ' is unclear , it should be distinguished from the ' hybrid element insertion ' , which leaves the transposon at the deletion site ( figure 1d ) . because large deletions ( several kilobases ) are expected to occur at low rates , this strategy may be feasible only when the insert is found very close to an exon of the target gene or when there is a convenient selection marker , which can be used to detect deletion events . a compound element consists of a carrier element that harbors a ' deleter ' element inside , flanked by a pair of visual markers ( for instance , green fluorescent protein [ gfp ] and red fluorescent protein [ rfp ] ) . during primary screening , the genomic insertions of the compound element are produced using the transposase for the carrier element . if the insert is found close to the gene of interest or if it lands in an intron causing no effect on gene function or hypomorphic mutation , then such insertion can be used as a starting point to produce flanking deletions by activating the deleter element . in this scheme , there is no need for additional genetic markers ; deletions on either side of the original insertion can easily be identified by the absence of one of the flanking markers , whereas the other marker shows the presence of the donor site . a similar selection scheme with a single flanking marker was utilized in plants using the ds transposon as a deleter . the strategies for generating flanking deletions illustrated in figure 1c , f both have advantages and disadvantages . the strategy shown in figure 1c requires two steps ( re - mobilization and excision ) to produce deletions , whereas the simpler strategy shown in figure 1f needs only one step , thereby reducing the experimental time for at least one generation . on the other hand , the strategy shown in figure 1c provides a platform for inducible and tissue / cell - specific gene inactivation . until now there have been no reliable data published on the distribution preference of transposable elements in fish therefore , to evaluate the feasibility of the approaches described above , it is important to determine the level of preference to insert to linked positions and to determine the frequency and extent of the flanking deletions . saturating the genome with random insertions ( obtaining at least one effective hit in every gene ) requires generation of a very large number of insertions , significantly larger than the total number of genes in the genome . it is problematic to generate , analyze , maintain , and maximize use of such huge collections . in the classical mutagenesis screens , this problem is addressed in two steps : animals are heavily mutagenized with highly active mutagens such as enu ( n - ethyl - n - nitrosourea ) or retroviruses , so that every founder carries multiple mutations ; and such collections are screened for the visible phenotypes , and only the mutant strains are retained and analyzed [ 49 - 51 ] . the main disadvantage of the phenotype - based mutant screening ( forward genetics ) is that only a relatively small number of genes are targeted , and mutations that do not cause obvious phenotypes are ignored or discarded . in the post - genome era , the most common problem is gaining insight into the function of genes that have been identified by sequencing but for which mutant information is lacking ( reverse genetics ) . therefore , reverse genetics approaches to mutant screening must operate with a complete collection of random mutations representing all genes , regardless of the phenotypic manifestation . until recently , only one reverse genetic approach has been implemented in zebrafish to obtain mutations in the gene of interest . this approach utilizes tilling ( targeting induced local lesions in genomes ) and re - sequencing of enu - mutagenized fish for target - selected screening of point mutations in the gene of interest . although this approach is very powerful , considerable screening efforts are required each time to obtain mutations in every new gene . furthermore , this method of mutagenesis generates predominantly missense mutations , which may or may not result in phenotypes . an alternative approach to reverse genetic mutagenesis screening was recently pioneered by znomics , inc . ( portland , or , usa ) , who have produced a large - scale library of retroviral insertions in zebrafish . the company has been identifying the locations of retroviral insertions from cryopreserved sperm samples containing , on average , 25 insertions per sample by sequencing the flanking dna adjacent to the insertions . with 100,000 insertions already identified , znomics hopes to map a total of half a million insertions . thus , their bank of retroviral insertions promises to be a valuable resource for the zebrafish research community . however , the actual efficiency of the znomics screen and the utility of the strains remain to be determined . despite the recent vector improvements , the frequency of transposon insertions still remains lower than that of retroviral insertions ( table 1 ) . it is therefore important to determine whether transposon vectors have the potential to complement the retroviral projects in the field of large - scale insertional mutagenesis . one way to increase the number of transposon insertions per germline is to use the donor lines carrying multiple inserts for re - transposition . the distribution of retroviral insertions ( or any other known insertional mutagen ) is not absolutely random . thus , a single insertional mutagen ( retrovirus ) would be inefficient in hitting genes at ' cold spots ' , but instead it will produce in vast excess insertions in ' hot spots ' when trying to achieve genome - wide saturation . the presence of hot and cold spots narrows the limits for efficient use of a single insertional mutagen in saturation mutagenesis screens . in order to achieve saturation more productively , it is worthwhile to launch several parallel screens of smaller scale using different insertional mutagens , rather than using a single agent alone . in this respect , having an arsenal of several transposable elements is an advantage . because vertebrate genomes contain only a small proportion of coding sequences , the majority of retroviral insertions ( or other random insertions ) are found either in the intergenic regions or inside introns . in case of retroviral mutagenesis , the only way to increase the number of exon hits is by significantly increasing the number of insertions . unlike retroviral insertions , transposons can be re - mobilized in order to obtain exon insertions or to generate flanking deletions ( figure 1 ) . re - transposition also offers a unique approach to reducing the size of insertion libraries - the ' launch pad ' strategy . a relatively small collection of the launch pads ( figure 1 ) regularly distributed throughout the genome must be generated and deposited in a stock center . then , even a moderate sized laboratory should be able to use a launch pad that is closest to their gene of interest for region - specific saturation mutagenesis to generate insertions in the target gene . although thousands of transgenic fish lines can be created , stored , and recorded in a database in individual laboratories , the long - term maintenance of such collections and wide public distribution of the materials by the same laboratories appear problematic . because large - scale projects in the field of functional genomics promise vast resources for the scientific community , the necessary funding can usually be obtained . in contrast , it is difficult to raise the additional funds necessary to further maintain and distribute the transgenic lines , and therefore the produced materials and data often remain largely unutilized and eventually wasted . other sensitive issues such as authorship , sharing of intellectual property rights , and oppressive material transfer agreements , among other factors , are common and can significantly hinder progress . operating on a cost - recovery basis may present a solution , but recovery from the cryopreserved stocks , quality control measures such as prevention of material loss , and insert confirmation can significantly increase running costs . recently , a private company ( znomics , inc . ) produced a large collection of retroviral insertion strains , which are available for purchase on a per strain basis . however , it is early to speculate whether demand for the transgenic zebrafish lines will be large enough to extend this model to projects of smaller scale . the distribution problem is unlikely to be resolved without a dedicated stock center that can take on these responsibilities . the success of large - scale functional genomics projects in other model organisms was achieved largely because of centralization . for example , arabidopsis stock centers maintain hundreds of thousands of genotypes produced by insertional mutagenesis projects [ 57 - 60 ] , and large - scale collections of transposon insertions in drosophila were also made available through stock centers . the existing zebrafish stock center will need to scale - up its capacity in order to accommodate many thousands of new samples that might be generated very soon by several laboratories . at the present time , there appears to be some variability from laboratory to laboratory in cataloging transposon lines . because various transposon screens are designed for different purposes ( mutagenesis , enhancer and gene trapping , driver lines , and so on ) , it is important to develop a set of standard requirements for the lines that are deposited at the stock center . these requirements should define the alternative descriptions to be provided with each line that would allow a searchable database to be established . at the same time , these requirements should not deter the community from depositing their collections into the stock center . arguably the simplest way to characterize this information can be used to map the insertions along the identified genome sequence ( znomics model ) . alternatively , flanking sequences can be used to build - up the blast dataset , which would allow checking for the availability of insertions inside any dna fragment using the blast search program . it is much more difficult to produce comprehensive expression pattern information , and to systematize and organize this information into a searchable database . high - throughput reverse genetics screening using transposable elements can generate a huge resource for zebrafish research , but the actual benefit of large - scale projects will depend on the subsequent utilization of this resource . this article has been published as part of genome biology volume 8 , supplement 1 , 2007 : transposons in vertebrate functional genomics .

the recent introduction of several transposable elements in zebrafish opens new frontiers for genetic manipulation in this important vertebrate model . this review discusses transposable elements as mutagenesis tools for fish functional genomics . we review various mutagenesis strategies that were previously applied in other genetic models , such as drosophila , arabidopsis , and mouse , that may be beneficial if applied in fish . we also discuss the forthcoming challenges of high - throughput functional genomics in fish .

Introduction Mutagenicity of transposon insertions Mutagenesis of closely linked genes by re-mobilization of genomic transposon insertions Large-scale reverse genetics mutagenesis in fish Conclusion Competing interests Acknowledgements

PMC4890860

aptamers are short single - stranded oligomers made up of dna , rna , or peptides that are capable of binding a target ligand ( proteins , small molecules , or even living cells ) with high affinity . they are also known as artificial antibodies because in addition to binding with high affinity , they also bind with high specificity . aptamers have several advantages over antibodies , including ease and low cost of production which does not involve animals . aptamers are less immunogenic than antibodies and are already being used as therapeutic agents in humans . nucleic acid aptamers , unlike antibodies , can be selected for and used under nonphysiological conditions , such as high - salt conditions and varying ph . also , nucleic acid aptamers are able to undergo specific conformational changes that antibodies can not . for example , nucleic acid aptamer binding can be turned off by the addition of the complementary strand . additionally , nucleic acid aptamers can undergo a conformational change when binding to their target and can be used as molecular beacons , fluorescently off when unbound and on when bound . the field of aptamers is rapidly growing as is the number of applications for their use . nucleic acid aptamers are evolved from random sequences of dna / rna by a process known as systematic evolution of ligands by exponential enrichment ( selex ) . the selex procedure involves the use of the random library of dna / rna sequences being incubated with the target , followed by a partitioning step to remove unbound sequences , an elution step to recover the binding sequences , and then an amplification step to generate a library of sequences enriched for binding . the selex procedure generally takes months to complete , with a typical selection requiring 10 or more rounds before completion . also , traditional selex requires a support for the target ( magnetic beads , membranes , etc . ) to bind with . the supports themselves can be targets for selection , and often rounds of negative selection must be done to avoid aptamers for the support . use of capillary electrophoresis ( ce ) allows for selex to be performed in a much shorter amount of time due to much more efficient partitioning and without the aptamers binding to the ligand support ( the ligand flows freely in buffer , there is no support ) . in as little as one round of selection , and generally less than five rounds of selection ce - selex is a new technology first developed for use in 2004 and has yet to be commonly used . one of the main advantages to ce - selex over traditional selex is that the aptamer - target complex can be detected in the first round of selection . this early detection contrasts traditional selex , where several rounds must be done before being able to detect any dna . most ce - selex is done with laser - induced fluorescence ( lif ) to increase the detection sensitivity to the analyzed samples . using ce with lif , a laser excites fluorescently labeled samples passing through the glass capillary tube which then emits light that is captured by an on - board detector attached to the ce machine itself . we have developed a technique for selection of dna aptamers using ce but without the need for an on - board laser / detector system . the system takes advantage of real - time polymerase chain reaction ( rt - pcr ) . rt - pcr is able to sensitively detect dna - target complexes early in the selection procedure with an efficacy greater than that of traditional selex and equal to that of ce - selex with lif . we believe that this system could be beneficial for researchers that have access to ce , but do not have access to ce with lif , and are seeking to perform ce - selex . the protein that we chose to use as a target for aptamer selection was bovine serum albumin ( bsa ) . bsa is widely used for stabilization of enzymes , preventing enzymes of interest from adhering to tubes or pipettes , or as a protein comparison standard . there are several advantages to using bsa in that it is relatively stable , abundantly available from cow 's blood , and is of low cost . due to the low cost and high abundance of bsa , we chose it to serve as the protein target for our rt - pcr - coupled selection system . here , we report the isolation of a dna aptamer with specificity for bsa using the rt - pcr coupled capillary electrophoresis selection system . the target protein of interest , bovine serum albumin ( bsa ) , was purchased as a lyophilized powder through sigma - aldrich and was greater than 98% pure . the bsa was dissolved in rb1 buffer ( 50 mm tris - hcl , ph 8.2 ) and stored at 4c at a stock concentration of 1 mm . the dna library was purchased from alpha dna and contained a sequence of 5_cttctgcccgcctccttcc-(n)36-gacgagataggcggacact_3 ( 36 random nucleotides flanked by two - fixed 19 base regions used later as primers for pcr amplification ) . the protocol for selex using capillary electrophoresis ( ce ) was essentially as described earlier but with a few modifications . the initial bulk affinity assay was performed with 50 m bsa and 25 m dna in order to view any dna - protein complexes and determine the collection window . capillary electrophoresis was done using a beckman coulter proteomelab pa 800 with a photon diode array ( pda ) capable of reading wavelengths in the uv range ( 10 nm400 nm ) . separation was done at a voltage of 10 kv and with 0 psi of pressure , except that during timed fraction collection the machine automatically reaches 0.1 psi of pressure . after determination of the collection window based on the bulk affinity analysis , the first round of selection began . the initial in vitro selection procedure involved 500 nm bsa and 3.3 m dna . the dna library ( 0.3 l at 100 m ) was mixed with 0.3 l of sb3 ( 100 mm tris - hcl at ph 8.2 , 200 mm nacl , and 10 mm mgcl2 ) for a final concentration of 50 m dna library , 50 mm tris - hcl at ph 8.2 , 100 mm nacl , and 5 mm mgcl2 . this mixture was heated in the biorad icycler to 94c for 1 minute and then cooled to 20c at a rate of 0.5c per second . after the folding of the dna library , 5 l of 1 m bsa dissolved in rb1 buffer was added , and additional run buffer was added to make the final volume 10 l . this brought the final concentrations to 3.3 m dna library , 500 nm bsa , 6 mm nacl , 300 m mgcl2 , and 50 mm tris - hcl ( ph 8.2 ) . after each round of selection , fractions were analyzed through real - time pcr ( rt - pcr ) using the abi stepone plus . rt - pcr was done with two primers : the forward aptamer - amplifying primer p1 ( 5_cttctgcccgcctccttcc_3 ) and the reverse primer p2 ( 5_agtgtccgcctatctcgtc_3 ) , respectively . the primers were designed using oligoanalyzer ( http://www.idtdna.com/analyzer/applications/oligoanalyzer/ ) to limit complementarity to each other , in order to decrease nonspecific amplification of self - dimerizing primers . for amplification , 20 l of pcr mix was prepared consisting of 10 l of 2x quanta sybr green pcr master mix ( roche ) , 0.6 l of 10 m p1 , 0.6 l of 10 m p2 , 1 l of collected fraction as template , and 7.8 l h2o . following rt - pcr , the fraction containing the complex was amplified using standard pcr . pcr was done in a 100 l volume consisting of 1 l of 5 u/l ex taq polymerase from takara , 3 l of 10 m forward primer p1 , 3 l of 10 m reverse primer p2 , 10 l of 10x mg buffer ( takara ex taq ) , 8 l of 2.5 mm each dntp , and 5 l of the collected fraction from capillary electrophoresis . pcr was done using primer p1 and p2 as noted previously , except that the number of cycles for pcr amplification was based on 50% of the maximum yield as determined by rt - pcr . the biotin - labeled primer was used subsequent to pcr in order to separate the strand of interest and the nonaptamer strand after pcr . magnetic beads with streptavidin coating from bangs laboratories ( biomag nuclease - free streptavidin ) were used to bind the biotin - labeled dna . strands were separated with 10 mm naoh after three washes with wash buffer ( 10 mm tris - hcl at ph 8 with 500 mm nacl and 1 mm edta ) . post - selection dna cloning of the aptamer pool was done with the zero blunt topo pcr cloning kit ( invitrogen ) . standard pcr with unlabeled primers p1 and p2 was used to generate double - stranded dna containing the aptamer sequence , which was then blunt - end ligated into the pcr - blunt ii - topo vector that contains the kanamycin resistance gene . colonies were selected for growth on kanamycin - containing media ( kanamycin final concentration was 40 g / ml ) , and plasmid dna was isolated using the genejet plasmid miniprep kit ( fermentas ) . asymmetric pcr with unlabeled primers p1 and p2 was used on the plasmid dna to predominately generate the strand of interest which was then analyzed using ce and rt - pcr . twelve colonies were pooled into a group and each group was assayed for bsa binding using ce . individual plasmids from each pooled group that showed binding were sequenced by eurofins mwg operon . based on sequencing results , additionally , mfold ( http://mfold.rna.albany.edu/?q=mfold/dna-folding-form ) was used on each candidate aptamer to identify secondary structure . potential aptamer oligonucleotides and a negative control oligonucleotide were 5 labeled with p32 -atp using t4 polynucleotide kinase ( new england biolabs ) . the negative control consisted of an oligonucleotide of the same length as the random dna library oligonucleotides ( 74 bases ) , contained the same flanking primer regions , and had a fixed sequence for its internal region 5-cttctgcccgcctccttccggtcgggcacacctgtcatacccaatctcgaggccagacgagataggcggacact-3. the internal region was chosen using a random dna sequence generator with a specified gc content of 50% ( http://www.faculty.ucr.edu/~mmaduro/random.htm ) . the binding conditions for the initial emsa were done by adding equal amounts of sb3 buffer to the labeled oligonucleotides ( 20,000 cpm equivalent ) and incubating at 94c for 1 minute in a pcr machine and a gradual cooling to 20c at a rate of 0.5c per second ( total time taken is ~4 minutes ) . bsa stock of 1 mm was made in rb1 buffer ( the run buffer used in the ce - selex protocol ) . different dilutions of bsa , as required for assessing aptamer binding , were also made in rb1 buffer . with fixed concentration of the p32-labeled candidate aptamer , the concentration of the ligand ( bsa ) was varied from 50 to 800 m . the buffer used for binding was a 6x buffer consisting of 600 mm ammonium chloride , 300 mm potassium chloride , 30 mm sodium chloride , 120 mm tris - hcl ph 7.5 , 30% glycerol , and bromophenol blue ( bpb ) 0.25% . the reaction was incubated at room temperature for 30 minutes after which 1.5 l of 10x loading buffer ( 200 mm tris - hcl ph 8.2 , 50% glycerol , and bpb 0.25% ) was added and the reaction was left on ice for 515 minutes before loading into the gel . minigels were made with stock solutions of 40% acrylamide / bis - acrylamide ( 29 : 1 ) , 1x tris - borate edta ( tbe ) , 10% ammonium persulfate ( aps ) , and tetramethylethylenediamine ( temed ) . prerun was done in 1x tbe buffer for 1 hour prior to loading of the samples . the samples were run at 150 v until the bromophenol blue dye reached the bottom of the gel . the radioactivity in the gel was analyzed by phosphor imager ( molecular dynamics - typhoon trio imager ) . apart from the above - mentioned 6x buffer , an additional 5x binding buffer containing 100 mm tris - hcl ph 8.5 , 250 mm nacl , 10 mm mgcl2 , 10 mm zncl2 , and 10% glycerol was added in the incubation mixture . furthermore , the radiolabeled oligonucleotides were added directly to the incubation mixture and not heated to 94c as done previously . samples were left on ice for 515 minutes before being loaded into the 4% nondenaturing gels which had been prerun for 1 hour in 1x tbe as described previously . increasing concentrations of the specific unlabeled oligonucleotide were added during incubation of the bsa - aptamer complex ( conditions described previously ) . three different amounts ( 1.25 , 2.5 , and 5 pmol ) were used . complex formation was allowed to go on for 30 minutes at room temperature before the radioactively labeled oligonucleotide was added and the incubation was continued for another hour and 30 minutes . in the control sample , all the conditions were similar except for the absence of the unlabeled competing oligonucleotide . emsas were set up using 4 g of the anti - bsa polyclonal antibody ( obtained from invitrogen ) . essentially , the antibody ( 4 g ) was mixed with bsa ( 500 m ) along with the 5x binding buffer and left on ice for 1 hour . the radioactively labeled i1 - 5 aptamer and the 6x buffer were added next and the incubation continued for 1 hour and 30 minutes at room temperature before stopping the incubation by leaving the samples on ice for 515 minutes . the general scheme of rt - pcr coupled ce - selex is shown in figure 1 . to test the concept that aptamer selection with ce - selex and rt - pcr could be feasible , we first began by calibrating the capillary electrophoresis ( ce ) machine . the ce machine used , the proteomelab pa 800 , is incapable of running solutions that contain high concentrations of salts . due to this limitation , our buffers had to be tested to find the proper salt balance to ensure that the machine did not fail but at the same time had enough salt to stabilize our aptamer structures . therefore , the buffer condition used for the initial step of folding the dna library was done in a high - salt buffer ( 50 mm tris - hcl at ph 8.2 , 100 mm nacl , and 5 mm mgcl2 ) followed by incubation and running the folded dna library in low - salt concentrations ( 50 mm tris - hcl at ph 8.2 , 6 mm nacl , and 300 nm mgcl2 ) to ensure both proper folding and running of the dna library . although the low - salt problem may have excluded many potential binders to bsa , low - salt concentrations actually mirror the physiological conditions more accurately since the cellular level of magnesium is only ~1 - 2 mm . after optimizing for the salt concentrations , we used ce and ran a large amount ( 100 m ) of bsa alone in order to visualize the free protein peak run timing . next , we performed the same analysis using a large ( 3 m ) amount of dna alone . once the individual free protein and free dna run times were established , we proceeded to combine bsa and dna for a bulk affinity analysis ( figure 2 ) . the bulk affinity analysis allowed us to visualize peaks for the free bsa and the free dna in combination , and this information was used to determine the collection window . the ce machine used was the proteomelab pa 800 from beckman coulter , which did not have laser - induced fluorescence ( lif ) . to sensitively detect protein - dna complexes between the free dna and free protein , we relied on rt - pcr . the collection window started from the end of the free - protein peak to the start of the free - dna peak ( figure 3(a ) ) . the seven fractions , instead of just one fraction , allowed us to analyze with greater precision the region of the dna - protein complex . unlike the bulk affinity assay in which 100 m bsa was used , for the selection , the concentration of bsa was reduced to 500 nm in order to increase the stringency of selection . in the first round of selection , the initial collected fraction of dna detected by rt - pcr needed 36 cycles of amplification to reach 50% of the maximum yield , the midpoint cycle , of pcr ( figure 3(a ) ) . the second fraction analyzed had a higher amount of dna compared to the first fraction collected , taking only 34 cycles of amplification to reach the midpoint cycle . the amount of dna collected for the third and fourth fractions was lower than that of the second fraction collected . the fifth fraction collected showed a marked increase in dna indicative of the beginning of the free - dna peak and so this fraction was not used . the pattern detected by rt - pcr implied a dna - protein complex present in the second fraction collected since this fraction was collected by ce after the free protein peak , but well before the free - dna peak . the collected dna containing the supposed dna - protein complex was rt - pcr amplified using primers flanking the internal random sequence . the forward primer , p1 , amplified the aptamer - containing strand of interest , while the reverse primer , p2 , amplified the nonaptamer complementary strand . in a previous protocol to select dna aptamers , it was shown that overamplification of the random library leads to formation of nonspecific products , therefore the random library was only amplified to ~50% of the maximum yield as measured by rt - pcr . after rt - pcr analysis revealed the optimum number of cycles to amplify the collected dna , a regular pcr using more of the collected dna was performed . in this regular pcr , the p2 primer was labeled at its 5 end with biotin while p1 had no modifications . after the pcr , the dna products were attached to streptavidin - coated beads due to the strong interaction between the streptavidin on the beads and the biotin - labeled primer p2 . after immobilization on the beads and several washing steps , the forward aptamer - containing strand was released from the complementary strand by incubation with 10 mm naoh . after this step , the binding of the new aptamer pool was analyzed using ce and rt - pcr . to assess the binding of the newly generated aptamer pool to the target , two separate ce runs were done , one with a 200-fold molar excess of bsa used for the first round of selection ( 100 m ) ( figure 3(b ) ) and another without any bsa ( figure 3(c ) ) . based upon these ce test runs , it was clear that the second fraction collected in round one of ce - selex did show binding to bsa . the aptamer pool ( 5 l of the collected fraction ) was then subjected to another round of selection . selection continued until the fourth round ; at which point rt - pcr did not show any change in the amount of dna at the complex and we did not continue with any further rounds of selection . potential aptamers collected during the third round of selection were again amplified and then used for cloning . instead of amplifying with a biotin - labeled p2 primer , the potential aptamers were amplified with a nonlabeled p2 primer since the biotin label at the 5 end of the dna might interfere with ligation during cloning . topo blunt - end cloning was performed with the aptamer pool and colonies were selected by growth on lb plus kanamycin plates . two hundred colonies were selected and analyzed for bsa binding using ce and rt - pcr . groups of 12 colonies were combined in order to facilitate faster analysis . in order to amplify the aptamer strand from the vector with the aptamer insert , asymmetric pcr was performed using a 10-fold excess of the aptamer strand primer . four groups : i1 , r2 , g2 , and o3 showed stronger binding than the others by rt - pcr and then the individual clones from these groups were sequenced . after sequencing , in order to confirm that the potential aptamer sequences were binding to bsa , salt - free oligonucleotides containing the potential aptamer sequences were used in emsa gels . emsas work on the principle that dna bound in a dna - target complex will run slower than free dna . the free dna will appear at the bottom of the gel , while the dna bound in the dna - target complex will be shifted higher up in the gel . the potential aptamers , as well as a negative control ( described in section 1 ) , were initially screened with a set of binding conditions similar to that of the ce experiments . only those sequences that were 76 or 75 bases in length , and identical or almost identical in length to the original library length of 76 bases , were ordered and subsequently screened by emsa . the candidate aptamer sequences were analyzed in silico by using clustalw2 and mfold , but no consensus sequence or specific secondary structure between the sequences was found . of the initial group of oligonucleotides screened by emsa , the i1 group , one member of this group of potential aptamers , i1 - 5 , did bind to bsa and a distinct bound complex could be visualized at 500 and 800 m bsa in the initial emsa ( figure 4(a ) ) . also in the initial emsa , at higher concentrations of bsa ( > 500 m ) , a faint band could be seen . this band was considered a nonspecific complex because both the negative control and the i1 - 5 aptamer had this band . in this emsa , and in all subsequent emsas , the appearance of radiolabeled dna at the top of each lane , in the well , can be seen . the dna at the top of the lanes is caused due to the single - stranded nature of the dna . the single - stranded dna is capable of forming aggregates with itself and with the loading dye . the size of these aggregates prevents the dna from entering the gel and thus it remains in the well . after the initial emsa modeled after the ce experiments , binding conditions were changed to include higher salt conditions that were not possible to run with the proteomelab pa 800 . in addition to buffer conditions , we also did not subject the aptamers to the heating at 94c prior to incubation . again the potential aptamer i1 - 5 showed a bound complex using these modified binding conditions ( figure 4(b ) ) . after the initial screen for potential aptamers with the i1 group , a subsequent screen using oligos from the g2 group and the modified emsa conditions revealed several additional aptamers for bsa ( figure 5 ) . the list of the potential aptamers ' sequences ordered is shown in table 2 , among these aptamers , i1 - 5 was chosen for further characterization . only the i1 - 5 oligonucleotide was further pursued as it was the first aptamer discovered by the screen that consistently showed binding ability to bsa in the ce - selex as well as under the two different emsa conditions . to further confirm the specificity of this aptamer to bsa , a supershift assay using an antibody to bsa was performed . in the presence of 4 g of the anti - bsa polyclonal antibody , the binding capacity was reduced as seen by an appreciable reduction in the intensity of the radioactive oligo banding pattern ( figure 6 ) . this supports the idea that the anti - bsa polyclonal antibody and the bsa aptamer i1 - 5 recognize the same epitope . a similar pattern of banding was reported for the human neurofilament mrna binding to superoxide dismutase1 ( sod1 ) in a supershift assay . also , competition assays were performed by incubating bsa with an excess of unlabeled i1 - 5 aptamer of three different amounts ( 1.25 , 2.5 , and 5 pmoles ) before the addition of the labeled i1 - 5 oligo . the bsa - aptamer bound complex was abolished in the presence of higher amounts of the unlabeled competitor ( figure 7 ) . although by emsa the i1 - 5 aptamer showed low binding affinity to bsa , the cold - competitor assay , as well as the supershift assay indicated that a specific interaction was occurring between bsa and the i1 - 5 aptamer , thus supporting the effectiveness of rt - pcr coupled ce - selex . the conclusion drawn from our studies is that we have been able to generate an aptamer for bsa with appreciable specificity in a few rounds of selection from a random library of dna oligonucleotides . the protocol described here is very efficient compared to the traditional selex which takes much more time and reagents . as noted previously , traditional selex makes use of a solid support to which the target must be bound . the coupling of the target to the support is not completely efficient and often much of the target remains unbound and washed away . using ce - selex , there is no need for a solid support and because of the small size of the capillary a much smaller amount of target is required . even though ce - selex is much more efficient than traditional selex , ce - selex still requires additional equipment ( lif ) beyond the standard capillary electrophoresis machine . ce is not restricted to the isolation of aptamers , and while many labs may have a ce machine , much fewer will have one with lif . rt - pcr and lif both work under the principle of fluorescence . very sensitively and directly , rt - pcr has the potential to be more sensitive because unlike lif , which directly detects the fluorescent signal , rt - pcr can amplify the signal . by amplifying a signal undetectable by lif , dna - target complexes that would have been missed by lif taken together the efficiency , time , and sensitivity of the protocol for dna aptamer selection by coupling ce - selex with rt - pcr described here can benefit other researchers that are also interested in selecting for aptamers and would like to use ce - selex , but are unable to do so for lack of lif . bsa was chosen to test our rt - pcr - coupled selection system , but the bsa aptamer we selected may be beneficial itself . due to the high amount of bsa used in many biochemical assays , sometimes the amount of bsa present in a mixture of proteins obscures accurate readings of proteins of interest . it would be useful to have a way to deplete this unwanted bsa from a reaction . also , bsa can be allergenic and in certain situations it might be beneficial to detect small amounts of bsa contaminant present in cow 's milk . currently , antibodies to bsa provide an answer to these issues , but as previously mentioned , there are several advantages to using aptamers over antibodies .

aptamers are short nucleic acid or peptide sequences capable of binding to a target molecule with high specificity and affinity . also known as artificial antibodies , aptamers provide many advantages over antibodies . one of the major hurdles to aptamer isolation is the initial time and effort needed for selection . the systematic evolution of ligands by exponential enrichment ( selex ) is the traditional procedure for generating aptamers , but this process is lengthy and requires a large quantity of target and starting aptamer library . a relatively new procedure for generating aptamers using capillary electrophoresis ( ce ) , known as ce - selex , is faster and more efficient than selex but requires laser - induced fluorescence ( lif ) to detect the aptamer - target complexes . here , we implemented an alternative system without lif using real - time- ( rt- ) pcr to indirectly measure aptamer - target complexes . in three rounds of selection , as opposed to ten or more rounds common in selex protocols , a specific aptamer for bovine serum albumin ( bsa ) was obtained . the specificity of the aptamer to bsa was confirmed by electrophoretic mobility shift assays ( emsas ) , an unlabeled competitor assay , and by a supershift assay . the system used here provides a cost effective and a highly efficient means of generating aptamers .

1. Introduction 2. Materials and Methods 3. Results and Discussion 4. Conclusion

PMC5110360

cerebrospinal fluid ( csf ) leak is a recognized complication of spinal surgeries . the incidence of csf leak during spine surgery is 2 to 5%.1 in cases of intradural tumor removal or nerve root sacrifice , the dura is opened intentionally , thus exposing patients to the risk of csf leak . although most durotomies are repaired and most patients do not experience symptomatic csf leak , it could nevertheless potentially lead to spinal headache , formation of a pseudomeningocele , wound breakdown , and subsequent leakage of csf through the skin . furthermore , reports exist of intracranial hemorrhage associated with csf leak after spinal surgeries.2 csf leak can occur anywhere from the cervical to lumbar spine . in addition to primary closure of dura , numerous other options have been developed and are used intraoperatively in the management of a csf leak . these include the use of fibrin glue and surgical clips in minimally invasive surgeries.3 4 5 6 7 8 postoperatively , supine bed rest has been instituted to decrease the rate of csf leak . refractory csf leaks have been treated with lumbar drain placement , oversewing the incision and repeat surgery.9 10 here we review our experience at two institutions with utilizing epidural subfascial drains after intentional intraoperative durotomies to prevent csf leak . we take particular interest in cases of concurrent durotomy and arthrodesis , the latter of which is now commonly performed to enhance spinal column stability in patients with iatrogenic or pathologic spinal instability . arthrodesis and instrumentation are associated with a relatively high rate of bleeding , often necessitating drain placement to avoid postoperative hematoma or seroma , the pressure of which could cause neurologic symptoms that may require reoperation.11 12 in patients who undergo durotomies and arthrodesis , the dilemma is whether an epidural subfascial suction drain should be placed , given the potential of exacerbating the csf leak . here we present our experience at two institutions with utilization of epidural subfascial drain placement after intentional intraoperative durotomies . a retrospective review was performed to identify patients undergoing spinal surgery over a 4-year period at university of california , los angeles and university of california , san francisco medical centers . the inclusion criteria include ( 1 ) known intentional durotomy with egress of csf , ( 2 ) intraoperative placement of subfascial epidural drains , ( 3 ) complete documentation of daily drain output available via electronic medical record , and ( 4 ) at least one postoperative follow - up visit . medical records were surveyed for patient age and sex , medical comorbidities , duration of drain placement , daily drain output , perioperative laboratory data , and postoperative complications . the primary outcomes of interest were the development of postoperative csf cutaneous fistula or symptomatic pseudomeningocele formation . following the intradural component of the case , the durotomy was closed with running 40 nurolon or 50 prolene ( ethicon , somerville , new jersey , united states ) to achieve primary watertight closure . one layer of either tissel fibrin glue ( baxter , deerfield , illinois , united states ) or duraseal ( covidien , minneapolis , minnesota , united states ) was applied to the primary closed durotomy site . valsava maneuvers up to 40 mm h2o were performed at the surgeon 's discretion but were not always performed . a medium or 19-french channel davol drain ( bard davol inc . , covington , georgia , united states ) was placed in the epidural space at the site of durotomy and tunneled out through a separate incision distal to the closed wound . the subcutaneous tissue and skin were then reapproximated in standard fashion utilizing interrupted 20 vicryl sutures ( ethicon ) and surgical skin staples ( covidien ) or 40 subcuticular sutures , respectively . the patients were placed in bed rest with the head of bed flat for 48 hours . the patients who underwent simultaneous arthrodesis were placed in external rigid orthotics for a total of 6 weeks . if there was evidence of leakage from the wound , suction was then adjusted to full - bulb suction . the drains were discontinued after daily output became negligible ( < 30 ml/24 h ) or 3 to 5 days following surgery when the incision appeared well healed ( even if output was still high , > 100 ml/24 h ) , prior to discharge . if output remained high prior to drain discontinuation , the drain was clamped first and the wound site evaluated for csf leak . if there was no evidence of csf leak , then the drains were removed . of note , a figure - of - eight stitch was placed at the drain exit site after drain removal if csf leaked out of the drain site . patients were clinically evaluated and the wound sites were examined at follow - up visits . a retrospective review was performed to identify patients undergoing spinal surgery over a 4-year period at university of california , los angeles and university of california , san francisco medical centers . the inclusion criteria include ( 1 ) known intentional durotomy with egress of csf , ( 2 ) intraoperative placement of subfascial epidural drains , ( 3 ) complete documentation of daily drain output available via electronic medical record , and ( 4 ) at least one postoperative follow - up visit . medical records were surveyed for patient age and sex , medical comorbidities , duration of drain placement , daily drain output , perioperative laboratory data , and postoperative complications . the primary outcomes of interest were the development of postoperative csf cutaneous fistula or symptomatic pseudomeningocele formation . following the intradural component of the case , the durotomy was closed with running 40 nurolon or 50 prolene ( ethicon , somerville , new jersey , united states ) to achieve primary watertight closure . one layer of either tissel fibrin glue ( baxter , deerfield , illinois , united states ) or duraseal ( covidien , minneapolis , minnesota , united states ) was applied to the primary closed durotomy site . valsava maneuvers up to 40 mm h2o were performed at the surgeon 's discretion but were not always performed . a medium or 19-french channel davol drain ( bard davol inc . , covington , georgia , united states ) was placed in the epidural space at the site of durotomy and tunneled out through a separate incision distal to the closed wound . the fascia was then closed with either interrupted 0 vicryl or no . 1 polydioxanone sutures ( ethicon ) . the subcutaneous tissue and skin were then reapproximated in standard fashion utilizing interrupted 20 vicryl sutures ( ethicon ) and surgical skin staples ( covidien ) or 40 subcuticular sutures , respectively . the patients were placed in bed rest with the head of bed flat for 48 hours . the patients who underwent simultaneous arthrodesis were placed in external rigid orthotics for a total of 6 weeks . if there was evidence of leakage from the wound , suction was then adjusted to full - bulb suction . the drains were discontinued after daily output became negligible ( < 30 ml/24 h ) or 3 to 5 days following surgery when the incision appeared well healed ( even if output was still high , > 100 ml/24 h ) , prior to discharge . if output remained high prior to drain discontinuation , the drain was clamped first and the wound site evaluated for csf leak . if there was no evidence of csf leak , then the drains were removed . of note , a figure - of - eight stitch was placed at the drain exit site after drain removal if csf leaked out of the drain site . patients were clinically evaluated and the wound sites were examined at follow - up visits . twenty - five spinal surgery cases with known intentional intraoperative durotomies were identified from the review of the authors ' surgical logs ( table 1 ) . thirteen men ( age 52.4 15.7 years ) and 12 women ( age 63.3 12.7 years ) were included in the study . the length of follow - up ranged from 0.5 to 28 months ( 9.5 7.4 months ) . the surgeries range from 1 to 11 levels with an average of 3.3 2.8 levels . of the 25 patients , 13 ( 52% ) the mean duration of the drain was 5.3 3.4 days with a range from 2 to 18 days . abbreviations : fu , follow - up ; lod , length of drain ; mis , minimal invasive surgery ; n , no ; who , world health organization ; y , yes . note : all cases experienced primary closure of dura . we observed a direct correlative trend between the number of spinal surgery levels and the duration of the drain placement . however , this difference was not statistically significant ( r = 0.57 , fig . the average drain duration for fused patients was 6.33 4.0 days , which was significantly longer than that of patients who did not undergo arthrodesis ( 3.7 1.1 days , p = 0.016 ) . similarly , the average daily drain output for patients who underwent arthrodesis ( 153.1 117.4 ml ) was significantly higher than that of patients who did not undergo arthrodesis ( 86.8 63.5 ml , p = 0.04 ) . the relationship between the number of spinal levels involved in surgery and duration of the drain 1 ) experienced a delayed postoperative wound infection requiring reoperation for exploration and wound washout 2 weeks after the surgery . this patient had a complicated history of multiple spinal surgeries at or near the operating site . furthermore , his postoperative care was complicated by his immobility , chemotherapy , radiation , and existing deep venous thrombosis . no seroma or pseudomeningocele were identified on his postoperative magnetic resonance imaging or during the reoperation . csf leak is a known and frustrating complication associated with all spinal surgeries and can cause headache , pseudomeningocele , and wound breakdown.13 14 although primary watertight closure remains the gold standard , numerous other strategies have been developed . dilemmas commonly encountered include whether to leave a closed suction wound drain and whether to encourage early mobilization.15 16 17 many surgeons avoid leaving a closed suction wound drain in patients with known durotomy for fear of worsening the csf leak , which is especially problematic when the surgery involves multilevel instrumentation and a surgical drain is usually required to prevent postoperative hematoma . our mean drain duration was 5.3 3.4 days and mean daily drain output was 126.5 103.2 ml . subgroup analyses revealed that the drain duration was significantly longer in patients who underwent arthrodesis compared with those who did not ( 6.33 4.0 days versus 3.7 1.1 days , p = 0.016 ) . the average daily drain output was also significantly higher in the arthrodesis group ( 153.1 117.4 ml versus 86.8 63.5 ml , p = 0.04 ) . furthermore , we noticed a linear trend in the relationship between drain duration and the number of spinal levels of operation , although the difference was not statistically significant . surgeries involving arthrodesis tend to have more extensive dissection , and the decortication processes tend to induce more seroma or hematoma formation . the seroma or hematoma could be symptomatic because of its compression on the neural structures.11 12 complications associated with closed suction wound drains have been previously described.18 19 these complications include infection , hematoma formation , and additional neurologic deficit . in addition , in cases with known durotomies , there is a concern for worsening of csf leak , possible formation of csf cutaneous fistula , pseudomeningocele , and the potential for intracranial subdural hematoma with excessive drainage of csf . of note , although one patient did have a superficial wound infection that required a washout , he had multiple comorbidities and highly complicated preoperative and postoperative courses , which was an anomaly in our study . our findings expand upon the initial findings of hughes et al for the management of csf leak after lumbar spinal surgery.20 although analogous in principle , our treatment strategy is different in that our intraoperative subfascial epidural drains were placed on an inpatient basis , and patients had their drains removed prior to discharge . despite these differences , we observed similar results in terms of our primary outcomes of interest , namely the formation of postoperative csf fistula and symptomatic pseudomeningocele . of the 25 patients in the present study , none displayed evidence of persistent csf leak due to durotomy at the most recent follow - up . and more importantly , none of the 25 patients suffered negative consequences associated with the drain . specifically , none of the patients had a postoperative csf leak or postoperative symptomatic pseudomeningocele requiring intervention . therefore , our results suggest that the techniques described herein may be employed safely and efficaciously in patients with intentional durotomies . the subfascial epidural closed suction drain likely prevents the formation of the csf fistula / leak in a similar manner to the traditional lumbar drain . the closed suction drain provides a lower resistance pathway for the csf to flow if there is a small leak from the durotomy after the primary watertight closure , which allows time for the dura , soft tissue , and fascia to scar and seal the durotomy , thereby closing the dead space . the small drain tubing tract could eventually be closed with a figure - of - eight stitch if csf continues to leak . the advantage of intraoperative placement of the epidural closed suction drain over a lumbar drain is that the epidural drain is placed under direct visualization at the same time of surgery . furthermore , intentional durotomies are usually associated with a lower rate of csf leak because they usually involve much better - quality dura and the primary closures are of significantly higher quality . therefore , future randomized prospective studies with larger sample sizes are needed to draw further conclusions . we present a review of 25 cases in which epidural subfascial drains were placed intraoperatively in patients undergoing spine surgeries with intentional durotomies . no patients developed a postoperative csf cutaneous leak , symptomatic pseudomeningocele , or complications associated closed suction drains at latest follow - up . we conclude that the placement of an epidural surgical drain after durotomy to divert csf away from the wound prevented postoperative csf leak and pseudomeningocele . however , larger studies would be useful to further evaluate the durability of such a treatment modality after durotomy .

study design retrospective chart review . objective postoperative cerebrospinal fluid ( csf ) leak is a known complication of intraoperative durotomy . intraoperative placement of subfascial epidural drains following primary dural repair has been proposed as a potential management strategy to prevent formation of csf cutaneous fistula and symptomatic pseudomeningocele . here we describe our experience with subfascial drain after intentional durotomy . methods medical records of patients who underwent placement of subfascial epidural drains during spinal procedures with intentional intraoperative durotomies over a 4-year period at two institutions were retrospectively reviewed . primary outcomes of interest were postoperative csf cutaneous fistula or symptomatic pseudomeningocele formation . results twenty - five patients were included . mean length of follow - up was 9.5 months . twelve patients ( 48% ) underwent simultaneous arthrodesis . the average duration of the drain was 5.3 days with average daily output of 126.5 ml . subgroup analyses revealed that average drain duration for the arthrodesis group was 6.33 days , which is significantly greater than that of the nonfused group , which was 3.7 days ( p = 0.016 ) . similarly , the average daily drain output for the arthrodesis subgroup at 153.1 ml was significantly higher than that of the nonfused subgroup ( 86.8 ml , p = 0.04 ) . no patient developed postoperative csf cutaneous fistula or symptomatic pseudomeningocele or had negative sequelae associated with overdrainage of csf . one patient had a delayed wound infection . conclusions the intraoperative placement of subfascial epidural drains was not associated with postoperative development of csf cutaneous fistula , symptomatic pseudomeningocele , overdrainage , or subdural hematoma in the cases reviewed . subfascial closed wound drain placement is a safe and efficacious management method after intentional spinal durotomies . it is particularly helpful in those who undergo simultaneous arthrodesis , as those patients have statistically higher daily drain output and longer drain durations .

Introduction Methods Chart Review Surgical Technique Results Discussion Conclusions

PMC3914506

while the first reports of mammalian adult neurogenesis in the 1960s were met with little fanfare , the revival of the field in the 1990s incited both excitement and skepticism ; until that time , it was accepted that after birth , the brain could only lose and not gain neurons . however , with the advent of new techniques to label dividing cells and distinguish neuronal from glial populations , evidence for adult neurogenesis accumulated throughout the 1990s and 2000s . it is now well established that the birth of new neurons in the adult brain occurs in two regions : the subventricular zone of the lateral ventricles and the hippocampus . increasingly sophisticated questions have since been asked , refining our image of how these newborn neurons are regulated and how they function . in this review , we will cover several themes that have emerged in the last few years in the study of adult hippocampal neurogenesis . these themes share a common goal of defining the unique contributions of adult - born cells , albeit at different levels of study : learning and memory , physiology , hippocampal anatomy , and comparative biology . both positive and negative alterations in neurogenesis affect discrimination between memories of recalled events and similar present events , also referred to as behavioral pattern separation . ( b ) young adult - born hippocampal neurons have unique physiology and circuitry that may contribute to pattern separation . although links are largely speculative , current hypotheses have attempted to link pattern separation to the period of hyperexcitability in newborn neurons . ( c ) the position of newborn cells within the dentate gyrus may alter their fate and function . differences in proliferation , maturation , and function of newborn neurons have been identified along the longitudinal axis of the dentate gyrus . ( d ) the function of new neurons in humans may be unique when compared with other mammals . differences in maturation rates , newborn neuron proportion , and anatomy between humans and animal models are now being recognized and studied . current inquiries into the functional significance of adult - born neurons have heavily emphasized the concept of pattern separation . pattern separation , a term appropriated from computational models of neural networks , has been loosely used to describe the process by which similar , but not identical , patterns of inputs are classified as distinct [ 1 - 3 ] . at the behavioral level , these inputs reflect both external sensory input and internally generated representations of a previously experienced environment or event . by manipulating the rate of adult neurogenesis , several groups have shown that newborn neurons are critical for making fine discriminations between neighboring spatial locations or highly similar environments in tests of working memory and long - term memory . ablating adult neurogenesis via irradiation impairs performance on a touchscreen task in which mice must discriminate between two adjacent stimuli presented simultaneously in close proximity . the same irradiation treatment interfered with the recall of nearby arm locations after a brief delay ( < 30 s ) on a radial arm maze task . in contrast , an increase in rates of neurogenesis via running improves the performance on the touchscreen task . improving the survival of newborn neurons via a genetic strategy similarly enhances the ability to discriminate between two similar contexts during contextual fear conditioning , a distinction that arises over the course of several days of training . notably , the contribution of adult neurogenesis in each of these cases emerges only on more difficult discriminations . when difficulty is reduced by either increasing the spatial separation or making the contextual conditioning environments more distinct , both impaired and enhanced neurogenesis groups perform comparably to controls . these data support the hypothesis that the advantage provided by adult - born neurons grows as the overlap between two input patterns increases . newborn neurons that are 3 - 4 weeks of age are particularly distinct in function from mature granule cells ( see below ) . optogenetic silencing of newborn cells at 4 weeks of age , but not at 2 or 8 weeks , impairs the retrieval of both previously learned spatial location on the morris water maze and of a previously learned fear - conditioned context . from these studies , it remains unclear whether these 4-week - old cells contribute solely to the retrieval of an existing memory or whether they also play a role in encoding . genetic suppression of mature granule cell activity , while leaving younger granule cells less than 4 weeks of age intact , also improves contextual fear discrimination of two similar contexts . conversely , this young cell - dominated dentate gyrus impairs performance on a water maze task requiring the opposite process pattern completion when navigation must be completed using only a subset of the cues present during training . this study suggests that a dentate gyrus network dominated by young granule cells is biased towards interpreting similar but not identical inputs as distinct , whereas older granule cells are biased towards interpreting similar inputs as equivalent . however , the behaviorally optimal amount of pattern separation versus completion will depend on the relevance of particular stimuli to the demands of the task and motivation of the individual . it is possible that a deficit in pattern separation does not automatically imply an enhancement of pattern completion but rather a global deficit in the detailed recall of a particular context . the physiological properties of newborn neurons and their effects on dentate gyrus circuitry provide some explanation for their time - limited role in pattern separation as described above . newborn neurons have a developmental time window during which they exhibit unique intrinsic and circuit - level properties . physiology and novel circuit tracing studies in mice have revealed details in newborn neuron development . days after birth , newly generated cells respond to ambient -aminobutyric acid ( gaba ) with tonic activation due to a high concentration of intracellular chloride that leads to depolarization . in 1 - 2 weeks after 2 - 3 weeks , they start expressing glutamatergic receptors , and subsequently , the direction of the chloride gradient switches such that gabaergic input hyperpolarizes newborn neurons [ 10 - 12 ] . at around 1 month , new neurons receive synaptic glutamatergic input from the entorhinal cortex , similar to mature cells [ 13 - 16 ] . however , at this time point , new neurons have a lower density of gaba inputs and inhibitory post - synaptic currents ( ipscs ) compared with mature granule neurons . once fully mature ( about 6 weeks after birth ) , newborn neurons are essentially indistinguishable physiologically from developmentally born granule neurons . hence , at 4 weeks after birth , new neurons receive input from the same sources as mature granule cells but , because of their unique properties , they are hyperexcitable and show broader tuning than surrounding mature granule cells ; young neurons are more likely to respond to two separate inputs than mature granule cells . the effect of this developmental time course is a period during which excitation dominates over inhibition . by contrast , inputs to fully mature granule neurons are biased towards inhibition , as they fire very infrequently . adult neurogenesis therefore serves to make the principal cells of the dentate gyrus physiologically heterogeneous and distinct subpopulations are constantly shifting : as one newborn neuron subpopulation matures , another develops to replace it . the physiological differences between mature granule cells and 4-week - old newborn neurons suggest at least two mechanisms for how neurogenesis may affect pattern separation and completion . one mechanism involves interpreting the activity of individual granule cells directly in response to two different inputs as being reflective of overall dentate gyrus activity . in this case , mature granule neurons , which require high input specificity and maintain a high activation threshold , potentially serve as good pattern separators . the hyperexcitability and broad tuning properties of newborn neurons would conversely suggest that they could serve as pattern integrators . however , this hypothesis is inconsistent with the behavioral evidence discussed above , in which increases in the newborn neuron population improve pattern separation . an alternative mechanism is to consider how local dentate gyrus interneurons may influence overall dentate gyrus activity . both young and mature granule cells stimulate local inhibitory interneurons either directly or indirectly via mossy cells in the hilus . those interneurons in turn also send efferents to granule cells but with a higher density of inhibitory inputs to mature as compared with young neurons ( as described above ) . thus , by dampening the activity of mature granule cells , newborn cells increase their influence on the network . by this proposed mechanism , increased numbers of hyperexcitable neurons paradoxically make the dentate gyrus sparser , supporting a role for newborn neurons in enhancing pattern separation function . while the evidence for a role for newborn neurons in pattern separation is accumulating , we are also beginning to appreciate that this function depends on the location of new cells within the dentate gyrus . the dentate gyrus can be anatomically distinguished along the dorsal - ventral ( septo - temporal ) axis , and it is becoming increasingly recognized that newborn neurons arising from the dentate gyrus may be functionally distinguished along this axis . differences in the generation and maturation of adult - born neurons appear along the dorsal - ventral axis . new neurons in the dorsal dentate gyrus may mature significantly faster than in the ventral dentate gyrus because of higher levels of basal local network activity in the former . these distinctions might arise from the region - specific variation in cortical and subcortical connections to the hippocampus . a newborn neuron 's maturation time and therefore its unique properties is linked with its position within the dentate gyrus . an additional distinction of newborn neuron function may be related to the idea that the dorsal hippocampus is involved in spatial learning and memory , whereas the ventral hippocampus has been linked with emotional behavior . with these associations , it has been proposed that a cognitive - specific task or a stimulus with emotional valence would selectively affect neurogenesis in the dorsal and ventral hippocampus , respectively when adult rats learned a spatial water maze task , enhanced neurogenesis was observed in the dorsal , but not ventral , hippocampus , as predicted . in probing the activation of granule cells after water maze learning , c - fos expression was higher in the dorsal than ventral hippocampus when considering the overall granule cell population , but among the adult - born subpopulation alone , c - fos expression was higher in the ventral hippocampus . acute stress or administration of corticosterone in adult rats was predicted to alter neurogenesis in the ventral hippocampus , when , in fact , neurogenesis increases were observed selectively in the dorsal hippocampus . therefore , although there is evidence for cognition primarily involving the dorsal hippocampus and emotional behavior utilizing mainly the ventral hippocampus , the links with neurogenesis require further refinement . collectively , these studies highlight the idea that newborn neurons can be born at the same time yet mature differently , and/or subserve unique functions depending on their position along the long axis of the dentate gyrus . the nature and consequence of having variability within a newborn neuron population along the dorsal - ventral axis are usually not reported and warrant re - evaluation of previous studies and further attention in future studies . while we have known for 15 years that adult neurogenesis takes place in the adult human , most of our understanding of mammalian adult neurogenesis comes from studies of rodents . therefore , it has been tempting to view our knowledge of rodent adult neurogenesis from an anthropocentric viewpoint . however , recent adult neurogenesis studies in primates and humans are reshaping ideas of how new neurons may function within us . as suggested from evaluating non - human primates , the developmental timeline of newborn neurons in humans may be much longer than previously estimated . two - thirds of brdu cells continued to express the immature neuron marker doublecortin ( dcx ) at 6 months in an adult macaque hippocampus , whereas dcx expression in the dentate gyrus neurons in an adult rodent lasts only several weeks . a report by spalding , frisen and colleagues confirmed that neurogenesis continues to occur in the adult human hippocampus and to a much greater extent than previously estimated . they showed that hippocampal neurogenesis in adult humans is robust and continues through at least the fifth decade of life . while these data suggest that the age - related decline in adult neurogenesis is significantly slower in humans than in rodents , a direct comparison requires further validation because of the impoverished and sedentary environment of rodents reared under typical laboratory conditions . an emerging idea is that newborn neurons may be playing significantly larger roles in hippocampal function and human cognition than previously thought . previous models utilized rodent neurogenesis data for proposing computational roles for newborn neurons in learning and memory . given that the study by spalding and colleagues suggests that most human dentate gyrus neurons are subject to turnover compared with 10% of mouse dentate granule neurons , new models may be required for predicting the contribution of adult - born neurons in human hippocampal function . the next leap in understanding the role of newborn neurons in human health and disease will require studying hippocampus - dependent behaviors in humans . development of novel imaging techniques to visualize newborn neuron activity in the dentate gyrus of humans would lead to breakthroughs . one example of a funding initiative that would encourage development of necessary technologies is the recently announced brain research through advancing innovative neurotechnologies ( brain ) funding initiative by the obama administration , which encourages development of these transformational techniques . about 20 years ago , the dogma that no new neurons are born in adulthood began to crumble . the advances in the last few years have shown why neurogenesis may be important ( theme 1 ) , revealed a mechanism by which it may work ( theme 2 ) , suggested that newborn neuron function is heterogeneous along its axes ( theme 3 ) , and hinted at how what we know may be modified in the case of humans ( theme 4 ) . although these themes may at first appear to concern separate aspects of neurogenesis , it could be that the inter - relationships between these themes will be critical for understanding the importance of newborn neurons in humans . for example , the longer developmental time window in humans compared with rodents suggests a relatively prolonged state of hyperexcitability in newborn neurons . this extended period may impact the human dentate gyrus circuitry such that pattern separation may function qualitatively or quantitatively differently in humans than in rodents . does the presence of a different / larger ventral dentate gyrus have implications for whether newborn neurons function differently there ? and , as noted , the larger scale of human adult neurogenesis may mean that we need to modify our computational models . recent work has sharpened our view of the regulation and function of adult hippocampal neurogenesis . new techniques and advancements will literally and figuratively present a progressively higher - resolution image of this striking example of neural plasticity .

the birth of new neurons in the adult mammalian brain once thought impossible is now a well - accepted phenomenon that takes place in the subventricular zone of the lateral ventricles and the hippocampus . this review focuses on the recent work that has sharpened our views of how hippocampal newborn neurons are regulated and function . areas of study include ( a ) how neurogenesis contributes to behavioral pattern separation , ( b ) how pattern separation may be influenced by the properties and circuitry of newborn neurons , ( c ) differences along the dorsal - ventral axis of how neurogenesis is regulated and functions , and ( d ) adult neurogenesis in primates , including new human data . these current avenues of research reveal new details of adult neurogenesis and foreshadow what we may learn about this exciting phenomenon in the near future .

Introduction Newborn neurons contribute to dentate gyrus pattern separation function Young adult-born hippocampal neurons have unique physiology and circuitry that may contribute to pattern separation The position of newborn cells within the dentate gyrus may alter their fate and function The function of new neurons in humans may be unique when compared with other mammals Conclusions Disclosures

PMC3321651

different ways exist to conceptualize executive functioning . for research that has applied latent statistical models , the focus is on classification and documenting both the diversity and unity of efs . although related , efs can be classified into three categories , including ( i ) working memory and updating , ( ii ) executive attention or cognitive control , and ( iii ) inhibition ( e.g. , miyake et al . , 2000 ; friedman et al . , 2006 ; miyake and friedman , 2012 ) . but the three aspects also form an integrated mechanism for processing information . this broader mechanism underlies the ability to manipulate and maintain tasks , plans , and goals ( i.e. , their mental representations ) in an active state while monitoring performance and inhibiting distracting stimuli , whether from the environment or internally ( kane and engle , 2002 ) . executive functioning is a central topic in many areas of psychology ( posner and rothbart , 2007 ) . various theoretical frameworks emphasize that while some cognitive processes can run efficiently on limited cognitive resources , many others engage executive functioning . within social psychology , efs are important for a wide array of sub - fields that inform the nature of social behavior , including persuasion , attitudes and prejudice , social perception , self - control , and emotion regulation , for example ( e.g. , smith and decoster , 2000 ; von hippel , 2007 ) . in all these areas of social functioning , automatic processes are thought to help create a first - pass , working model of the event ( e.g. , perceiver readily infers a speaker seems competent due to style of dress ) . assuming the perceiver is motivated and has the requisite cognitive resources ( efs ) , they then can integrate more information about the event to enrich the working model and arrive at a deeper social understanding ( for reviews , see chaiken and trope , 1999 ; smith and decoster , 2000 ) . one central question about efs in day - to - day life is their malleability . except for changes across the lifespan ( e.g. , von hippel , 2007 ) , people s executive functioning has long been viewed as relatively static perhaps because of robust individual differences in efs . however , starting with recent reports of successful cognitive interventions , this view has begun to change and now efs are seen as much more open to both short- and long - term training , warm - up , and exhaustion effects . research has shown , for example , that working memory training not only leads to improvements on distinct measures of executive functioning but also to transfer effects resulting in improvement on measures of fluid intelligence ( e.g. , jaeggi et al . , 2008 , 2011 ) . in young children , cognitive training has been shown to improve subsequent attention control ( e.g. , thorell et al . , 2008 ) . other findings indicate efs benefit from meditation training ( e.g. , tang and posner , 2009 ) . however , some of the most intriguing evidence comes from research showing that social engagement enhances performance on standard ef tests . this is important since the majority of people s life takes place in the social world it has long been argued that communicating with others , taking others perspectives , and following social rules sets the stage for the development and maintenance of efs , thus helping structure general mental functioning ( e.g. , vygotsky , 1978 ; buttelmann et al . , 2009 ) . as previously mentioned , the developmental literature has long linked efs to performance on some aspects of tom ( hughes and ensor , 2007 ) . selection pressures related to the complex , dynamic and mixed - motive nature of social life have also been posited to partly underlie the evolution of primate intelligence ( e.g. , jolly , 1966 ; humphrey , 1976 ; dunbar and shultz , 2007 ) . there also are intriguing suggestions regarding the overlap of the neural underpinnings of ef and social reasoning processes ( von hippel , 2007 ; adolphs , 2009 ) . and there are now several reports of positive correlations of some brain structures with social network size . for example , amygdala size correlates with the size and complexity of real social networks ( bickart et al . , 2011 ) , whereas gray matter correlates with the number of facebook friends ( kanai et al . , 2011 ) . more impressively , it appears that , at least in macaques , social network size causally influences brain structure and function ( sallet et al . , 2011 ) . with humans , much cross - sectional and longitudinal research has found positive relationships between social participation / engagement and executive functioning and related mental health outcomes ( e.g. , fratiglioni et al . , 2004 ) . some findings with distinct populations thus , for example , a vygotskian based curriculum ( tools of the mind ) which requires much social interaction and taking others perspective boosted not only preschoolers social skills but also their executive functioning ( e.g. , diamond et al . , 2007 ) . although most of the available work examining the effects of social engagement relies on correlational designs , a few studies are beginning to show positive causal effects of social processes on executive functioning , and the most direct evidence comes from social psychological research investigating the effect of on - line social interaction on executive functioning . in one experiment , we had participants interact by having a discussion of a social topic ( ybarra et al . , 2008 ) . participants were given 10 min total , with a few minutes to prepare for the discussion . following the interaction the participants evaluated the activity and then completed tests of cognitive functioning , in particular a test of working memory which is a critical component of executive functioning . we also tested participants assigned to either an intellectual activities condition or a control condition that involved watching a 10-min video . another aspect of this mental exercising through simple socializing research that should be highlighted is that participants assigned to the video condition were presented with social content involving several human characters that were engaged in social interaction ( ybarra et al . , 2008 ) . in a sense , the video content represents a rich stimulus compared to many of the stimuli used to study social cognitive processes from a neuroscientific perspective . still , the video condition did not result in any boosts to efs ; it was the real , on - line social interaction that resulted in ef boosts , which were equivalent to those resulting from engaging in difficult intellectual activities . thus , benefits to efs are selectively seen in on - line social cognition , where participants dynamically construct a model of another person , and less in off - line social cognition where participants deal with static or impoverished and less engaging representations of others . regarding the above research , the argument could be made that the discussion that comprised the social interaction was atypical in some way , in that participants had to take positions , make arguments , and discuss their point of view . but as recent theorizing on the evolution of reasoning suggests , this aspect of social interaction evaluating arguments and proffering others may have been an important pressure on the evolution of our distinctive human cognition ( mercier and sperber , 2011 ) . further , as we will discuss later , recent research indicates ef boosts also can result from basic get - to - know - you interactions if structured in a particular , mind - engaging way ( ybarra et al . so the positive effects on efs can occur from other types of on - line social interactions . however , evidence also exists for the detrimental effects of some social interactions on efs . most of these findings come from research on intergroup social interactions ( e.g. , richeson and trawalter , 2005 ) . in one study , for example , participants who underwent an interracial interview compared to a same race interview subsequently exhibited more interference on a stroop task , a measure of ef . further , this effect was greater the stronger participants associations between concepts denoting african - americans and negative personality characteristics , as measured with the iat test . studies found that after interacting with an attractive female , men showed worse performance on a subsequent ef task , and the decline was related to the degree men tried to manage their impression in the interaction ( karremans et al . , 2009 ) . interactions can result in reduction of cognitive functioning ( finkel et al . , 2006 ) . these investigators had participants coordinate on a task with a confederate , who in some cases made scripted errors ( high maintenance ) and in some cases did not ( low maintenance ) . participants in the high maintenance condition performed worse on various subsequent tests , although in this research the tests were indirectly tied to efs . note that most , if not all , studies showing ef reductions invoked self - presentation concerns ( e.g. , about appearing non - prejudiced , unintelligent , etc . ) . first , it constitutes a working memory load ( what was the interaction about ? second , it triggers effortful attempts to self - regulate , which , if extensive , could deplete cognitive resources ( muraven and baumeister , 2000 ) . at a broader level this reasoning also applies to some of the findings dealing with performance decrements under conditions of stereotype threat , for example . in our opinion , however , one key difference between studies showing reductions and boosts in efs has to do with the nature of the interaction . in particular , it is critical whether participants mentally engage with others and attempt to build a rich model of their minds , that they toggle between self and other perspectives , and that they communicate and create meaning during the social interaction versus disengage from the interaction . we argue that this is often , though not always ( see below ) , determined by whether the interaction is cooperative or competitive . however , the default in a cooperative setting is often to engage with the other person , build a model of their mind , figure out whether or not they are trustworthy , and convey to them that they can trust us . in fact , under these trust - building conditions neuroimaging work has reported some of the most robust effects of mentalizing on activity in the medial prefrontal cortex ( for reviews , see frith and singer , 2008 ) . further , children s ability to mentalize ( i.e. , perform tom tasks ) has been shown to be positively correlated to the likelihood of cooperating , for example , in prisoner s dilemma games and also to making fair offers in the ultimatum game ( sally and hill , 2006 ; also see buttelmann et al . , 2009 ) . in contrast , the default under competitive goals , as realized in the above research on intergroup interactions , is often to become self - protective and withdraw from engaging the other person . this may occur because the interaction is ambiguous and not well structured , which inclines people to back away from the situation as a general way of deterring interpersonal costs ( ybarra et al . this may also occur because people have a tendency to dehumanize outgroups and thus attribute less mind to their competitors ( harris and fiske , 2006 ) . finally , it is possible that competition ( but also other high - stake situations ) may sometimes usurp the cognitive resources necessary for careful and effortful mentalizing . so , people focus on themselves and their own interests rather than the other person , and they do not engage in attempts to take perspective and create a rich model of the other and the event . a key aspect then of whether or not social interaction creates subsequent ef boosts rests on people engaging each other . we propose that doing so invokes processes that exercise underlying efs , such as working memory and executive attention . thus , when people engage with others in social interaction , versus withdraw into themselves , they can exercise or warm - up these core cognitive processes , whose influence is then transferred ( far ) to executive functioning tasks ( ybarra et al . , if such social cognitive processes underlie the cognitive boosts , disrupting them should eliminate the cognitive benefits . consistent with this idea , our recent experiments found that interaction goals ( competition ) that disengage participants from perspective taking and mentalizing eliminate the cognitive benefits that can result from social interaction ( ybarra et al . importantly , follow - up work has shown that getting people to engage others during interaction , even when the interaction is competitive , helps counter the loss in cognitive benefits ( ybarra et al . this is consistent with other research in social cognition suggesting that skepticism , suspiciousness , and other competitive approaches can sometimes improve mental performance ( schul et al . , 2004 , 2008 ) . these findings provide evidence that engaging the other during interaction along with concomitant social cognitive processing ( perspective taking , mind - reading ) may partly underlie the boosts to executive functioning following social interaction . the above findings also help inform , at least in some small measure , the assumption that competition in social contexts played an important role in the evolution of primate cognition and the more intense varieties of social cognition and mentalizing ( e.g. , byrne and whiten , 1988 ; whiten and byrne , 1997 ) . dealing with competitors can of course implicate the understanding of others behavioral tendencies and psychological states ( e.g. , tomasello et al . , 2003 ; decety et al . , 2004 ) , but as we have shown in our experiments , people who expect to compete during social interaction , if not given an explicit goal to read the other person and form a model of what they are like , will disengage and behave evasively ( ybarra et al . , 2010 ) and not receive cognitive benefits from the interaction ( ybarra et al . , 2011 ) . these findings suggest that people when competing have diverse options they can undertake , such as to try to hide or foil prediction . only when no , low - risk option is available will they engage or confront the opponent . this , however , does not mean some level of social understanding is not sought or created under competitive circumstances , but it may be that the working model of the other is of a generic , stereotypic nature that relies less on efs , similar to the social perception differences found when people judge members of outgroups versus ingroups ( neuberg and fiske , 1987 ; brewer , 1988 ) . when interdependence is called for meaning you have to interact on - line with a person and that your behavior is to some degree yoked to theirs the situation should instigate more intense social cognition and mentalizing to build a richer model of the other party . the discussion of competition helps highlight the role we assign to mentalizing and understanding others psychological states during social interaction . we propose that mental engagement with others leads to cognitive benefits from social interaction especially when the involved parties are taking perspective and dynamically building a model of what the other person is like . as we noted in the introduction , some social inferential processes can occur quite efficiently with little reliance on efs ( e.g. , winter and uleman , 1984 ; trope , 1986 ) . a similar theme comes up in research on theory of mind , with certain processes ( e.g. , the calculation of what another sees ) thought to be carried out efficiently and automatically ( e.g. , moll and tomasello , 2006 ; onishi and baillargeon , 2005 ; qureshi et al . , 2010 ) . related ideas on the role of efficient social understanding also have been discussed from the point of view of embodied and situated social cognition ( leudar et al . , 2004 ; however , some tom and mentalizing processes such as the selection of information for further processing , though , are thought to require limited cognitive resources or ef ( e.g. , leslie et al . , 2005 ; bull et al . , 2008 ; qureshi et al 2010 ) , and engagement with others in social interaction is considered the real domain in which minds are known ( reddy and morris , 2004 ) . thus , there are important elements of building a model of what another person is like , what they are thinking , and what they might do next that rely on efs . our proposal is that during real social interaction both low - level and high - level mentalizing and behavior prediction processes interact and inform each other . the automatic processes serve as input that feed into richer representations that are shaped and updated by processes requiring limited cognitive resources in real time . as noted with competition , it is not that people who are dealing with antagonistic parties fail to attempt to understand their foes but it is during social interaction when the parties are actively engaged with each other that richer representations of the other and of the interaction are created and dynamically updated , which entails the participation of efs . in addition to the issues discussed above , further work is needed to address the following questions : what specific types of social interactions benefit ef and what are the underlying processes that underlie theses boosts ? given both the unity and diversity of efs , does social interaction affect some ef elements more than others , or does this also depend on the type of interaction ? how long do cognitive boosts last and what is there time course , and does this depend on the task to which the cognitive processes are applied ? are the neural correlates underlying on - line social interaction , in particular those underlying efs , similar or different from the correlates unearthed for off - line social interaction ? how do short - term training effects of social interaction translate into long - term cognitive reserve , which may be captured in the cross - sectional and longitudinal studies on social engagement and cognitive functioning ? and , what are the longer - term consequences of repeated interactions that result in ef reductions ? if people do not avoid others different from the self , can they learn to cope with such challenging interactions ? it has long been argued that communicating with others , taking others perspectives , and following social rules sets the stage for the development and maintenance of efs , thus helping structure general mental functioning ( e.g. , vygotsky , 1978 ; buttelmann et al . , 2009 ) . as previously mentioned , the developmental literature has long linked efs to performance on some aspects of tom ( hughes and ensor , 2007 ) . selection pressures related to the complex , dynamic and mixed - motive nature of social life have also been posited to partly underlie the evolution of primate intelligence ( e.g. , jolly , 1966 ; humphrey , 1976 ; dunbar and shultz , 2007 ) . there also are intriguing suggestions regarding the overlap of the neural underpinnings of ef and social reasoning processes ( von hippel , 2007 ; adolphs , 2009 ) . and there are now several reports of positive correlations of some brain structures with social network size . for example , amygdala size correlates with the size and complexity of real social networks ( bickart et al . , 2011 ) , whereas gray matter correlates with the number of facebook friends ( kanai et al . , 2011 ) . more impressively , it appears that , at least in macaques , social network size causally influences brain structure and function ( sallet et al . , 2011 ) . with humans , much cross - sectional and longitudinal research has found positive relationships between social participation / engagement and executive functioning and related mental health outcomes ( e.g. , fratiglioni et al . , 2004 ) . some findings with distinct populations thus , for example , a vygotskian based curriculum ( tools of the mind ) which requires much social interaction and taking others perspective boosted not only preschoolers social skills but also their executive functioning ( e.g. , diamond et al . , 2007 ) . although most of the available work examining the effects of social engagement relies on correlational designs , a few studies are beginning to show positive causal effects of social processes on executive functioning , and the most direct evidence comes from social psychological research investigating the effect of on - line social interaction on executive functioning . in one experiment , we had participants interact by having a discussion of a social topic ( ybarra et al . , 2008 ) . participants were given 10 min total , with a few minutes to prepare for the discussion . following the interaction the participants evaluated the activity and then completed tests of cognitive functioning , in particular a test of working memory which is a critical component of executive functioning . we also tested participants assigned to either an intellectual activities condition or a control condition that involved watching a 10-min video . another aspect of this mental exercising through simple socializing research that should be highlighted is that participants assigned to the video condition were presented with social content involving several human characters that were engaged in social interaction ( ybarra et al . , 2008 ) . in a sense , the video content represents a rich stimulus compared to many of the stimuli used to study social cognitive processes from a neuroscientific perspective . still , the video condition did not result in any boosts to efs ; it was the real , on - line social interaction that resulted in ef boosts , which were equivalent to those resulting from engaging in difficult intellectual activities . thus , benefits to efs are selectively seen in on - line social cognition , where participants dynamically construct a model of another person , and less in off - line social cognition where participants deal with static or impoverished and less engaging representations of others . regarding the above research , the argument could be made that the discussion that comprised the social interaction was atypical in some way , in that participants had to take positions , make arguments , and discuss their point of view . but as recent theorizing on the evolution of reasoning suggests , this aspect of social interaction evaluating arguments and proffering others may have been an important pressure on the evolution of our distinctive human cognition ( mercier and sperber , 2011 ) . further , as we will discuss later , recent research indicates ef boosts also can result from basic get - to - know - you interactions if structured in a particular , mind - engaging way ( ybarra et al . so the positive effects on efs can occur from other types of on - line social interactions . . however , evidence also exists for the detrimental effects of some social interactions on efs . most of these findings come from research on intergroup social interactions ( e.g. , richeson and trawalter , 2005 ) . in one study , for example , participants who underwent an interracial interview compared to a same race interview subsequently exhibited more interference on a stroop task , a measure of ef . further , this effect was greater the stronger participants associations between concepts denoting african - americans and negative personality characteristics , as measured with the iat test . studies found that after interacting with an attractive female , men showed worse performance on a subsequent ef task , and the decline was related to the degree men tried to manage their impression in the interaction ( karremans et al . , 2009 ) . interactions can result in reduction of cognitive functioning ( finkel et al . , 2006 ) . these investigators had participants coordinate on a task with a confederate , who in some cases made scripted errors ( high maintenance ) and in some cases did not ( low maintenance ) . participants in the high maintenance condition performed worse on various subsequent tests , although in this research the tests were indirectly tied to efs . however , the findings are also puzzling . why do some interactions lead to ef impairments but other interactions to benefits ? note that most , if not all , studies showing ef reductions invoked self - presentation concerns ( e.g. , about appearing non - prejudiced , unintelligent , etc . ) . first , it constitutes a working memory load ( what was the interaction about ? second , it triggers effortful attempts to self - regulate , which , if extensive , could deplete cognitive resources ( muraven and baumeister , 2000 ) . at a broader level this reasoning also applies to some of the findings dealing with performance decrements under conditions of stereotype threat , for example . in our opinion , however , one key difference between studies showing reductions and boosts in efs has to do with the nature of the interaction . in particular , it is critical whether participants mentally engage with others and attempt to build a rich model of their minds , that they toggle between self and other perspectives , and that they communicate and create meaning during the social interaction versus disengage from the interaction . we argue that this is often , though not always ( see below ) , determined by whether the interaction is cooperative or competitive . however , the default in a cooperative setting is often to engage with the other person , build a model of their mind , figure out whether or not they are trustworthy , and convey to them that they can trust us . in fact , under these trust - building conditions neuroimaging work has reported some of the most robust effects of mentalizing on activity in the medial prefrontal cortex ( for reviews , see frith and singer , 2008 ) . further , children s ability to mentalize ( i.e. , perform tom tasks ) has been shown to be positively correlated to the likelihood of cooperating , for example , in prisoner s dilemma games and also to making fair offers in the ultimatum game ( sally and hill , 2006 ; also see buttelmann et al . , 2009 ) . in contrast , the default under competitive goals , as realized in the above research on intergroup interactions , is often to become self - protective and withdraw from engaging the other person . this may occur because the interaction is ambiguous and not well structured , which inclines people to back away from the situation as a general way of deterring interpersonal costs ( ybarra et al . , 2010 ) . this may also occur because people have a tendency to dehumanize outgroups and thus attribute less mind to their competitors ( harris and fiske , 2006 ) . finally , it is possible that competition ( but also other high - stake situations ) may sometimes usurp the cognitive resources necessary for careful and effortful mentalizing . so , people focus on themselves and their own interests rather than the other person , and they do not engage in attempts to take perspective and create a rich model of the other and the event . a key aspect then of whether or not social interaction creates subsequent ef boosts rests on people engaging each other . we propose that doing so invokes processes that exercise underlying efs , such as working memory and executive attention . thus , when people engage with others in social interaction , versus withdraw into themselves , they can exercise or warm - up these core cognitive processes , whose influence is then transferred ( far ) to executive functioning tasks ( ybarra et al . , 2008 ) . if such social cognitive processes underlie the cognitive boosts , disrupting them should eliminate the cognitive benefits . consistent with this idea , our recent experiments found that interaction goals ( competition ) that disengage participants from perspective taking and mentalizing eliminate the cognitive benefits that can result from social interaction ( ybarra et al . , 2011 , study 1 ) . importantly , follow - up work has shown that getting people to engage others during interaction , even when the interaction is competitive , helps counter the loss in cognitive benefits ( ybarra et al . this is consistent with other research in social cognition suggesting that skepticism , suspiciousness , and other competitive approaches can sometimes improve mental performance ( schul et al . these findings provide evidence that engaging the other during interaction along with concomitant social cognitive processing ( perspective taking , mind - reading ) may partly underlie the boosts to executive functioning following social interaction . the above findings also help inform , at least in some small measure , the assumption that competition in social contexts played an important role in the evolution of primate cognition and the more intense varieties of social cognition and mentalizing ( e.g. , byrne and whiten , 1988 ; whiten and byrne , 1997 ) . dealing with competitors can of course implicate the understanding of others behavioral tendencies and psychological states ( e.g. , tomasello et al . , 2003 ; decety et al . , 2004 ) , but as we have shown in our experiments , people who expect to compete during social interaction , if not given an explicit goal to read the other person and form a model of what they are like , will disengage and behave evasively ( ybarra et al . , 2010 ) and not receive cognitive benefits from the interaction ( ybarra et al . , 2011 ) . these findings suggest that people when competing have diverse options they can undertake , such as to try to hide or foil prediction . only when no , low - risk option is available will they engage or confront the opponent . this , however , does not mean some level of social understanding is not sought or created under competitive circumstances , but it may be that the working model of the other is of a generic , stereotypic nature that relies less on efs , similar to the social perception differences found when people judge members of outgroups versus ingroups ( neuberg and fiske , 1987 ; brewer , 1988 ) . when interdependence is called for meaning you have to interact on - line with a person and that your behavior is to some degree yoked to theirs the situation should instigate more intense social cognition and mentalizing to build a richer model of the other party . the discussion of competition helps highlight the role we assign to mentalizing and understanding others psychological states during social interaction . we propose that mental engagement with others leads to cognitive benefits from social interaction especially when the involved parties are taking perspective and dynamically building a model of what the other person is like . as we noted in the introduction , some social inferential processes can occur quite efficiently with little reliance on efs ( e.g. , winter and uleman , 1984 ; trope , 1986 ) . a similar theme comes up in research on theory of mind , with certain processes ( e.g. , the calculation of what another sees ) thought to be carried out efficiently and automatically ( e.g. , moll and tomasello , 2006 ; onishi and baillargeon , 2005 ; qureshi et al . , related ideas on the role of efficient social understanding also have been discussed from the point of view of embodied and situated social cognition ( leudar et al . , 2004 ; barrett and henzi , 2005 ; iacoboni et al . , 2005 ) . however , some tom and mentalizing processes such as the selection of information for further processing , though , are thought to require limited cognitive resources or ef ( e.g. , leslie et al . , 2005 ; bull et al . , 2008 ; qureshi et al . , 2010 ) , and engagement with others in social interaction is considered the real domain in which minds are known ( reddy and morris , 2004 ) . thus , there are important elements of building a model of what another person is like , what they are thinking , and what they might do next that rely on efs . our proposal is that during real social interaction both low - level and high - level mentalizing and behavior prediction processes interact and inform each other . the automatic processes serve as input that feed into richer representations that are shaped and updated by processes requiring limited cognitive resources in real time . as noted with competition , it is not that people who are dealing with antagonistic parties fail to attempt to understand their foes but it is during social interaction when the parties are actively engaged with each other that richer representations of the other and of the interaction are created and dynamically updated , which entails the participation of efs . in addition to the issues discussed above , further work is needed to address the following questions : what specific types of social interactions benefit ef and what are the underlying processes that underlie theses boosts ? given both the unity and diversity of efs , does social interaction affect some ef elements more than others , or does this also depend on the type of interaction ? how long do cognitive boosts last and what is there time course , and does this depend on the task to which the cognitive processes are applied ? are the neural correlates underlying on - line social interaction , in particular those underlying efs , similar or different from the correlates unearthed for off - line social interaction ? how do short - term training effects of social interaction translate into long - term cognitive reserve , which may be captured in the cross - sectional and longitudinal studies on social engagement and cognitive functioning ? and , what are the longer - term consequences of repeated interactions that result in ef reductions ? if people do not avoid others different from the self , can they learn to cope with such challenging interactions ? in addition to theoretical implications regarding the difference between real , on - line social cognition versus off - line social cognition , the processes discussed here have several practical implications . the major one is that certain social interactions can be an effective way of keeping mentally fit . sharpbrains , a company that tracks the mental fitness industry , estimated that worldwide revenue associated with cognitive training programs ( e.g. , computer software ) surged to $ 850 million in 2008 , up from $ 250 million in 2005 . unfortunately , many of these training programs are not only expensive , but few have been scientifically evaluated ( jaeggi et al . , 2011 ) . more germane to this proposal , what is important to emphasize is that what also matters is engagement and taking an active and not a passive role to the technology or the social interaction . as reviewed earlier , some forms of social interaction result in no boosts , whereas those in which the parties were engaged and actively tried to form a working model of the other yielded cognitive benefits . however , we would add that given that social connections are at the core of primate life ( jolly , 1966 ) , are central to the human survival strategy ( barash , 1986 ; dunbar , 1992 , 1998 ; baumeister , 2005 ) , and yield various benefits to health and well - being ( e.g. , house et al . , 1988 ; ybarra et al . , 2008 ) , engaged socializing with others in cooperative interaction may not only strengthen people s brains and minds but possibly their social relations as well , allowing them to reap the various benefits that flow from such bonds . in short , our review highlights the essential role of studying on - line social interactions for understanding the operation of fundamental cognitive processes . although we focused on how executive functioning can change due to task context , especially the on - line social context , it is also important to appreciate the role of people s beliefs and strategies in social navigation . most of us probably know people who seem quite intelligent but still do many dumb things in the cpu is a work of exquisite engineering , but if you try to use such a computer , task performance will be suboptimal and frustrating . the point here is simple : raw executive functioning matters for many social tasks , but so does the content of people s beliefs and strategies their rationality and match to the environment ( both in terms of controlled and automatic mental processes ) . but social life , especially who people interact and associate with , also plays a central role in the beliefs and values that end up populating people s minds . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

a successful social interaction often requires on - line and active construction of an ever - changing mental - model of another person s beliefs , expectations , emotions , and desires . it also requires the ability to maintain focus , problem - solve , and flexibly pursue goals in a distraction - rich environment , as well as the ability to take - turns and inhibit inappropriate behaviors . many of these tasks rely on executive functions ( ef ) working memory , attention / cognitive control , and inhibition . executive functioning has long been viewed as relatively static . however , starting with recent reports of successful cognitive interventions , this view is changing and now efs are seen as much more open to both short- and long - term training , warm - up , and exhaustion effects . some of the most intriguing evidence suggests that engaging in social interaction enhances performance on standard ef tests . interestingly , the latest research indicates these ef benefits are selectively conferred by certain on - line , dynamic social interactions , which require participants to mentally engage with another person and actively construct a model of their mind . we review this literature and highlight its connection with evolutionary and cultural theories emphasizing links between intelligence and sociality .

EXECUTIVE FUNCTIONS IN PSYCHOLOGY AND THEIR MALLEABILITY SOCIAL INTERACTION AND EXECUTIVE FUNCTIONING ON-LINE SOCIAL INTERACTION AND EXECUTIVE FUNCTIONING BOOSTS ON-LINE SOCIAL INTERACTION AND EXECUTIVE FUNCTIONING REDUCTIONS SOLVING THE SOCIAL INTERACTION-EXECUTIVE FUNCTION PUZZLE PRACTICAL IMPLICATIONS CONCLUSION Conflict of Interest Statement

PMC3312021

systems biology is an emerging academic field aiming at system - level understanding of biological systems . recent progress in molecular biology has enabled us to gain information on the interactions among the underlying molecules from comprehensive experimental data sets . in general , a system - level understanding of a biological system can be derived from insight into four key properties : ( 1 ) the system 's structure , ( 2 ) the system dynamics , ( 3 ) the control method , and ( 4 ) the design method . equivalently , identifying related components and their interactions , gathering qualitative and quantitative information about the system 's evolution under different circumstances , achieving the desired outputs by controlling the input with appropriate definitions of inputs and outputs of the system , and reconstructing analogous systems by eliminating the undesired properties are four essential steps in systems biology done by collaboration among engineers , biologists , and doctors . systems biology is a cross - cutting research area connecting control engineering , biology , and medical science , as shown in figure 2 . it aims at understanding the bare function and integration function of the cell to reconstruct the biological systems with desired features . control and automation play critical roles in this novel field not only by providing new technology and equipment for biologists to design and perform meticulous experiments , to take high - throughput measurements , and to analyze experimental data efficiently , but also by offering doctors new medical applications and improving the precision of medical manipulations . the wide range of aspects which control and automation have been applied to include , but are not limited to , gene regulation [ 3 , 4 ] , drug delivery [ 2 , 5 ] , and neuron networks [ 6 , 7 ] . the equipment provided by control engineers includes , but is not limited to , nanodevices , biochips , cuvettes for electroporation , and gene guns . biologists perform various biological experiments , such as protein synthesis and virus dna modifications , to gather measurements for model revisions and verifications , to conclude theoretical and practical results from evidence , and to help medical practice . doctors use both theoretical and practical results from biologists to perform tissue engineering , such as organ transplants and artificial tissue construction . according to their scales , biological systems can be divided into three levels : the molecular level ( nm ) , cellular level ( m ) , and tissue level ( cm ) , analogous to the part , individual , and group , respectively . molecular - level research focuses on how , when , where , and to what extent a gene is expressed . the essential goal is to sketch a complete blueprint of genes by identifying the control sequences of coding dna segments and their interactions . cellular level research , in general , treats one cell as a plant in classical control theory and investigates the reactions of the cell to the changing environment , for instance , concentration changes of related chemicals . state - of - the - art medical therapies are primarily based on experimental results at the cellular level . tissue - level research mainly concerns tissue reconstruction , artificial tissue substitutes , or tissue function recovery . in contrast , understanding biological systems at the molecular level is crucial , since species have the same basic inheritance , dna macromolecules , and follow a common rule in gene expression , the central dogma in molecular biology . molecular level understanding of biological systems provides instrumental information about radical causes of many diseases and the genetic evidence of evolution . it also helps biologists to gain a better understanding of molecular level interactions , draw a complete blueprint of gene networks , improve existing means , create novel means to cure genetic diseases , and to elaborate on the theory of evolution . recent technology in gene sequencing makes it possible to conquer the difficulty in measurement at the molecular level and to identify the nucleotide sequences of a particular dna segment . targeted sequencing is the most promising step toward maximizing the efficiency of the next - generation sequencing technology using polymerase chain reaction . the availability of dna microarray makes it possible to accomplish tens of thousands of genetic tests for picomoles ( 10 ) of a specific dna sequence . researchers have applied various methods to model , simulate , and control the gene regulation processes . early attempts to model and simulate gene regulatory systems are summarized in , including direct graphs , bayesian networks , boolean networks , ordinary and partial different equations , qualitative differential equations , quantative differential equations , stochastic equations , and role - base formalisms . other approaches include petri nets , transformational grammars [ 12 , 13 ] , and process algebra . three important modeling methods in recent work are gene regulatory units viewed under compound control [ 4 , 1518 ] , logic network models [ 19 , 20 ] , and base - to - base molecular - level formulation [ 21 , 22 ] . the first modeling method quantitatively describes chemical concentration variations corresponding to external environmental changes at the cellular level . the last modeling converts dna segments to discrete vectors . in our paper , we adapt the base - to - base molecular level formulation to express state variables . most existing models are constructed by data - driven or hypothesis - driven methods , with only partial information available . due to the complexity of the systems and incomplete information , the mathematical models are usually formulated by modifying empirical equations or proposing heuristic equations . although those models can disclose significant details of the system 's structure and dynamics , the inconsistency between theoretical and experimental results creates difficulties for control engineers to verify the models , develop optimal controls , and reconstruct systems with desired properties . in this paper , we use a novel approach to build up abstract mathematical models at the molecular level in section 2.2 , based directly on biological theory . with reasonable assumptions different from existing methods , focusing on a gene or changes in chemical concentration , we emphasize the base change in the nucleotide bases . the cost function , a summation of costs for applying mutagens and the off - trajectory penalty , together with the system equations , formulates the optimal control problem . section 3 shows simulation results of the optimal control problem at different scales and is followed by several important propositions . the central dogma of molecular biology , first elaborated in and restated in , illustrates the detailed residue - by - residue transfer of genetic sequential information . nowadays , it describes the genetic information flow among three kinds of biopolymers : dna , rna , and protein . in most living organisms , this process is usually irreversible , thus protein always acts as the sink of information flow . a codon consists of three consecutive nucleotide bases , corresponding to one amino acid according to the genetic codes . since there are only 20 kinds of amino acids and 64 combinations of codons , there exists redundancy in genetic codes . we are particularly interested in mutations that happen during the process of dna replication , as dna serves as long - term genetic information storage and is the basis of genetic inheritance , the accuracy of which is particularly important to ensure the correct expression of genes . dna molecules consist of four kinds of nucleotide acids , adenine ( a ) , thymine ( t ) , guanine ( g ) , and cytosine ( c ) , and a backbone made of sugars and phosphate . in 1953 , james d. watson and francis crick found the double helix structure of dna and the rule of basepairing , known as watson - crick basepairing [ 25 , 26 ] . a always pairs with t , g always pairs with c , and vice versa . in nature , replication errors occur at a very low rate , one error for every 10 nucleotides added . the redundancy of information caused by the double - helix structure ensures the accuracy of dna replication . some dna self - repair mechanisms , listed in , such as proofreading , also help to eliminate errors during the replication process . point mutations can be further divided into transitions ( ag or ct ) and transversions ( a / gc / t ) . transversions are theoretically expected to be twice as frequent as transitions , but transitions may be favored over transversions in coding dna because they usually result in a more conserved polypeptide sequence . in this section , we first give the problem statement in section 2.1 , and then we construct system equations for both deterministic and stochastic mutations in section 2.2 . at last , in section 2.3 , we formulate the optimal control problem and apply dynamic programming algorithm to solve it . figure 3 shows the system diagram of restoring an abnormal dna segment back to a normal sequence by applying mutagens during the process of dna replication . after we obtain a patient 's genome , we compare the coding dna segments with normal dna segments in our database to figure out the possible range of mutated segments . due to the redundancy in genetic codes , as long as any two dna segments can be transcribed and then translated to the same amino acid sequence , the distance reference between them is considered to be zero . therefore , instead of having a predetermined final state or a neighborhood of a final state , our final state lies in a set where the distance reference between any sequence in this set and the desired sequence is zero . the prescription is then determined by comparing the current measurement and every sequence in the desired set . we treat dna sequences as state variables , the on / off controls of all available mutagens at every spot on the given dna segment as inputs , the measurements as the outputs , and one cell cycle as the step increment in our system equations . the objective function is defined as a summation of the costs ( including risks ) of applying mutagens and the off - trajectory penalty . the optimal control sequences are computed beforehand to let doctors make treatment plans according to the patient 's condition . in general , the optimal control sequence and the corresponding optimal trajectory are not unique because the bases mutate independently in most cases and the order of mutating different bases does not matter if the number of medical treatment sessions is not under a tight restriction . additional measurements are taken before and after each treatment , if necessary . in deterministic cases , the purpose of taking additional measurements is to check the current sequence and to eliminate both internal and external disturbances . in stochastic settings , the measurements are taken to conquer the randomness caused by both mutagens and other noises . , our system is a discrete - time dynamic system with finite state space and output space , and a set of on / off switches as controls . our goal is to optimally drive this system from a given initial state to a desired final set at the lowest cost . we mainly focus on applying chemical mutagens and radiation to restore the original amino acid sequence during the process of dna replication . other factors that may affect the gene mutation , including temperature and electroporation , are not within our consideration . in addition , we assume that chemical mutagens or radiation target one and only one nucleotide base at any preset site , despite the technical limitation , and the results of applying chemical mutagens and radiation are independent . for simplicity , we normalize the dose of mutagens to transfer one nucleotide base to another in one step to 1 . in most cases , nucleotide bases mutate independently , therefore there is no chain effect caused by mutagens . to avoid reactions among different mutagens , we require that at most one chemical mutagen and one radiation be applied in each cell cycle . while constructing a generalized model , since the order of applying chemical mutagens and radiation does not affect the results , without loss of generality , we require they be applied in the order shown in figure 4 . that is , chemical mutagens are always applied before the duplication process starts , radiation is always applied in the middle of the cell cycle , and the measurements are taken before every replication starts . lastly , we assume that the measurements are always correct , and dna replication error , background mutation rate , and other random noise can be eliminated from measurements by considering them as spontaneous mutation . denote the targeted dna segment with n nucleotide bases at kth step by a column vector x k , as shown in figure 5 . x k is the ith element of x k. let p be the transfer matrix from x k to x k+1 , for all k , k { 0 } , without mutation . then , the perfect dna replication process can be expressed as proposition 1 p = i . proofas no mutation occurs , x k+1 is completely complementary to x k by watson - crick base pairing rule , and x k+2 is completely complementary to x k+1 . therefore , x k+2 is exactly the same as x k. thus , ( 2)xk+2=pxk+1=p2xkp2=i . since every base mutates independently , every element of x k+1 only depends on the corresponding element of x k , thus p is diagonal . in addition , x k+1 x k , we conclude p = i . as no mutation occurs , x k+1 is completely complementary to x k by watson - crick base pairing rule , and x k+2 is completely complementary to x k+1 . therefore , x k+2 is exactly the same as x k. thus , ( 2)xk+2=pxk+1=p2xkp2=i . since every base mutates independently , every element of x k+1 only depends on the corresponding element of x k , thus p is diagonal . in addition , x k+1 x k , we conclude p = i . based on proposition 1 , we assign values to nucleotide bases set { a , g , c , t , o } , where o is an artificial nonsense base . define an equivalence relationship between { a , g , c , t , o } and { 1,2 , 2 , 1,0 } , that is , { a , g , c , t , o}{1,2 , 2 , 1,0 } , with ( 3)xki={1,if a,2,if g,2,if c,1,if t,0,if o. proposition 2{1,2 , 2 , 1,0 } is a field under proper definitions of addition and multiplication . { 1,2 , 2 , 1,0 } is a field under proper definitions of addition and multiplication . proofdefining the addition table and multiplication table as in tables 1 and 2 , we check if the set { 1,2 , 2 , 1,0 } satisfies the definition of field . defining the addition table and multiplication table as in tables 1 and 2 , we check if the set { 1,2 , 2 , 1,0 } satisfies the definition of field . commutativity of addition and multiplicationsatisfied as tables 1 and 2 are symmetric according to the diagonal . additive and multiplicative inversesadditive inverses pair : 11 , 22 , 00.multiplicative inverses pair : 11 , 22 , 11 . we conclude { 0,1 , 2 , 2 , 1 } is a field under addition and multiplication defined by tables 1 and 2 . from now on , we use to denote the field { 0,1 , 2 , 2 , 1}. and x k is the state vector representing a dna segment with n nucleotide bases , where is the set of -valued vectors of dimension n. we start with the simplest form of mutations , point mutation . suppose there is a point mutation , we write it mathematically as ( 4)xk+1=(i+s)xk+w , where x k+1 , x k , and i reduces to 1 as only one base is involved . the corresponding values of s and w , obtained by reverse engineering with all possible pairs of x k and x k+1 , are listed in table 3 . here , s represents the mutation from four normal nucleotide bases , and w corresponds to mutation from nonsense base , that is , w 0 only if x k = 0 . rewriting ( 4 ) by collecting all values of s and w in table 3 , we get ( 5a)xk+1=(i+j=04ukjsj)xk+j=04ckjwj ( 5b)=(i+uks)xk+ckw , where { s 0 , s 1 , s 2 , s 3 , s 4 } = { w 0 , w 1 , w 2 , w 3 , w 4 } = { 0,1 , 2 , 2 , 1 } , u k , c k { 0,1 } , representing the on / off controls , u k = [ u k u k u k u k u k ] , c k = [ c k c k c k c k c k ] , and s = w = [ 0 1 2 2 1 ] . in ( 5a ) , s j and w j are constants for all k and j. u k and c k , the inputs of the system , are the on / off controls for chemical mutagens or radiation . clearly , j=0 c k = 1 only if x k = 0 . equation ( 5b ) is a simplified version of ( 5a ) as we put u k , s j , c k , w j into vector form u k , s , c k , w. s and w serve as vector basis for base - to - base deterministic model . u k and c k are now multi - input controls ; each of them contains 5 on / off controls , corresponding to all possible transfer patterns . for a particular k , at most one of u k s and c k s can be 1 , as stated in proposition 3 . this is consistent with the fact that every state can be transferred to only one of the five states in the state space with corresponding mutagens available . proposition 3it is always 1 1 transfer when mutation occurs , that is , one nucleotide base can only transfer to another one , thereforeif x k = 0 and c k = 0 , or c k = [ 1 0 0 0 0 ] , then x k+1 = 0,if x k 0 , then c k = 0 and u k is either 0 or a unit row vector , if x k = 0 , then u k = 0 and c k is either 0 or a unit row vector , u k + c k is either 0 or a unit row vector , for all k { 0}. it is always 1 1 transfer when mutation occurs , that is , one nucleotide base can only transfer to another one , thereforeif x k = 0 and c k = 0 , or c k = [ 1 0 0 0 0 ] , then x k+1 = 0,if x k 0 , then c k = 0 and u k is either 0 or a unit row vector , if x k = 0 , then u k = 0 and c k is either 0 or a unit row vector , u k + c k is either 0 or a unit row vector , for all k { 0}. if x k = 0 and c k = 0 , or c k = [ 1 0 0 0 0 ] , then x k+1 = 0 , if x k 0 , then c k = 0 and u k is either 0 or a unit row vector , if x k = 0 , then u k = 0 and c k is either 0 or a unit row vector , u k + c k is either 0 or a unit row vector , for all k { 0}. now , suppose for some reason we need to take an addition , measurement in the middle of the cell cycle , after the completion of the kth duplication and before the start of the ( k + 1)th . we name this kind of measurement an intermediate state , and denote by it x k. then , we have ( 6)xk+1=(i+s ) xk+w , where the values of s and w , listed in table 4 , are obtained in the same way as getting s and w in table 3 . comparing tables 3 and 4 , we find the collection of s and s , w and w , form the same set , respectively . thus , we continue using s and w when rewriting ( 6 ) in the form of ( 5a ) and ( 5b ) , that is , ( 7)xk+1=(i+vks)xk+ckw , where v k , c k are the counterparts of u k , c k , respectively , and s , w are the same as in ( 5b ) . similar to proposition 3 , we get proposition 4 . proposition 4 v k and c k in ( 7 ) need to satisfy the following conditions.if x k = 0 and c k = 0 , or c k = [ 1 0 0 0 0 ] , then x k+1 = 0.if x k 0 , then c k = 0 and v k is either 0 or a unit row vector.if x k = 0 , then v k = 0 and c k is either 0 or a unit row vector . v k + c k is either 0 or a unit row vector , for all k { 0}. v k and c k in ( 7 ) need to satisfy the following conditions.if x k = 0 and c k = 0 , or c k = [ 1 0 0 0 0 ] , then x k+1 = 0.if x k 0 , then c k = 0 and v k is either 0 or a unit row vector.if x k = 0 , then v k = 0 and c k is either 0 or a unit row vector . v k + c k is either 0 or a unit row vector , for all k { 0}. if x k = 0 and c k = 0 , or c k = [ 1 0 0 0 0 ] , then x k+1 = 0 . if x k 0 , then c k = 0 and v k is either 0 or a unit row vector . if x k = 0 , then v k = 0 and c k is either 0 or a unit row vector . v k + c k is either 0 or a unit row vector , for all k { 0}. now take , both chemical mutagens and radiative rays under our consideration and apply them in the order as shown in figure 4 . then , we can express our system equation as ( 8a)xk=(i+uksmutations caused by chemicalmutagens from normal bases)xk + ckwmutations caused by chemicalmutagens from o , ( 8b)xk+1=(i+vksmutations caused by radiativerays from normal bases)xk + ckwmutations caused by radiativerays from o , ( 8c ) yk = xk , where u k and v k are the inputs of the system and y k is the measurement . obviously , ( 8a ) is modified from ( 5b ) and ( 8b ) from ( 7 ) . the two - step mutation and the intermediate state x k avoid the case x k is changed to different bases by radiation and chemical mutagens simultaneously , which causes confusion . substituting ( 8a ) and ( 8b ) , we get ( 9a)xk+1=(i+vks)(i+uks)xk+(i+vks)ckw+ckw , ( 9b)yk = xk . obviously , proposition 3 still holds for u k and c k , and proposition 4 holds for v k and c k for ( 9a ) . for point mutations , we have 20 on / off controls in total for every step k , 10 for chemical mutagens as described before , and the rest for radiation . in general , now , we show how to extend our model to large - scale systems . suppose we have a coding dna segment with length n , then x k . since a coding dna segment usually contains integer number of codons , which is made of three consecutive bases , n is a multiple of 3 . let x k denote the ith component of x k. this notation is consistent with the one in section 2.2.1 . initiated by the base - to - base deterministic model from section 2.2.1 , we write our system equation for large - scale system as ( 10 ) xk=(i+i=1nukiskimutations caused by chemicalmutagens from normal bases)xk + ikckiwkimutations caused by chemicalmutagens from o , xk+1=(i+i=1nvkiqkimutations caused by radiative raysfrom normal bases)xk + ikbkirkimutations caused by radiativerays from o , yk = xk , where u k , v k , c k , b k are on / off controls of the ith element , s k , q k are n n square matrices corresponding to the mutations between normal bases or from normal bases by chemicals and radiation , respectively , w k , r k are n - dimensional column vectors representing mutations from nonsense bases by chemicals and radiation , respectively , and k = { i : x k = 0,1 i n } , k = { i : x k = 0,1 i n}. s k and q k are diagonal matrices since each base mutates independently . the values in the first four rows of tables 3 and 4 correspond to the diagonal elements of s k and q k , respectively . the last rows of tables 3 and 4 are assigned to w k and r k , n - dimensional vectors , at nonsense base 's spots for x k. define = { s j e i e i , i , j , 0 j 4,1 i n } , a collection of n n matrices , where s j is the same as in ( 5a ) and ( 5b ) , e i is the unit column vector of length n with ith component equal to 1 and all other components equal to 0 , and e i e i is the square matrix with only the ith element on the diagonal equals to 1 , and 0 otherwise . then , s k , q k can be written as linear combinations of all elements from , with the coefficient of each element either 0 or 1 corresponding to the on / off control u k and v k , respectively . similarly , define = { w j e i , i , j , 0 j 4,1 i n } , where w j is the same as ( 5a ) and ( 5b ) . w k , r k can be written as linear combinations of all components from , with coefficient of every component either 0 or 1 corresponding to the on / off control c k and c k , respectively . therefore , instead of using step - varying s k , s k , w k , r k , we find matrix basis for those four square matrices to make the controls to be the only variables depending on k , as we did for single - base cases . then , we can , write ( 10 ) as ( 11a)xk=(i+i=1n j=04uk(i , j)sjeieit)xk+ik j=04ck(i , j)wjei , ( 11b)xk+1=(i+i=1n j=04vk(i , j)sjeieit)xk+ik j=04ck(i , j)wjei , ( 11c)yk = xk , where u k , v k , c k , c k { 0,1}. as shown in ( 11a ) , ( 11b ) , and ( 11c ) , multisites mutations contain 20n controls in total for every step k , where n is the number of nucleotide bases on the targeted gene . similar to point mutations , every single site has 20 controls in each step , 10 for chemical mutagens and 10 for radiation . we can view u k , v k , c k , c k as binary matrices of dimension n 5 , and u k , v k c k , c k are the corresponding element of ith row and jth column . use u k , v k , c k , b k , binary row vectors of dimension 5 , to denote the ith row of u k , v k , c k , c k , respectively . again , s = w = [ 0 1 2 2 1 ] . combining ( 11a ) and ( 11b ) , and writing control variables in vector forms , we get ( 12)xk+1=(i+i=1nvkiseieit)(i+i=1nukiseieit)xk + ( i+i=1nvkiseieit)ikckiwei+ikbkiwei , yk = xk . proposition 5for large - scale deterministic system , u k , v k , c k , c k satisfy conditions below.if e i x k = 0 , then i k.if e i x k = 0 , c k = 0 or c k = [ 1 0 0 0 0 ] , then i k.for all i k , u k is either 0 or a row unit vector and c k = 0.for all i k , c k is either 0 a row unit vector and u k = 0.for all i k , v k is either 0 or a row unit vector and b k = 0.for all i k , b k is either 0 or a row unit vector and v k = 0.for all i , k , 1 i n , k { 0 } , u k + c k is either 0 or a unit row vector and v k + b k is either 0 or a unit row vector . for large - scale deterministic system , u k , v k , c k , c k satisfy conditions below.if e i x k = 0 , then i k.if e i x k = 0 , c k = 0 or c k = [ 1 0 0 0 0 ] , then i k.for all i k , u k is either 0 or a row unit vector and c k = 0.for all i k , c k is either 0 a row unit vector and u k = 0.for all i k , v k is either 0 or a row unit vector and b k = 0.for all i k , b k is either 0 or a row unit vector and v k = 0.for all i , k , 1 i n , k { 0 } , u k + c k is either 0 or a unit row vector and v k + b k is either 0 or a unit row vector . if e i x k = 0 , then i k. if e i x k = 0 , c k = 0 or c k = [ 1 0 0 0 0 ] , then i k. for all i k , u k is either 0 or a row unit vector and c k = 0 . for all i k , c k is either 0 a row unit vector and u k = 0 . for all i k , v k is either 0 or a row unit vector and b k = 0 . for all i k , b k is either 0 or a row unit vector and v k = 0 . for all i , k , 1 i n , k { 0 } , u k + c k is either 0 or a unit row vector and v k + b k is either 0 or a unit row vector . the mathematical model ( 12 ) is quite flexible and can be easily extended to many cases , such as transcription process , multiple spot mutations within one - step or broken dna strands . our system equation can represent this phenomenon by dividing the whole system into small subsystems . significant brokage of dna strands is simply eliminated by cell mechanism to ensure the accuracy to dna replication . equation ( 13 ) shows the case of one single dna strand breaking into two segments by chemical mutagens ( 13)(xk(1)xk(2))=(im+i=1mukiseieit00inm+i = m+1nukiseieit ) (xk(1)xk(2))+ ( ik,1imckiweiik , ( m+1)inckiwei),xk+1(1)=(im+i=1mvkiseieit)xk(1)+ik , 1imbkiwei , xk+1(2)=(inm+i = m+1nvkiseieit)xk(2 ) + ik , ( m+1)inbkiwei . in reality , therefore , we need to derive the model for gene - to - gene stochastic mutations . introduce new random variables , h k , l1 , r k , l2 , h k , l3 , r k , l4 { 0,1 } , associated with probability p l1,j , p l2,j , p l3,j , p l4,j , for all i , k , 1 i n , k { 0 } , respectively , where k is the step index , l 1 , l 2 are indices for chemical mutagens inducing mutation from normal bases and from o , respectively , l 3 , l 4 are indices for radiation inducing mutation from normal bases and from o , respectively , i is the index of dna segment , and the value of j corresponds to the transfer pattern , which can be found in tables 3 and 4 . note different mutagens have different probability assignments , the probability assignments are only related to the type of mutagens , and the probability associated with every kind of mutagens sums up to 1 , that is , ( 14)j=04pl1,j(h)=1 , l1 , 1l1l,j=04pl2,j(r)=1 , l2 , 1l2m,j=04pl3,j(h)=1 , l3 , 1l3l,j=04pl4,j(r)=1 , l4 , 1l4m. the controls are u k , l1 , c k , l2 , v k , l3 , b k , l4 { 0,1 } , with the fact that 1 representing mutagen with corresponding index is applied at ith spot of dna segment at kth generation , and 0 representing mutagen with corresponding index is not applied at spot i at kth step , similar to sections 2.2.1 and 2.2.2 . the mutagen indices l 1 , l 2 , l 3 , l 4 can be omitted in deterministic mutations since given the current state and control , the next state is unique . however , they are necessary for stochastic mutations , because there exist multiple possible states for the next stage given the control . in other words , the next state is determined by random variables h k , l1 , r k , l2 , h k , l3 , r k , l4 , given the values of u k , l1 , c k , l2 , v k , l3 , b k , l4 , and x k. suppose we have ( l + m ) kinds of chemical mutagens available , with l kinds to induce mutations from normal bases and m kinds to induce mutations from o. and we have ( l + m ) kinds of radiation available , with l kinds to induce mutations from normal bases and m kinds to induce mutations from o. therefore , we have total ( l + m + l + m ) controls for each spot i at each step k. we can write our system equation as ( 15a)xk=(i+l1=1l i=1nuk , l1ij=04hk , l1(i , j)sjeieitmutations caused by chemical mutagens from normal bases)xk + l2=1 m ikck , l2ij=04rk , l2(i , j)wjeimutations caused by chemicalmutagens from o , ( 15b)xk+1=(i+l3=1l i=1nvk , l3ij=04hk , l3(i , j)sjeieitmutations caused by radiative rays from normal bases)xk + l4=1m ikbk , l4ij=04rk , l4(i , j)wjeimutations caused by radiative rays from o , ( 15c ) yk = xk . again , we define h k , l1 , r k , l2 , h k , l3 , r k , l4 the elements at ith row and jth column of n 5 binary matrices h k , l1 , r k , l2 , h k , l3 , r k , l4 , respectively . h k , l1 , r k , l2 , h k , l3 , r k , l4 , and binary row vectors of dimension 5 denote the ith row of h k , l1 , r k , l2 , h k , l3 , r k , l4 , respectively . then , we can simplify ( 15a ) , ( 15b ) , and ( 15c ) and combine ( 15a ) and ( 15b ) as ( 16)xk+1=(i+l3=1l i=1nvk , l3ihk , l3iseieit ) (i+l1=1l i=1nuk , l1ihk , l1iseieit)xk + ( i+l3=1l i=1nvk , l3ihk , l3iseieit)l2=1 m ikck , il2rk , l2iwei + l4=1m ikbk , l4irk , l4iwei , yk = xk . proposition 6for large - scale stochastic system , u k , l1 , h k , l1 , c k , l2 , r k , l2 , v k , l3 , h k , l3 , b k , l4 , r k , l4 follow the rules below.if e i x k = 0 , then i k.if e i x k = 0 and l2=1 c k , l2 = 0 , then i k.if e i x k = 0 , l2=1 c k , l2 = 1 and r k , l2 = [ 1 0 0 0 0 ] , then i k.for all i , k , l 1 , 1 i n , k { 0},1 l 1 l , if u k , l1 = 1 , then h k , l1 is a unit row vector.for all i , k , l 2 , 1 i n , k { 0 } , 1 l 2 m , if c k , l2 = 1 , then r k , l2 is a unit row vector.for all i , k , l 3 , 1 i n , k { 0 } , 1 l 3 l , if v k , l3 = 1 , then h k , l3 is a unit row vector.for all i , k , l 4 , 1 i n , k { 0 } , 1 l 4 m , if b k , l4 = 1 , then rk , l4 is a unit row vector.for all i k , l1=1 u k , l1 = 0 or 1 and c k , l2 = 0 , for all l 2 , 1 l 2 m.for all i k , l2=1 c k , l2 = 0 or 1 and u k , l1 = 0 , for all l 1 , 1 l 1 l.for all i k , l3=1 v k , l3 = 0 or 1 and b k , l4 = 0 , for all l 4 , 1 l 4 m.for all i k , l4=1 b k , l4 = 0 or 1 and v k , l3 = 0 , for all l 3 , 1 l 3 n , k { 0 } , l1=1 u k , l1 + l2=1 c k , l2 = 0 or 1 and l3=1 v k , l3 + l4=1 b k , l4 = 0 or 1 . for large - scale stochastic system , u k , l1 , h k , l1 , c k , l2 , r k , l2 , v k , l3 , h k , l3 , b k , l4 , r k , l4 follow the rules below.if e i x k = 0 , then i k.if e i x k = 0 and l2=1 c k , l2 = 0 , then i k.if e i x k = 0 , l2=1 c k , l2 = 1 and r k , l2 = [ 1 0 0 0 0 ] , then i k.for all i , k , l 1 , 1 i n , k { 0},1 l 1 l , if u k , l1 = 1 , then h k , l1 is a unit row vector.for all i , k , l 2 , 1 i n , k { 0 } , 1 l 2 m , if c k , l2 = 1 , then r k , l2 is a unit row vector.for all i , k , l 3 , 1 i n , k { 0 } , 1 l 3 l , if v k , l3 = 1 , then h k , l3 is a unit row vector.for all i , k , l 4 , 1 i n , k { 0 } , 1 l 4 m , if b k , l4 = 1 , then rk , l4 is a unit row vector.for all i k , l1=1 u k , l1 = 0 or 1 and c k , l2 = 0 , for all l 2 , 1 l 2 m.for all i k , l2=1 c k , l2 = 0 or 1 and u k , l1 = 0 , for all l 1 , 1 l 1 l.for all i k , l3=1 v k , l3 = 0 or 1 and b k , l4 = 0 , for all l 4 , 1 l 4 m.for all i k , l4=1 b k , l4 = 0 or 1 and v k , l3 = 0 , for all l 3 , 1 l 3 l.for all i , k , 1 i n , k { 0 } , l1=1 u k , l1 + l2=1 c k , l2 = 0 or 1 and l3=1 v k , l3 + l4=1 b k , l4 = 0 or 1 . if e i x k = 0 , then i k. if e i x k = 0 and l2=1 c k , l2 = 0 , then i k. if e i x k = 0 , l2=1 c k , l2 = 1 and r k , l2 = [ 1 0 0 0 0 ] , then i k. for all i , k , l 1 , 1 i n , k { 0},1 l 1 l , if u k , l1 = 1 , then h k , l1 is a unit row vector . for all i , k , l 2 , 1 i n , k { 0 } , 1 l 2 m , if c k , l2 = 1 , then r k , l2 is a unit row vector . for all i , k , l 3 , 1 i n , k { 0 } , 1 l 3 l , if v k , l3 = 1 , then h k , l3 is a unit row vector . for all i , k , l 4 , 1 i n , k { 0 } , 1 l 4 m , if b k , l4 = 1 , then rk , l4 is a unit row vector . for all i k , l1=1 u k , l1 = 0 or 1 and c k , l2 = 0 , for all l 2 , 1 l 2 m. for all i k , l2=1 c k , l2 = 0 or 1 and u k , l1 = 0 , for all l 1 , 1 l 1 l. for all i k , l3=1 v k , l3 = 0 or 1 and b k , l4 = 0 , for all l 4 , 1 l 4 m. for all i k , l4=1 b k , l4 = 0 or 1 and v k , l3 = 0 , for all l 3 , 1 l 3 l. for all i , k , 1 i n , k { 0 } , l1=1 u k , l1 + l2=1 c k , l2 = 0 or 1 and l3=1 v k , l3 + l4=1 b k , l4 = 0 or 1 . we close this section with the definition of controllability to the system equations proposed above . dna replication systems with system equations proposed as ( 9a ) , ( 9b ) , ( 12 ) , and ( 16 ) are completely controllable if and only if for all x 0 , x 2k1 , x 2k2 + 1 , k 1 , k 2 { 0 } , at least one path from x 0 to x 2k1 and at least one path from x 0 to x 2k2 + 1 by applying proper mutagens in the correct order , with k 1 , k 2 finite . we first define our objective function that can be adapted to all kinds of systems proposed in section 2.2 with minor changes . mathematically , in systems where the controllable parameters of interest are discrete , the objective function is usually a weighted sum representing the number of times that a piece of equipment is turned on or off or the number of resources needed to execute certain tasks in the frequent cases . in our case , this summation is the total number of times that different mutagens are applied weighted by the corresponding cost ( including the risk ) . another key factor of objective function is the off - trajectory penalty . designing a trajectory if the measurement indicates that the current state is off the predefined trajectory , we include a distance reference between current state and desired state as penalty and change the treatment plan accordingly . therefore , our objective function can be expressed as ( 17)j0(x0)=minu , c , v , c h , h,r , r[k=0n1l1=1li=1nl1uk , l1i+k=0n1l2=1mi=1nl2ck , l2icost of applying chemical mutagens + k=0n1l3=1li=1nl3vk , l3i+k=0n1l4=1mi=1nl4bk , l4icost of applying radiative rays + k=0nd(xk,{xkd})tracing cost ] , with x 0 , x k , 1 k n , n 0 ( mod 3 ) given . the physical meaning of u k , l1 , c k , l2 , v k , l3 , b k , l4 , l 1 , l 2 , l 3 , l 4 is the same as in section 2.2.3 . l1 , l2 , l3 , l4 , for all l 1 , l 2 , l 3 , l 4 , 1 l 1 1 l 2 m , 1 l 3 l , 1 l 4 m , are the corresponding cost of applying chemical mutagens and radiative rays indexed l 1 , l 2 , l 3 , l 4 , respectively . { x k } : { 0 } denotes the desired set at kth stage , generated by the dna sequences representing the same amino acid sequence as x k , the desired state at kth step . and d(x k , { x k } ) is the distance reference of the current state x k to the desired set { x k } at kth step . the final penalty , the distance reference from the final state to the desired set at k = n , is included in the last term . in general , l2 , l4 l1 , l3 , for all l 1 , l 2 , l 3 , l 4 , 1 l 1 l , 1 l 2 m , 1 l 3 l , 1 l 4 m , because physically o is a set of nonsense bases and more details are necessary to convert an o back to normal bases , for instance , the cost to identify the exact element in the set o. our goal is to drive our system optimally from initial state x 0 to the desired final set { x n } by applying a sequence of mutagens indexed with { l 1 , l 2 , l 3 , l 4 } , at problematic positions i , and in a correct order k. in ( 17 ) , the first four terms inside the expectation do not depend on random variables h k , l1 , r k , l2 , h k , l3 , and r k , l4 , for all i , k , l 1 , l 2 , l 3 , l 4 as the treatment plan is computed based on the initial state x 0 . given y k , the last term inside expectation , k=0 d(x k , { x k } ) , is the only term in summation that depends on the distribution of the random variables . the constraint of the optimal control problem , in general , is the system equation . we choose multidimensional stochastic system equation as the generalized constraints as it can be degenerated to one - dimensional and multidimensional deterministic cases by proper modifications . therefore , we can rewrite our objective function and formulate our optimal control problem as ( 18)j0(x0)=min{u , c , v , c}0,1, ,n1[k=0n1l1=1li=1nl1uk , l1i+k=0n1l2=1mi=1nl2ck , l2i + k=0n1l3=1li=1nl3vk , l3i+k=0n1l4=1mi=1nl4bk , l4i + k=0n{h , r , h,r}0,1, ,n1[d(xk,{xkd } ) ] ] , subject to ( 19)xk+1=(i+l3=1li=1nvk , l3ihk , l3iseieit ) (i+l1=1li=1nuk , l1ihk , l1iseieit)xk + ( i+l3=1li=1nvk , l3ihk , l3iseieit)l2=1mikck , l2irk , l2iwei + l4=1mikbk , l4irk , l4iwei , yk = xk . we need to choose a proper distance reference to quantitatively describe the relationship between dna segments of same length . we first define the distance reference between codons , and the distance reference between dna segments is a weighted sum of distance reference between every pair of codons . the distance reference between codons , d( 1 , 2 ) , 1 , 2 , needs to fulfill the biological requirements as below . mathematically , d : { 0 } , d( 1 , 2 ) 0 . symmetry : the distance reference from codon 1 to codon 2 equals the distance reference from codon 2 to codon 1 , that is , d( 1 , 2 ) = d( 2 , 1 ) . the distance reference between two codons corresponding to different amino acids should reveal the chemical and physical differences between two amino acids . the distance reference from stop codons to all other codons is much larger than those between other codons as early termination of amino acid sequences is more harmful than other forms of mutations . all the existing metric defined on the finite field can not achieve all the requirements above . the second requirement violates the identity of indiscernible , that is , d( 1 , 2 ) = 0 if and only if 1 = 2 . the redundancy in genetic codes implies d( 1 , 2 ) = 0 if those two amino acids , 1 and 2 , are translated into the same amino acids . in addition , the triangular inequality is not necessarily true , according to the underlying physical meanings . we take the assumption that the stop codons are of the same distance reference from and to all other codons . we ignore codons containing o since their chemical and physical properties can not be found in literature . from table 5 , we can see all codons are divided into different sets with each set corresponding to one amino acid . the size and this implies that the costs of driving one codon to the desired final set generated by the desired final state might be different from the costs of driving the complementary codon to the desired final set generated by the complementary of desired final state . more discussions about this issue are presented in section 3 . the distance reference between any two codons can be defined by a weighted sum of the differences between physical and chemical properties or other reasonable functions . and the distance reference between two dna sequences is defined as the sum of distance reference between the corresponding pair of codons . an example of the distance function can be expressed as ( 20)d(1,2)=polarity polarity(1,2 ) + ph ph(1,2)+size size(1,2),polarity(1,2 ) = { 0if 1,2 are both polar or non - polar,1if one of 1,2 is polar , and the other non - polar , ph(1,2 ) = |ph value of 1ph value of 2|,size(1,2 ) = { 0,if 1,2 are both tiny , small , or normal,1,if one of 1,2 is tiny , and the other small,2,if one of 1,2 is tiny , and the other normal,3,if one of 1,2 is small , and the other normal , where 1 , 2 are two amino acids . d( 1 , 2 ) is then assigned to d( 1 , 2 ) with 1 , 2 corresponding to amino acids 1 , 2 , respectively . since the generalized optimal control problem in ( 18 ) and ( 19 ) is a multistage problem that can be broken down into simpler steps at different time points . for dynamic programming , the optimal control policy is constructed backward . and bellman 's principle of optimality states that the optimal policy for x 0 to { x n } is also the optimal policy for the tail problem , from x q to { x n } . the tail problem is defined as ( 21)jq(xq)=min{u , c , v , c}q , q+1, ,n1{k = qn1l1=1li=1nl1uk , l1i+k = qn1l2=1mi=1nl2ck , l2i + k = qn1l3=1li=1nl3vk , l3i+k = qn1l4=1mi=1nl4bk , l4i + k = qn{h , r , h,r}q , q+1, ,n1[d(xk,{xkd})]}. the iterative update equation to find optimal policy can be expressed by ( 22 ) , according to the dynamic programming algorithm in . ( 22)jn(xn)=d(xn,{xnd}),jq(xq)=minuq , cq , vq , cq hq , rq , hq,rq[l1=1li=1nl1uq , l1i+l2=1mi=1nl2cq , l2i+l3=1li=1nl3vq , l3i + l4=1mi=1nl4cq , l4i+d(xq,{xqd})+jq+1(xq+1)]=minuq , cq , vq , cq{l1=1li=1nl1uq , l1i+l2=1mi=1nl2cq , l2i+l3=1li=1nl3vq , l3i + l4=1mi=1nl4cq , l4i + hq , rq , hq,rq[d(xq,{xqd})+jq+1(xq+1 ) ] } , q=0,1, ,n1 . in the following examples , we consider applying chemical mutagens only because the randomness of applying radiation is much larger and more difficult to control . we also omit the mutations between a normal base and o because of high - cost l2 and the unavailable chemical and physical properties for codons containing o. the distance reference between codons used in sections 3.2 and 3.3 is computed by ( 20 ) with polarity = 8 , ph = 3 , size = 1 , 1 = 2 , 2 = 5 and 3 = 3 . we only keep the final penalty but omit the off - trajectory penalty along the trajectory . we define the distance reference between bases as ( 23)d(1,2)={0,if xn = xnd,,if xnxnd , with 1 , 2 {0 } , where {0 } denotes the set excluding the element 0 . our optimal control problem for point mutations is ( 24)j0(x0)=minuk , l1 , 0kn , 1l1l{k=0n1 l1=1ll1uk , l1 } , subject to ( 25)xk+1=(i+l1=1luk , l1s)xk , xn = xnd , with x 0 given , x k {0}. suppose that there are 12 kinds of mutagens ( l 1 = 12 ) , each corresponding to a specific transfer pattern as in table 6 , all available controls and the respective costs can be immediately listed as in tables 7 and 8 . the elements along the antidiagonal of table 7 , u at , u gc , u cg , and u ta , are artificially added , because the complementary transfers naturally happen and no mutagen is necessary . thus , the costs along the antidiagonal of table 8 are all zero , that is , at = gc = cg = tc = 0 . the equivalence relationship between subscription in two nucleotide bases and subscription in integer l 1( 1 2 ) : { a , t , g , c } { a , t , g , c } { integers from 1 to 12 } is defined by table 6 . under the above assumptions , we can write update equation for optimal policy explicitly as ( 26)jq(xq)=minuq , l1{xq+jq+1(),{a , t , g , c}{0}}. proposition 7for the same x n , jq()jq+1( ) , for all q , 0 q n 1 , for all { a , t , g , c } , where denotes the complementary base of . if , in addition , the system is completely controllable , m , s.t . j m( ) is the global minimum and for all q m , jq()=jm( ) if m q 1 ( mod 2 ) , and j q( ) = j m( ) if m q 0 ( mod 2 ) . in our example , m n 6 . for the same x n , jq()jq+1( ) , for all q , 0 q n 1 , for all { a , t , g , c } , where denotes the complementary base of . if , in addition , the system is completely controllable , m , s.t . j m( ) is the global minimum and for all q m , jq()=jm( ) if m q 1 ( mod 2 ) , and j q( ) = j m( ) if m q 0 ( mod 2 ) . in our example , proofthis first part is due to the zero cost for the transfers between complementary bases in the consecutive steps . for any 0 q n 1 , the relationship between minimal costs in consecutive steps is shown in ( 26 ) . since { a , t , g , c } , +jq+1( ) is one of the four elements in the set from which the j q( ) is picked . moreover , =0 . therefore , jq+1( ) is one of the four elements in the set . since j q( ) is the minimum picking for a set containing jq+1( ) , we conclude that jq()jq+1().the m value in our example is proved by brute force method , that is , j n6( ) is a guaranteed global minimum . for completely controllable systems the existence of m implies that for without limitation in the number of steps , we can reach the global optimal in n m steps , 6 steps in our example.suppose that q = m , j m( ) is the global minimum , thus jm-1()jm( ) . jm-1( ) is also a global minimum.by backward induction , suppose for q = q 1 , the statement is true , that is , jq1 - 1()=jq1( ) is the global optimal either from xq1 - 1= or x q1 = to x n . obviously , for q = q 1 1 , the statement is still true . therefore , jq()=jq-2()=jq-1( ) , {a , t , g , c } , for all q , 2 q m. this first part is due to the zero cost for the transfers between complementary bases in the consecutive steps . for any 0 q n 1 , the relationship between minimal costs in consecutive steps is shown in ( 26 ) . since { a , t , g , c } , +jq+1( ) is one of the four elements in the set from which the j q( ) is picked . since j q( ) is the minimum picking for a set containing jq+1( ) , we conclude that jq()jq+1( ) . the m value in our example is proved by brute force method , that is , j n6( ) is a guaranteed global minimum . for completely controllable systems , this m always exists . the existence of m implies that for without limitation in the number of steps , we can reach the global optimal in n m steps , 6 steps in our example . suppose that q = m , j m( ) is the global minimum , thus jm-1()jm( ) . suppose for q = q 1 , the statement is true , that is , jq1 - 1()=jq1( ) is the global optimal either from xq1 - 1= or x q1 = to x n . obviously , for q = q 1 1 , the statement is still true . therefore , jq()=jq-2()=jq-1( ) , {a , t , g , c } , for all q , 2 q m. in the proof of global minimum that can be reached in the finite step in proposition 7 , we also discover proposition 8 . here , j q(x q , x n ) denotes the optimal cost from x q to x n . proposition 8given two single base mutation optimal control problems , with the same fixed n , with and desired final states complementary to each other . if j m( , x n ) is the global minimum , then jm(,xnd ) is also the global minimum , that is , the global minimum of both systems is reach at the same stage m. moreover , for all q , 0 q m , ( 27)jq(,xnd)=jq(,xnd ) , ,xnd{a , t , g , c}. given two single base mutation optimal control problems , with the same fixed n , with and desired final states complementary to each other . if j m( , x n ) is the global minimum , then jm(,xnd ) is also the global minimum , that is , the global minimum of both systems is reach at the same stage m. moreover , for all q , 0 q m , ( 27)jq(,xnd)=jq(,xnd ) , ,xnd{a , t , g , c}. physically , proposition 8 states that the optimal can be achieve at the same step from a pair of complementary bases to another pair of complementary bases at the same cost . however , this fact is true only for base - to - base deterministic mutations , because the distance reference is well defined by ( 23 ) . since we apply mutagens before the replication starts , u aa actually transfer a to t and then to a by replication . for simplicity , we just use the kth and ( k + 1)th step states as subscripts to represent the corresponding control and cost . therefore , ac , ca , gt , tg is smaller than other mutagens , except artificial ones . if we use to denote the costs of mutagens as listed in table 9 , then ( 28)=[5.216.602.3306.158.9503.824.6109.177.2400.645.0910.28]=[aaagacatgagggcgtcacgcccttatgtctt][1230450670890101112 ] . running the dynamic programming for every pair of ( x q , x n ) { a , t , g , c } { a , t , g , c } , n = 9 . here , we sightly modify our notation . we use j q(x q , x n ) to denote the optimal cost from x q to x n . then , ( 29)jq=[jq(a , a)jq(a , g)jq(a , c)jq(a , t)jq(g , a)jq(g , g)jq(g , c)jq(g , t)jq(c , a)jq(c , g)jq(c , c)jq(c , t)jq(t , a)jq(t , g)jq(c , c)jq(t , t ) ] . the path to reach the optimal cost is denoted by ( 30)pq=[pq(a , a)pq(a , g)pq(a , c)pq(a , t)pq(g , a)pq(g , g)pq(g , c)pq(g , t)pq(c , a)pq(c , g)pq(c , c)pq(c , t)pq(t , a)pq(t , g)pq(t , c)pq(t , t ) ] , where p q(x q , x n ) is the ( q + 1)th state from x q to x n , that is , x q+1 = p q(x q , x n ) . the simulation results are shown as below , including optimal costs for all possible transfer pairs ( x q , x n ) { a , t , g , c } { a , t , g , c } , j q , 0 q 8 , graphical representation in figure 6 , and optimal path p q , 0 q 7 . ( 31)j0=[5.215.090.6406.156.7903.823.8206.796.1500.645.095.21],j1=[00.645.095.213.8206.796.156.156.7903.825.215.090.640],j2=[5.215.090.6406.156.7903.823.8206.796.1500.645.095.21],j3=[00.645.095.213.8206.796.156.156.7903.825.215.090.640],j4=[5.215.090.6406.156.7903.823.8206.796.1500.645.095.21],j5=[00.645.095.213.8206.796.156.156.7903.825.215.090.640],j6=[5.215.090.6406.156.7903.823.8207.886.1500.645.095.21],j7=[00.645.095.213.8208.486.156.157.8803.825.215.090.640],j8=[5.216.602.3306.158.9503.824.6109.177.2400.645.0910.28 ] , ( 32)p0=[a , tttta , ca , ccc , tggggaa , ga , ca],p1=[ttta , tc , tca , ca , cggggaa , ca , ga],p2=[a , tttta , ca , ccc , tggggaa , ga , ca],p3=[ttta , tc , tca , ca , cggggaa , ca , ga],p4=[a , tttta , ca , ccc , tggggaa , ga , ca],p5=[ttta , tc , tcaa , cggggaa , ca , ga],p6=[a , tttta , cacc , tggtgaa , ga , ca],p7=[tttatcaagtggacga ] . for simplicity , we use 1 to represent a , 2 to g , 3 to c , and 4 to t in graphical interpretation . from figure 6 , we can see clearly that the optimal cost decreases as q decreases in the first few steps , and then optimal cost remains at the global minimum . this phenomenon obeys proposition 7 . in this example , global optimal is reached at m = 5 for all pairs of initial and final states as j 7 j 5 = j 3 and j 6 j 4 = j 2 . so , the global minimum is achieved before we reach n 5 = 4 in this particular case . this also implies that with n free we can reach desired final state in 4 steps from given initial state . observing closely to j q , 0 q 5 , j q1 equals to j q by exchanging the first and the last columns , and the second and the third columns , which is consistent with proposition 8 . or we can exchange the first and the last rows , and the second and the third rows of j q to obtain j q1 . j q1 and j q2 are the same for q 1 , q 2 m = 5 for q 1 q 2 = 0 ( mod 2 ) . the optimal trajectories are generated from p q(x q , x n ) . for example , given x 2 = t , and the final state x 9 = g , we want to generate the optimal trajectories . x 3 = p 2(t , g ) = a , g. if x 3 = a , x 4 = p 3(a , g ) = t ; if x 3 = g , x 4 = p 3(a , g ) = c. if x 4 = t , x 5 = p 4(t , g ) = a , g ; if x 4 = c , x 5 = p 4(c , g ) = g. if x 5 = a , x 6 = p 5(a , g ) = t ; if x 5 = g , x 6 = p 5(g , g ) = c. if x 6 = t , x 7 = p 6(t , g ) = a , g ; if x 6 = c , x 7 = p 6(c , g ) = g. if x 7 = a , x 8 = p 7(a , g ) = t ; if x 7 = g , x 8 = p 7(g , g ) = c. so , the optimal routes are tatatattgutgg ; tatattgutggcg ; tattgutggcgcg ; ttgutggcgcgcg . consequently , the optimal cost is j 2(t , g ) = 0.64 = tg . optimal trajectories for other pairs of initial and final states can be obtained in the same manner . it takes less than 1 second to generate optimal trajectories for all pairs of initial and final states with n = 9 on a regular desktop . since we have already proven by the brute force method that the global optimal can be achieved with m 6 , the computation time can be further reduced by taking n = 6 with all the results necessary for this example . for codon - to - codon deterministic mutations , we formulate our optimal control problem as ( 33)j0(x0)=minuk , l1i , 0kn,1l1l , 1i3{k=0n1l1=1li=13l1uk , l1i+d(xn,{xnd } ) } , subject to ( 34)xk+1=(i+l1=1li=13uk , l1iseieit)xk , with x 0 , x n {0 } given , x k {0 } , for all k , 0 k n , and d( 1 , 2 ) , 1 , 2 {0 } as defined in section 2.3 . if we take the same assumption on available mutagens as in section 3.1 , then we can write update equation for optimal control policy explicitly as ( 35)jq(xq)=minuq , l1i , 1l1l , 1i3{xq11+jq+1([1xq2xq3 ] ) , xq22+jq+1([xq12xq3]),xq33+jq+1([xq1xq23 ] ) , 1,2,3{a , t , g , c}{0 } } , with x q { a , t , g , c} {0 } , 1 i 3 denotes the ith element of x q {0 } , and xqi denotes the complementary base of x q . the optimal control sequences depend on the numerical values of l1s and d( 1 , 2 ) , 1 , 2 {0 } . though we do not have real values of l1s and d( 1 , 2 ) , we can always obtain simulation results to compare the result differences by assigning different numerical values to those parameters . therefore , we use three different assignments of l1s and the same d( 1 , 2 ) to generate our simulation results . those three assignments of l1s are , 5 , and 0.5 , respectively , with the same as assigned in section 3.1 . in every particular example , it takes approximately 2 seconds on a regular desktop to generate the optimal path table for all pairs of initial and final states with n = 19 , and the dynamic programming algorithm ensures that the optimal control for tail problems is generated at the same time . the graphical interpretation of three assignments are shown in figures 7 , 8 , and 9 , respectively . the x - axis and y - axis denote x q and x n , respectively . for a codon [ 1 2 3 ] , 1 , 2 , 3 { a , t , g , c} {0 } , its index is calculated by ( 36)42(11)+4(21)+3,where i = 1 if a , i = 2 if g , i = 3 if c , and i = 4 if t , 1 i 3 , for the simplicity of graphical interpretation . thus , there are 64 pairs of initial and final desired states , and there are 64 21 pairs of initial state and final desired set . j q is calculated following the same procedure as in base - to - base deterministic cases . the value of optimal cost can be read directly from graphical interpretation , and the optimal path can be generated from path matrix p q , similar to base - to - base deterministic case . both j q and p q , for all q , 0 q n , are of 64 64 dimension . from the graphical interpretation and table 10 , we find that the value of q where the global minimum is reached at the first time decreases as l1 decreases . and j 0 is more similar to j 18 with = 5 than with = or = 0.5. this implies that if d( 1 , 2 ) are the deterministic term in our objective function , then the treatment plan is made to drive the final state as close to the desired set as possible ; if the costs of applying mutagens is the deterministic term in the objective function , then the treatment plan tends to stay in the original state and applies less mutagens ; if they are of equal weight , then the treatment plan deals with this tradeoff . moreover , no matter how the numerical values of final penalty and the costs of applying mutagens changes in our objective function as shown in ( 33 ) , there is always a m , m n 18 , j m(x m ) is global minimum . proposition 7 can be extended to codon - to - codon deterministic mutations as stated in proposition 9 . proposition 9given an optimal control problem with objective function in the form of ( 33 ) , constraints in the form of ( 34 ) , and all available chemical mutagens and their corresponding transfer pairs and costs as listed in tables 6 , 7 , and 8 , jq()jq+1( ) , {0}3 . if , in addition , the system is completely controllable , m , s.t . j m( ) is the global minimum and for all q m , jq()=jm( ) if m q 1 ( mod 2 ) , and j q( ) = j m( ) if m q 0 ( mod 2 ) . in our example , m n 18 . given an optimal control problem with objective function in the form of ( 33 ) , constraints in the form of ( 34 ) , and all available chemical mutagens and their corresponding transfer pairs and costs as listed in tables 6 , 7 , and 8 , jq()jq+1( ) , {0}3 . if , in addition , the system is completely controllable , m , s.t . j m( ) is the global minimum and for all q m , jq()=jm( ) if m q 1 ( mod 2 ) , and j q( ) = j m( ) if m q 0 ( mod 2 ) . in our example , m n 18 n 18 here since the rest is similar to the proof of proposition 7 . the objective function in ( 33 ) can be written as the summation of three separate single - base mutation systems and the distance reference between final states and the final desired set , that is , ( 37)jq(xq)=minn1,n2,n302nn1+n2+n33n1{jn1(xn1)(xq1,1) optimal costs of base - to - basedeterministic optimal controlproblem formed by the 1st base + jn2(xn2)(xq2,2)optimal costs of base - to - base deterministic optimal controlproblem formed by - the 2nd base + jn3(xn3)(xq3,3)optimal costs of base - to - basedeterministic optimal control problemformed by the 3rd base + d([123],{xnd } ) } , where n q = ( n n 1 ) + ( n n 2 ) + ( n n 3).according to proposition 7 , j n6(x n6 ) is guaranteed to be the global optimal for single - base mutations . therefore , optimal costs corresponding to three single - base mutation systems , j n1(x n1)(x q , 1 ) , j n2(x n2)(x q , 2 ) , j n3(x n3)(x q , 3 ) are guaranteed to reach their own global optimal at n 1 = n 2 = n 3 = n 6 with all possible combinations of 1 , 2 , 3 { a , t , g , c}. therefore , q = n 18 is a guaranteed global optimal . n 18 here since the rest is similar to the proof of proposition 7 . the objective function in ( 33 ) can be written as the summation of three separate single - base mutation systems and the distance reference between final states and the final desired set , that is , ( 37)jq(xq)=minn1,n2,n302nn1+n2+n33n1{jn1(xn1)(xq1,1) optimal costs of base - to - basedeterministic optimal controlproblem formed by the 1st base + jn2(xn2)(xq2,2)optimal costs of base - to - base deterministic optimal controlproblem formed by - the 2nd base + jn3(xn3)(xq3,3)optimal costs of base - to - basedeterministic optimal control problemformed by the 3rd base + d([123],{xnd } ) } , where n q = ( n n 1 ) + ( n n 2 ) + ( n n 3 ) . according to proposition 7 , j n6(x n6 ) is guaranteed to be the global optimal for single - base mutations . therefore , optimal costs corresponding to three single - base mutation systems , j n1(x n1)(x q , 1 ) , j n2(x n2)(x q , 2 ) , j n3(x n3)(x q , 3 ) are guaranteed to reach their own global optimal at n 1 = n 2 = n 3 = n 6 with all possible combinations of 1 , 2 , 3 { a , t , g , c}. therefore , q = n 18 is a guaranteed global optimal . indeed , the m value where the first global optimal is reached at earlier stage as listed in table 10 . graphically , the indices of complementary codons 1 = [ 1 2 3 ] and 2=[1 2 3]t sum up to 65 , that is , ( 38 ) ( 16(11)+4(21)+3 ) + ( 16(11)+4(21)+3 ) = ( 16(11)+4(21)+3 ) + ( 16((51)1)+4((52)1)+(53 ) ) = 65 . therefore , j q and j q1 , 1 q m are symmetric about the plane x = 32.5 , j q2 and j q , 2 q m are the same , as shown in figures 7 , 8 , and 9 . however , proposition 8 can not be extended to codon - to - codon deterministic case due to the redundancy of genetic codes , that is , the set of codons translated to the same amino acid varies from one amino acid to another as shown in table 5 . the simulation results show that the costs , a pair of complementary codons , to two final desired set generated by a pair of complementary final desired codons are different , that is , jq(xq,{xnd})jq(xq,{xnd } ) , in general , for any q. graphically , the optimal cost profile j q is not symmetric about the plane y = 32.5 for j q1 , 1 q m. therefore , the doctors need to pick the strand with lower cost to make the treatment plan . this also implies that in large - scale cases , for instance , a gene containing hundreds of nucleotide bases , the doctors should make the treatment plan based on the strand the total cost of which is lower than the other . the optimal control problem of codon - to - codon stochastic mutations can be written as ( 39)j0(x0)=minuk , l1i , 0kn11l1l , 1i3{k=0n1l1=1li=13l1uk , l1i + hk , l1i , 0kn11l1l , 1i3[d(xn,{xnd } ) ] } , subject to ( 40)xk+1=ixk+l1=1li=13uk , l1ihk , l1iseieitxk , with x 0 , x n {0 } given , x k the major difference between deterministic and stochastic systems is that we impose the random binary vector , h k , l1 , in our system equation ( 40 ) . we denote the probability associated with h k , l1 to be p l1,12 with 1 , 2 { a , t , g , c}. the equivalence relationship between j and 1 2 can be found in table 3 . again , we assume that we have l 1 = 12 kinds of mutagens , each corresponding to one major transfer pattern , associated with probability assignments , as listed in table 11 . then , we can write updated formula for optimal control policy explicitly as ( 41)jq(xq)=minuq , l1i , 1l1l , 1i3{xq11+hq , l1(xq11)1[jq+1([xq2xq3 ] ) ] , xq22+hq , l1(xq22)2[jq+1([xq1xq3 ] ) ] , xq33+hq , l1(xq33)3[jq+1([xq1xq2 ] ) ] , 1,2,3{a , t , g , c}{0 } } where ( 42)hq , l1(xq11)1[jq+1([xq2xq3])]=pl1(xq11 ) , xq1a(h)[jq+1([axq2xq3 ] ) ] + pl1(xq11 ) , xq1g(h)[jq+1([gxq2xq3 ] ) ] + pl1(xq11 ) , xq1c(h)[jq+1([cxq2xq3 ] ) ] + pl1(xq11 ) , xq1t(h)[jq+1([txq2xq3 ] ) ] , where x q { a , t , g , c} {0 } , 0 q n 1 , 1 i 3 denotes the ith element of x q {0 } , xqi denotes the complementary base of x q , and l 1 : 1 2 { a , t , g , c } { a , t , g , c } { integers from 1 to 12 } , the mapping from major transfer pattern 1 2 to mutagen index , as shown in table 11 . the mathematical expression of hq , l1(xq22)2[jq+1([xq1 xq3]t ) ] and hq , l1(xq33)3[jq+1([xq1xq2]t ) ] is similar to hq , l1(xq11)1[jq+1([ xq2 xq3]t ) ] as shown above . in order to run the simulation , we assign numerical values to probabilities in table 11 , as illustrated in table 12 . as in section 3.2 , we use three different assignments for l1s , , 5 , and 0.5 , respectively . the optimal cost profile j q with selected q values , for every pair of ( x q , x n ) , is graphically interpreted in figures 10 , 11 , and 12 , respectively , with n = 29 , with computation time of approximately 7 seconds on a regular desktop . the profile of j 0 is more similar to j 29 when l1s are assigned 5 than or 0.5. this implies in codon - to - codon stochastic mutations ; the optimal control sequence behaves as codon - to - codon deterministic cases , that is , the system tends to getting as close as possible to the final desired set if l1s are much smaller than d( 1 , 2 ) , and the system tends to remain in the same state with minor mutations when l1s are relatively larger than d( 1 , 2 ) , 1 , 2 {0 } . and jq()jq+1( ) , {0 } is still valid in codon - to - codon stochastic case . however , for stochastic cases , we can not reach a global minimum because of the randomness caused by mutagens . since , in usual cases , there exists no stationary global minimum , we need to define error tolerance , that is , if |jq()-jq-1()| with the same { x n } , then we can stop at j q(x q ) . however , we can still observe figures 10 , 11 , and 12 to conclude that j 0 and j 2 are almost of the same shape in all three different parameter assignments . higher dimensional optimal control problems , gene - to - gene stochastic mutations , can be solved as a series of cascade codon - to - codon stochastic problems . in this paper , we present a mathematical model to deal with mutations in the process of dna replication in the view of control systems . different from the existing models , our model is constructed directly from the basic biological theories , the central dogma in molecular biology , and the complementary base pair for dna molecules with double helix structure . it precisely describes how the induced mutations affect the targeted dna segments at molecular level . it provides instrumental information of molecule interactions in gene mutation for biologists and doctors to gain a better understanding of cellular and tissue level systems ' behavior . though we emphasize that we target at induced mutations during the process of dna replication in our work , this model can be extended to other biological processes at molecular level , such as transcription process and dna brokage . in our optimal control problem , the objective function includes two factors : the risk / cost of applying mutagens and the off - trajectory penalty . under optimal control policy , the summation of those two factors are minimized , by dynamic programming , to propose a low - risk treatment plan . we define the distance reference following the chemical and physical properties of amino acids , representing the penalty . our objective is to drive the system from given initial state to the final desired set generated by the final desired state at the lowest cost . we define the final desired set since redundancy in genetic codes gives us additional options of final desired state to further lower the cost . we also discuss three different small - scale system , and show the simulation results of examples . the optimal control problems of base - to - base deterministic mutations and codon - to - codon deterministic mutations are of theoretical importance . as shown in the propositions , the global optimal if the step limit is larger than the number of steps that global optimal can achieve , then we have some flexibility in our treatment plan . in addition , there exist multiple optimal paths with the same total cost , given the initial state and the final desired set . the optimal control problem of codon - to - codon stochastic mutations is of practical importance , since codon is the basic component forming long dna sequences . the step limit n is decided by doctors according to patients ' conditions , and the treatment plan is made according to the initial state , the final desired set , and the step limit . since the doctors constantly take measurement to see the result of treatments at current stage , the treatment plan is updated accordingly . solving codon - to - codon stochastic optimal control problem is a key step to realize the optimal control to gene - to - gene stochastic mutations in the real world . the optimal control sequences generated by dynamic programming make it possible for biologists and doctors to mutate certain sections of genes on purpose in laboratory , at a relative low cost and low risk , which is an essential step to identify the functional units , to examine the interactions among different segments , and to find healthy , harmful , and lethal nucleotide sequences . all those results are beneficial in gene network construction . in addition , the fundamental details of gene mutations at molecular level help biologists to elaborate on the biological theories at the cellular and tissue levels , such as the theory of evolution . moreover , by our method , biologists can distinguish the harmful and beneficial mutations and induce beneficial mutations during the evolution process in a proper way , which greatly helps to save rare species in danger . furthermore , our solution to the optimal control problem proposed provides a new medical intervention to genetic diseases . compared to the existing gene therapy , treatments by mutagens are safer by avoiding the side effect of virus infection . calculation errors , the mispairings in the process of two single - stranded dna segments , can be corrected at lowest cost by applying a correct mutagen sequence . further work can be done by extending codon - to - codon stochastic optimal control problem to gene - to - gene stochastic mutations . the distance reference between dna segment with equal length can be defined as a weighted sum of the distance references between codons . since certain combinations of amino acids this goal can be achieved by either defining a preset trajectory or eliminating high - risk sequences in the state space . under this situation , the spontaneous mutations can be modeled as an additional random factor in our state updating equations , and another random noises should be added to the output equation .

we propose a molecular - level control system view of the gene mutations in dna replication from the finite field concept . by treating dna sequences as state variables , chemical mutagens and radiation as control inputs , one cell cycle as a step increment , and the measurements of the resulting dna sequence as outputs , we derive system equations for both deterministic and stochastic discrete - time , finite - state systems of different scales . defining the cost function as a summation of the costs of applying mutagens and the off - trajectory penalty , we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm . in addition , given that the system is completely controllable , we find that the global optimum of both base - to - base and codon - to - codon deterministic mutations can always be achieved within a finite number of steps .

1. Introduction 2. System Equations and Generalized Optimal Control Problem Formulation 3. Results and Discussion 4. Conclusion

PMC2725789

this study was supported by a grant - in - aid for scientific research on priority areas ( 19039013 to t.m . and 20061016 to t.y . ) and a grant - in - aid for the gcoe programs ( systems biology ) of the ministry of education , culture , sports , science , and technology of japan .

the two - component systems ( tcs ) , or histidine - to - aspartate phosphorelays , are evolutionarily conserved common signal transduction mechanisms that are implicated in a wide variety of cellular responses to environmental stimuli in both prokaryotes and eukaryotes including plants . among higher plants , legumes including lotus japonicus have a unique ability to engage in beneficial symbiosis with nitrogen - fixing bacteria . we previously presented a genome - wide compiled list of tcs - associated components of mesorhizobium loti , which is a symbiont specific to l. japonicus ( hagiwara et al . 2004 , dna res . , 11 , 5765 ) . to gain both general and specific insights into tcs of this currently attractive model legume , here we compiled tcs - associated components as many as possible from a genome - wide viewpoint by taking advantage that the efforts of whole genome sequencing of l. japonicus are almost at final stage . in the current database ( http://www.kazusa.or.jp/lotus/index.html ) , it was found that l. japonicus has , at least , 14 genes each encoding a histidine kinase , 7 histidine - containing phosphotransmitter - related genes , 7 type - a response regulator ( rr)-related genes , 11 type - b rr - related genes , and also 5 circadian clock - associated pseudo - rr genes . these results suggested that most of the l. japonicus tcs - associated genes have already been uncovered in this genome - wide analysis , if not all . here , characteristics of these tcs - associated components of l. japonicus were inspected , one by one , in comparison with those of arabidopsis thaliana . in addition , some critical experiments were also done to gain further insights into the functions of l. japonicus tcs - associated genes with special reference to cytokinin - mediated signal transduction and circadian clock .

Supplementary Data Funding

PMC2753780

statistics demonstrate that , in the past 20 years , with the development of industry and aggravation of air pollution , the morbidity rate and mortality rate of lung cancer are increasing most quickly in all malignant tumors in china . in cities , the mortality of lung cancer is 27.5/1 000 000 , accounting for 22.4/100 of all death in malignant tumors . the five - year survival rate is 14/100 in america , less in china . besides the reasons of environment pollution , smoking , heredity , lack of early diagnostic tools is also the important factor which contributes to that bad situation . in the recent years , with the development of biology and imageology , for example , spiral ct , cytological examination of sputum and endoscopy of bronchus , and so on , positive rate of early diagnosis is increasing but there are related limitations in all kinds of methods . the sensitivity of fine needle aspiration biopsy ( fnab ) in diagnosis of malignant nodes is 70/100100/100 , but it may destroy some normal tissues and bring about some complications , for instance , pneumatothorax and hemoptysis . blood plasma is the most easily controlled and acquired specimen . so making use of serum sample to detect special markers is the most perfect method in diagnosis of clinical lung cancer . the reasons why we choose the blood plasma as the pathfinder of proteome research are as follows . ( i ) serum proteome is the most complicated proteome , including inferior proteome in different tissues . ( ii ) it is easy to obtain enough serum proteins as research sample and it is easy to be standardized . ( iii ) there is a large range of dynamic state in property of serum proteins . ( iv ) there is no strict linear relationship between the expression levels of the mrnas and proteins . the modification after translation , such as glycosylation and phosphorylation , is more and more popular , so it is necessary to globally analyze the secreted proteins expressed by cells or tissues . in the research of neoplastic serum proteomics , the related proteomics technology is principally used to fathom the change of serum proteins in the course of forming tumor , to screen and discover the tumor markers and potential drug targets which could be used for classification , early diagnosis , therapy , and intervention of the tumor . nowadays , two technical modes are often applied in the research of serum proteomics : ( i ) surface - enhanced laser desorption and ionization take - of - flight mass spectrometry ( seldi - tof - ms ) , ( ii ) matrix assisted laser desorption / ionization time - of - flight mass spectrometry ( maldi - tof - ms ) . the new generation of maldi - tof - ms could quickly , exactly identify polypeptides and proteins with high sensitivity and high throughput . there are many advantages : ( i ) small needed quantity ( fmol ) , ( ii ) short time of analysis ( 35 minutes ) , ( iii ) high accuracy of quality ( 1/10000 ) , ( iv ) the immunity to the effect of n - terminal close , ( v ) making use of situ - enzymolysis - technology could directly identify the protein spots which are cut from gels . so it reduces the loss of specimen , ( vi ) it could identify a single protein in protein mixture and directly identify the modification after translation [ 3 , 4 ] . so it develops quickly and becomes the preferred way of analyzing polypeptides and proteins in laboratory . in our research , we made the rats our lung cancer model which was induced with mca , used the method of 2de combined with maldi - tof - ms , made compared serum proteomics research in lung cancer , analyzed the changes of serum proteins before and after the formation of lung cancer in same body , identified serum proteins which related to lung cancer for offering serum proteomic evidence to probe the pathogenesis of lung cancer as well as providing new style to probe hematological diagnostic method of lung cancer . 20 wistar rats ( 10 male , 10 female ) were purchased from experimental zoology department at tongji medical college in huazhong technology university . they ranged in weight from 180 g to 200 g. 3-methylcholanthrene ( mca ) was the product of sigma ( sigma - aldrich , inc , saint louis , missouri , usa ) , immobilized ph gradient dry strip was purchased from amersham pharmacia biotech company , sodium dodecyl sulfate ( sds ) , dithiothreitol ( dtt ) , tris(hydroxymethyl ) aminomethane ( tris ) , bromophenol blue ( bpb ) , ammonium persulfate ( aps ) , glycine , acrylamide , methylene bisacrylamide ( bis ) , tetramethylethylenediamine ( temed ) , ipg - buffer , drystrip cover fluid , agarose , carbamide , protein - markers were purchased from a - pharmacia co. , coomassie brilliant blue r-250 , 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate ( chaps ) were purchased from sigma co. , glacial acetic acid , methanol , glycerol , paraform , alcohol were national analytical pure , sequencing - grade modified trypsin was purchased from american roche co. , -cyano-4-hydroxycinnamic acid ( cca ) ( sigma co. ) , acetonitrile ( acn ) ( fisher chromatographic pure ) , tri - fluoro - acetic - acid ( tfa ) ( sigma co. ) . ipgphor isoelectric focusing electrophoretic apparatus was purchased from swedish amersham pharmacia biotech co. , proteanxi cell vertical electrophoretic apparatus was purchased from bio - rad co. , image scanner was purchased from swedish amersham pharmacia biotech co. , centrivap centrifugal concentrators and cold traps were purchased from labconco co. , spotcutter apparatus was purchased from bio - rad co. , and autoflex maldi - tof - ms mass spectrometry apparatus was purchased from germany bruker co. image master ide software and mascot software are found in http://www.matrixscience.com/search_form_select.html . the rats were kept in cozy ( 1525c ) , quiet and avoided of highlight for 58 hours before making the experiment . the rats were kept for 14 days after the whole blood was collected by heart puncture . then we made the model of lung cancer induced with mca in iodized oil by intrabronchial installation [ 5 , 6 ] with minor modifications . the details were as follow : iodized oil 0.1 ml containing mca 10 mg was dissolved at 7678c for 24 hours . as the basal anesthesia , ketamine hydrochloride 0.12 ml was injected into the muscle of right thigh ( 0.6 ml / kg ) , at the same time , penicillin 20 000 u and phytomycin 50 mg per rat were injected into the muscle of left thigh once a day for a week for infection prevention . after about 2 - 3 minutes , early drugged state was showed up , and then the rats were anaesthetized with diethylether for relaxing the muscle of laryngeal . the anaesthetized rats were put on a consple with 45c inclined plane and the upper jaw incisor teeth were fixed by a retention suture on superior extremity of table top . the throat was exposed with gripping tweezers and bended tongue spatula with elastic metals . in a frontal mirror , at the moment of inspiration , the injection needle with blunt end in 1 ml syringe was inserted in glottis until reached the crotch of trachea , then turned left bottom to lobar bronchi in inferior lobe of left lung , and then iodized oil 0.1 ml with mca 10 mg was injected . take pictures with dsa after installation for a day to find the location of iodized oil with mca . sacrificed the animals after installation for 180 days dissected the rats systematically and took the tissues where pathological changes were obvious and all organs , metastasis , lymph nodes with suspected of invasion , fixed them with paraform , embeded them with paraffin wax , sliced them , and stained with he . the rats were raised with skins of hind neck in order that the limbs could downward sagging after they were anesthetized with diethylether . the injector that contains heparin was used to pump blood ( 13 ml ) on the left chest wall where the heart beats most powerfully ( 1.52 cm higher than the lower margin of ensiform cartilage ) . the blood was kept in centrifuge tube for 30 minutes at room temperature , centrifuged at 2000 rpm for 15 minutes . the plasma was taken out and aliquoted into sterile ep tubes , stored at 70c until used . 50 ul plasma was taken out , respectively , before and after the formation of lung cancer , then combined and quantified with bradford method , followed by taking 1 mg protein used for isoelectric focusing . all measurements were performed as described previously with minor modification . in the first dimension , proteins were separated by ief with ipg strip ( ph310 , nonlinear gradient and ph47 , linear gradient , both 180 mm 3 mm 0.5 mm ) . of the total proteins , 1 mg was dissolved in lysis buffer ( 8 m urea , 0.02 chaps , 0.02 m dtt , 0.05 ipg buffer ) to obtain a total volume of 350 ul per strip . focused ipg were rehydrated at 30 v for 6 hours , at 500 v for 1 hour , at 1000 v for 1 hour , and at 8000 v for 10 hours . after ief , ipg strips were washed with milli - q water and then incubated in equilibration buffer ( 30% glucerin , 6 m urea , 2% sds , 50 mm tris - hcl ph 8.8 , trace bromophenol blue ) containing 20 mm dtt on rocking bed for 15 minutes , followed by 15 minutes incubation in the same equilibration buffer containing 100 mm - iodoacetamide on rocking bed . equilibrated ipg strips were placed on top of a 13% homogeneous sds - polyacrylamide gel . a scrap of filter paper was immersed in 10 ul protein marker and put on top of one side of the gel . 13% sds - page gels 75 ml contained 30% acr/0.8% bis 33.5 ml , 4 tris - hcl 19.5 ml ph 8.8 , milli - q water 24.5 ml , 10% aps 0.25 ml , temed 0.05 ml . gels were run in parallel at constant power ( 40 ma for 40 minutes , 60 ma for 5 hours ) in running buffer until bpb reached the bottom line of each gel . the gels were put into 0.1% coomassie brilliant blue solution ( methanol 484 ml , glacial acetic acid 92 ml , milli - q water 454 ml , coomasie brilliant blue r-250 1 g ) and stained on rocking bed for 3 hours . after pouring out the coomassie brilliant blue solution , we decolored them in depigmenting agent solution ( methanol 50 ml , glacial acetic acid 75 ml , milli - q water 875 ml ) for 24 hours until the background of gel pieces became clear and transparent . spots detection , quantification , matching and comparison of 2de protein pattern were done with image master ide software . in the protein matching , serum protein gel maps of normal controls were regarded as referenced gel , artificial matched spots were built up , and the analysis of different expression was performed by applied software . the individual spot volumes were normalized by dividing their intensity values by the total intensity values of all the spots present in the gel and expressed as % vol . if the ratio of relative content in different group was more than 2 or less than 0.5 , we could assess there were differences . it was carried out by the procedure described in detail previously with minor modification . of all the spots , 7 protein spots were overexpressed , 4 protein spots were underexpressed , and 2 protein spots were new in the plasmas of lung cancer . the chosen protein spots in 2de maps were excised with spot - cutter apparatus and transferred into 1.5 ml ep tube , followed by washing them thrice with 1 ml water for 10 minutes . gel pieces were discolored in 50100 ul solution ( 50% acetonitrile , 25 mmol / l ammonium bicarbonate ) for 20 minutes with constant oscillation , followed by discarding the solution , repeated 1 - 2 times until blue color disappeared , dried them in vacuum centrifugal dryer for 30 minutes . then 510 ul of 0.01 ug / ul trypsin diluted in 25 mmol / l ammonium bicarbonate was added to each sample tube for digesting the proteins and kept the tubes in freezer at 4c for 2030 minutes . after all digestion solution was ingested , 510 ul of 25 mmol / l ammonium bicarbonate was added to it . stored it at 37c for 15 hours . the digested polypeptides were eluted twice with 5% tfa 50100 ul at 40c for 1 hour and 2.5% tfa , 50% acn 50100 ul at 30c for 1 hour , supernatants were collected , combined , vacuum - dried by centrifugation until used for mass spectrographic analysis . 5 ul of 0.5% tfa was added to dried sample tubes for dissolving the peptides mixture . the sample and ground substances ( cca added to 30% acn or 10% aceton to obtain saturated solution ) were combined with 1:1 volume and spotted onto the target plate , then air - dried . peptide mass fingerprinting spectrum was evaluated with a reflector positive ion model in following setting : accelerating voltage , 20 kv ; reflected voltage , 1.12 kv ; nitrogen laser wavelength , 337 nm ; pulse width , 3 nanoseconds ; delayed extraction time , 100 nanoseconds ; the degree of vacuum , 4 10 torr ; each spectrum was obtained by accumulating 50 laser shots and averaging them . a matrix peak and the peptide mass fingerprinting of each protein was searched from ncbinr database using mascot software . the conditions of searching are as follows ( i ) the peptides mass were controlled between 800 da and 4000 da . ( ii ) the sphere of error in apparent pi and apparent mr was + 0.5ph and 20% . ( iii ) the largest error in molecular weight of peptide fragment was controlled in the range of 0.3 da to + 0.3 da . ( iv ) the trypsin was chosen as the enzyme and the incomplete choice of enzymolysis fragment was 1 or 2 . lung cancer models were made successfully after installing mca in iodized oil . it was demonstrated that iodized oil was present in the inferior part of left pulmonary lobes by scissors shadow with x - ray . only in ten rats of 18 rats ( two rats died naturally in 20 rats ) , tubercles in bottom left of pulmonary lobes were observed in naked eye . by pathological examination , it was proved that they were squamous cell carcinomas . after he staining , by light microscope , we could observe that carcinoma nests were different in size and shape , the horny pearl was obvious , cell nucleus were very big , part of them were vacuous , the chromatins in cell nucleus were rough , there were many karyokinesis , and nucleoli were big and localized to the edge ( figure 1 ) . the electrophoresis of plasma in 10 animal models was performed before and after forming lung cancer , respectively . the protein spots were separated better using ph47 ipgief ( figure 2(b ) ) than ph310 ipgief ( figure 2(a ) ) . the protein spots in the range of pi46 and mr1065 kd were distributed most intensively . when making an analysis of 2de patterns which were separated with ph47 ipg strip ( figure 3 ) , we found that 455 spots on the normal plasmas 2de patterns and 716 spots on the lung cancer plasmas 2de patterns were detected . when we matched the lung cancer plasmas 2de patterns with the normal plasmas 2de patterns , it was demonstrated that the number of matched protein spots was 295 and matched rate was 50.38% . 141 protein spots were differently expressed significantly in plasmas 2de patterns , 82 spots overexpressed in the lung cancer and 59 spots overexpressed in normal controls . we chose 13 differently expressed proteins spots with clear margin and high quantity of proteins for maldi - tof - ms analysis . of all the protein spots , 7 protein spots were overexpressed ( numbers 1 , 2 , 3 , 4 , 7 , 8 , 9 ) , 4 protein spots were underexpressed ( numbers 10 , 11 , 12 , 13 ) , 2 protein spots were new in the plasmas of lung cancer ( numbers 5 , 6 ) ( figures 4 and 5 ) . the peptide mass fingerprinting maps were obtained successfully by analysis of maldi - tof - ms after digesting the chosen protein spots . finally , 3 proteins were identified through the ncbinr database search by mascot software in chosen 13 protein spots . the 3 proteins were heptoglobin ( overexpressed protein ) , transthyretin ( underexpressed protein ) , and tumor necrosis factor receptor superfamily member 8 ( new protein ) . the figures were the mass spectrum of identified proteins spots and detailed results of database retrieval ( figures 6 , 7 , 8 , 9 , 10 , and 11 ) . mca is an indirect chemical carcinogen , which belongs to polycyclic aromatic hydrocarbon with 3 , 4-benzpyrene , and is responsible to air pollution . its major effect is to make epithelium mucosae cell of bronchiole , respiratory bronchiole squamous metaplasia and gradually progress to squamous carcinoma cell . we had proved that there were a series of changes of genetic materials and related genes in the process of variation from normal bronchi epithelium to lung squamous carcinoma cell by immunohistochemistry staining and molecular pathology [ 8 , 9 ] . for example , the different positive expression rate of p53 protein was 69.57% in rat lung cancer tissue . the positive expression rate of proliferative cell nuclear antigen ( pcna ) took up 20% in normal bronchi epithelium tissue , and it advanced to 82.61% in infiltrating lung cancer tissue . in addition , the number of strong positive expressed cells was increasing obviously , even all carcinoma nests were positive expressed , it hinted the changes of activity of cell proliferation during the formation of lung cancer . thus making use of the model of rat lung cancer to carry out serum proteome research was effective and feasible . haptoglobin , one of acute phase proteins , is an acid glycoprotein , which belongs to 2-globulin and extensively exists in human plasmas and other body fluid . most of hp is synthesized in liver . in addition , hp mrna is also expressed in human endometriotic lesions , intestinal epithelium and mouse liver , lung , adipose tissue cell , skin . friedrichs et al . found that hp mrna was detected in some special cells of adernal gland , submandibular gland , ovary , ureter . further proved that hp was considered as a secretory protein , however , hp synthesized in thp-1 monocytic cells was largely retained within cells . and the content of hp in plasmas often greatly increases in pathologic state , for example , carcinoma , inflammation , infection , myocarditis , and so on . the main factor stimulates the composition of hp is il-6 . on the condition of inflammation , injury , il-1 , tnf are secreted by macrophage , leading to the increase of il-6 , resulting in the composition of hp . in addition , darmiento proved that lps also could stimulate the expression of hp mrna . proved protein kinase - c - delta could stimulate haptoglobin secretion as well . by forming the high - affinity complexes , , these hp - hb complexes could bind to the cd163 scavenger receptor on macrophages with high specificity , leading to endocytosis and subsequent intracellular degradation . so hp - hb complex formation is considered to lessen the loss of free hb through glomerular filtration and it is helpful for supporting the recycling of iron . moreover , because free hb is a source of iron , which may otherwise enhance bacterial growth and virulence , so it is important that hb released from erythrocytes could be cleared promptly . finally , free hb could release heme and iron which may participate in generating reactive oxygen species ( fenton reaction ) and promote the injury of tissue as well . in a word , hp works indirectly as a bacteriostatic agent and an antioxidant in the way of facilitating the immediate clearance of free hb by macrophages . haptoglobin polymorphism correlates to the prevalence and clinical evolution of many inflammatory diseases , for example , infections , atherosclerosis , and autoimmune disorders and that leads to the generation of two distinct alleles , hp2 - 1 , hp1 - 1 , and hp2 - 2 . hp2 - 2 has been reported to be associated with the risk of atherosclerosis and coronary heart disease . vormittag et al . proved that hp2 - 2 was a potentially new risk factor for spontaneous venous thromboembolism as well . there are many researches about hp correlate with injury , inflammation , metabolic disease [ 1618 ] . more and more documents report that the level of hp in plasmas goes up in many malignant tumors , such as ovarian cancer , breast cancer , renal cell cancer , colon carcinoma , acute leukemia , and lung cancer . our research results were consistent with them . in our research , we found hp greatly increased in lung cancer ( the content of protein adds up to 8.328 times ) . though maybe it does not belong to specific protein in lung cancer , owning to greatly increase level of hp in the active stage of carcinoma and high sensitivity of immunology method , it could become an important check index for lung cancer diagnosis and monitoring and improve the sensitivity and specificity of early diagnosis in lung cancer when combining with other diagnostic indexes . as for its function , ttr could transport the thyroid hormone t ( 4 ) and retinol through binding to the retinol binding protein . in addition , ttr has been established as a cryptic protease able to cleave apoa - i in vitro . some scholars have reported that ttr is involved in preventing a - beta fibrillization by inhibiting and disrupting a - beta fibrils , with consequent abrogation of toxicity . costa et al . further confirmed that as a protective mechanism in alzheimer 's disease ( ad ) , ttr could serve as a protective molecule in this disease and prompted a - beta proteolysis . it may be proved that ttr is a useful therapeutic agent in preventing or retarding the formation of cerebral amyloid plaque implicated in ad pathology . in the past , someone confirmed that in familial amyloidotic polyneuropathy ( fap ) which was associated with the abnormal extracellular tissue deposition of mutant transthyretin ( ttr ) , inflammatory and apoptotic pathways both are triggered in the presymptomatic stages of the disease on the condition that nonfibrillar ttr deposits are present . meistermann et al . also reported that transthyretin could serve as a biomarker for gentamicin - induced nephrotoxicity in rat . conversion of ttr tetramer to monomer may relate to the development of beta - cell failure / destruction in type 1 diabetes . so we could see that ttr expression was associated with diabetes . at the same time , bai et al . gussed that the concentration of ttr maybe relates to the level of blood pressure , however , the concrete mechanism is still unclear . the content of ttr quickly decreased when the proteins were insufficient and increased obviously when the amount of proteins gone up . therefore , ttr was often used as an index of evaluating nutritional state , especially the nutrition and immunity state after operation [ 33 , 34 ] . so far , reports about ttr relate to tumors mainly concentrate on liver cancer , ovarian cancer , leukemia . gu et al . first reported that the gene of ttr had close correlation to liver cancer , they found that the gene of ttr was expressed most highly in normal liver . the level of its mrna greatly went down in liver cancer which the parenchyma was destroyed little . ttr was also considered as potential serum marker in early ovarian cancer [ 3538 ] . in children with leukemia , the content of ttr and rbp in plasmas was greatly less than that in normal children . that difference also existed in different race , the melanoderm children were much less , and the lower level related to bad prognosis . some scholars reported that ttr was overexpressed in blood serum in lung squamous cell carcinoma compared with normal lung . our research also demonstrated that the content of ttr in plasmas greatly declined in the formation of lung cancer , it was consistent with their results . the amount of proteins in normal ones was 14 times bigger than that in lung cancer . tnfrs8 also named cd30 , because ki-1 monoclonal antibody was used in identifying it , therefore it named ki-1 as well . as a marker of activation of t and b lymphocytes , cd30 is a 120 kda surface phosphorylated glycoprotein and it is predominantly overexpressed by the tumor cells ( hodgkin 's and reed - sternberg cells ) of classical hodgkin 's lymphoma ( chl ) and those of anaplastic large cell lymphoma ( alcl ) in classical hodgkin lymphoma . it is well known that cd30 expression is not unique to hodgkin lymphoma and anaplastic large cell lymphoma ( alcl ) because of its expression in mediastinal large b cell lymphoma , a subset of nodal diffuse large cell lymphoma , large cells in follicular lymphoma , nodal and cutaneous diffuse large b cell lymphoma , peripheral t cell lymphoma , embryonal carcinoma , and other nonlymphoid cells and neoplasms . the expression of cd30 was also associated with pregnancy . kusanovic found that the content of maternal serum soluble cd30 increased in normal pregnancy , however , it decreased in preeclampsia and it is small for gestational age pregnancies . at the same time , lambropoulou et al . proved that during the second trimester , cd30 was expressed highly in many medullary thymic epithelial cells ( tecs ) and hassall 's corpuscles , but small numbers of cd30 tecs were showed during the late first trimester . large number of researches proved that if cd30 crosslinked with cd30l , activated signal may be issued . so it promoted the transmission of intracellular information . because that information could be positive or negative signal , consequently , it resulted in cellular growth was inhibited or cellular apoptosis , cellular hyperplasia or differentiation , secretion of cytokine , and so on . wright et al . further confirmed that in alcl cells , the stimulation of cd30 elicits p21 ( waf1)-mediated arrest through the canonical but not the alternative nf - kappab pathway . reported that there were many cd30cd4 , cd30cd8 cell in joint synovial fluid of patient with ra , large amount of scd30 existed in peripheral blood and affected joint synovial fluid , especially in active stage , it had direct relation with the titre of raf . it hinted that there was relationship between cd30 cell , scd30 cell , and th2 reactive disease . in addition , the increase of cd30 cells and scd30 cells was detected in acute stage of th2 reactive illness , such as sle , scleroderma , specifical scytitis . many researches showed the amount of scd30 increased in active stage of chronical viral hepatitis b and there were striking differences compared with normal controls and virus carries , hinting the activity of th2 cytokine in active stage of hepatitis [ 47 , 48 ] . in hodgkin 's disease , the level of serum scd30 abnormally increased in active stage in nontreated patients . the extent of increase related to the stage of illness and general symptoms . it could be an independent prognosis index , the higher of scd30 , the worser of prognosis . in alcl , the great increase of serum scd30 there was not scd30 in normal controls , indicating that the amount of scd30 went up indeed in forming lung cancer , so far , the mechanism of increase is not clear . hargreaves et al . guessed that it was possible that the function of scd30 brought into full play by blocking the cross - link of cd30 and cd30l . recently , researches in lung cancer demonstrated that a series of complicated molecular events involved in carcinogenesis , such as activation of oncogene and inactivation of antioncogene . proteomics aim at the large - scale analysis of protein in tissues , cell , and plasmas , including protein expression , posttranslational modification , and interaction of proteins . proteomics has become a hot spot in lung cancer research . by applying the proteomics technology , many researchers had found a large number of proteins as the candidate tumor markers from blood plasmas in lung cancers . by comparing protein expression levels among 93 lung adenocarcinomas and 10 uninvolved lung samples , chen et al . found that nine different enzyme proteins were identified by the method of 2d - page and maldi - ms or peptide sequencing . all of them increased obviously in the lung adenocarcinomas , including the antioxidant enzyme aoe372 , atp5d , b4galt , cytosolic inorganic pyrophosphatase ( ppase ) , grp58 , gstm4 , p4hb , tpi , and ubiquitin hiolesterase . identify proteins that commonly induce an antibody response in lung cancer by making use of proteomic approach ; protein gene product 9.5 ( pgp 9.5 ) was detected in serum . when they took advantage of a549 lung adenocarcinoma cell line , they have proved that pgp 9.5 existed at the cell surface as well as secreted . therefore , the discovery of pgp 9.5 antigen and/or antibodies in serum of patients with lung cancer showed that pgp 9.5 may be used in lung cancer screening and diagnosis . chatterji and borlak found that eight proteins were also identified in serum though they were identified in tissue of lung tumor bearing mice . a total of 50 proteins were identified in serum , some of which were specifically regulated or exclusively expressed either in tumor bearing or wild - type mice . what is more , they revealed that alpha-1-antitrypsin ( a1at ) and alpha-2-macroglobulin ( a2 mg ) were upregulated in the serum proteome of 12 months old mice . in cancer tissue , hemoglobin subunit alpha went up in serum samples of lung tumor bearing mice ( 12 months ) . they discovered the expression of transthyretin to be gone up in 1 month and repressed in 12 months old tumor bearing mice . thus they suggested that their in - depth validation could become biomarker candidates for the identification of lung adenocarcinomas . serological proteome analysis ( serpa ) of ten hlsc tissues was performed by li et al . to identify the tumor - associated antigens . the results showed 36 8 differential proteins reactive with patients ' autologous serum , 14 proteins of them were identified . in addition , six of the 14 proteins , alpha enolase , pre - b cell - enhancing factor precursor , triosephosphate isomerase , phosphoglycerate mutase 1 , fructose - bisphosphate aldolase a , and guanine nucleotide - binding protein beta subunitlike protein were also increased in hlscs in the comparative proteomic research , therefore , it indicated that these 6 hlsc - associated antigens can be applied in diagnosis and therapy of hlsc . autoantibodies against triosephosphate isomerase ( tim ) and superoxide dismutase [ mn ] ( mnsod ) were detected by yang et al . in serum from over 20% patients with lsc but none from the normal controls . their results suggested that autoantibody and antigen of tim and mnsod may also be potential application for screening and diagnosis of the lung squamous carcinoma . at the same time , lisa et al . found that five truncation forms of serum amyloid a protein precursor and serum amyloid a1 isoform 2 as a part of the components of the serum proteomic biomarkers of lung cancer . these results indicated that it was possible that the serum proteomic signature of lung cancer was the part of the result of specific proteolytic activity in the serum and/or in lung tumors . built up the protein configuration in the plasmas of lung adenocarcinoma using the method of the seldi - tof - ms technology and discovered 5 special protein peaks which highly expressed in lung adenocarcinoma . in addition , liao et al . captured serum proteins in lung adenocarcinoma by the technology of wcx2 chip and found 10 different expressed proteins in which 6 overexpressed proteins and 4 underexpressed proteins . however , a large number of lung cancers and normal people were essential to prove these differently expressed proteins and special expressed spectral patterns , to identify and show their functions in the formation of tumor . due to direct examination of the molecular machinery of cell physiology , including protein expression , sequence variations and isoforms , posttranslational modification , and protein - protein complexes , proteomics has the self - evident advantages over genomic - based assays . nonetheless , there are certain disadvantages as well , for instance , ( i ) sample collection , preparation , and analysis need rigorous requirement , ( ii ) there are no amplification procedures which similar to pcr that could enable assay to improve making use of the limited biological starting material , ( iii ) we are short of purification strategies which could enrich samples for intended work ( e.g. , phosphoprotein analysis ) , and ( iv ) necessary costs are insufficient for staffing and equipping shared resources or clinical laboratory which can be able to perform the required assays . though there are some limitations in the technology of proteomics , with the maturation of proteomic technique and improvement of sample pretreatment and preparation technique . we believe its application in analysis of blood plasmas will become more and more popular and become a new method for clinical diagnosis and illness monitoring . in addition , the screening and identification of tumor markers will step into a new stage . in a word , the research tactics in proteomics of tumor markers will bring about far - reaching extensive effects for lung cancer diagnosis and treatment . it will quicken the process of researches in lung cancer as well as making a great contribution to win a victory in human being 's flight with tumor . in our experiment , we made the rat plasmas derived from lung cancers and the normal controls to be our targets of observation and comparison . by regulating and optimizing all conditions of 2de technique , we finally obtained satisfactory 2de patterns in which the 700 serum proteins were detected from the lung cancers and the normal controls . in addition , the 141 differently expressed protein spots were acquired by image screen and image analysis . the 82 spots were overexpressed in lung cancer and the 59 spots were overexpressed in normal controls . at the same time , we successfully identified three proteins including hp , ttr , and tnfrs8 by making use of the maldi - tof - ms to analyze the 13 differently expressed protein spots . the increase of hp , which belongs to app , hinted the appearance of stress reaction in the process of forming lung cancer . in addition , the decrease of ttr , which shows the nutritional state , hinted the changes of nutritional state . as a member of tumor necrosis factor super family , tnfrs8 could regulate the function of immunity and hinted a series of changes of immunity state in the process of forming lung cancer . in a conclusion , ( i ) the plasmas proteins were separated successfully for proteome research of lung cancer by the optimized 2de technique . ( ii ) there were the differently expressed proteins between the normal plasmas and the lung cancer plasmas . ( iii ) the differentially expressed proteins in plasmas of rat lung cancer provided the evidence for keeping searching the markers for lung cancer diagnosis and therapy .

lung cancer remains the leading cause of cancer - related mortality worldwide . early detection of lung cancer is problematic due to the lack of a marker with high diagnosis sensitivity and specificity . to determine the differently expressed proteins in the serum of lung cancer and figure out the function of the proteins , two - dimensional electrophoresis ( 2de ) and matrix - assisted laser desorption / ionization time - of - flight mass spectrometry ( maldi - tof - ms ) were used to screen the serum proteins of lung cancer model induced by 3-methylcholanthrene ( mca ) . from optimized 2de image , 455 spots in the normal sera and 716 spots in the lung cancers sera were detected . among them , 141 protein spots were differentially expressed when comparing the serum from normal rat and serum from lung cancer model , including 82 overexpressed proteins and 59 underexpressed proteins . changes of haptoglobin , transthyretin , and tnf superfamily member 8 ( tnfrs8 ) were confirmed in sera from lung cancer by maldi - tof - ms . proteomics technology leads to identify changes of haptoglobin , transthyretin , and tnfrs8 in serum of rat lung cancer model and represents a powerful tool in searching for candidate proteins as biomarkers .

1. Introduction 2. Materials 3. Methods 4. Results 5. Discussion 6. Conclusion

PMC3320427

a 35-year - old man with an unremarkable medical history sought treatment for headaches , hearing loss , and night sweats . they came on as the day progressed and were neither positional nor associated with nausea , vomiting , or visual changes . three weeks before arriving at the hospital , he noted a sense of " fullness " in his ears ; he said that spoken voices sounded muffled , and he had difficulty hearing telephone conversations . when someone at the restaurant where he worked dropped a dish , he heard that sound clearly and reported that it was almost painful , causing him to become dizzy . his appetite was good , and he had not lost weight . although he reported no fever , he did report night sweats for several weeks . he had no rash , diarrhea , abdominal pain , chest pain , shortness of breath , joint complaints , or dysuria . he also said that he was exposed to dust at his workplace because of remodeling . he lived in new hampshire , had no pets , and worked as part owner of a restaurant . exposures included multiple male and female sexual partners with inconsistent condom use , and he had acquired several tattoos 8 months earlier while traveling in spain and italy . he had no known tuberculosis exposure . temperature was 36.7c , blood pressure 128/84 mm hg , pulse 80 , respirations 16/minute . sclerae were anicteric , and his pupils reacted to direct and consensual testing and responded normally to accommodation . bedside testing showed that his hearing was diminished to low volume sounds , but he was able to hear loud sounds , which he found painful . when the examiner clapped his hands loudly a few feet from the patient 's ear , the patient exhibited nystagmus . the patient 's neck was supple ; a 1.5-cm , nontender lymph node was palpated in the left upper anterior cervical chain . the remainder of the examination was unremarkable , with negative romberg test ; normal gait ; and normal motor , sensory , and reflex performance . rapid plasma reagin ( rpr ) was positive at a titer of 1:128 and was confirmed by a fluorescent treponemal antibody test . subsequent studies showed a cd4 receptor positive t - cell ( cd4 ) count of 899/ml and an hiv viral load of 878 copies / ml . a lumbar puncture showed protein 33 mg / dl , glucose 78 mg / dl , 9 erythrocytes/l , and 8 leukocytes/l ( 100% lymphocytes ) . cerebrospinal fluid venereal disease research laboratory test ( csf - vdrl ) results were negative . csf - vdrl , cerebrospinal fluid venereal disease research laboratory test ; elisa , enzyme - linked immunosorbent assay ; wb , western blot ; rt - pcr , reverse transcription polymerase chain reaction . the patient was started on 24 mu of iv penicillin per day for 14 days . at the end of this period , he reported notable improvement in his headaches , hearing loss , and vertiginous symptoms . one month after completing treatment , his rpr titer was 1:32 ; 3 months after he completed treatment , it was nonreactive . the course of syphilis in an hiv - positive patient may be altered from the natural history of the disease in hiv - negative patients . an increased frequency of ocular disease , multiple and slower resolving primary chancres , and a higher titer rpr have been reported ( 16 ) . in addition , delay or failure of titer decline after treatment , predilection for developing the jarisch - herxheimer reaction , and clinical relapse have also been described in hiv infection ( 1,4,7,8 ) . treponema pallidum is thought to invade the central nervous system in 25% of patients with syphilis , irrespective of hiv status ( 9 ) . most of these persons successfully clear the infection ( 10 ) , but other patients harbor the spirochete and remain at risk for sequelae of neurosyphilis . syphilitic meningitis , meningovascular disease ( often occurring with stroke ) , labyrinthitis , or cranial nerve palsies , as seen in this case , can be early findings . loud sounds or even routine acoustic stimuli can result in vertigo , nystagmus , or nausea and vomiting . the physiologic underpinnings of the tullio phenomenon were first described in 1929 , when tullio noted that experimentally induced fenestrations in the bony capsule of the lateral semicircular canals of pigeons caused the canals to be sound - responsive , inducing vestibular activation ( 11,12 ) . shortly thereafter , benjamins described a tullio reaction in a human patient with fistulizing cholesteatoma ( 13 ) . today , the term has been generalized to include vestibular activation in response to stimulation by sound of any part of the vestibular apparatus ( 12 ) . the tullio phenomenon is seen in a range of clinical contexts , including congenital deafness , meniere disease , suppurative middle ear disease , and spirochetal infections , such as syphilis or lyme disease . nields et al . describe a woman who had nystagmus and vertigo with routine sounds ; running tap water caused her to fall to the floor or retch in pain ( 14 ) . describe a series of patients with oscillopsia induced by pencil tapping , telephone ringing , or the sound of cutlery falling on the floor . patients often report a vague sense of ear blockage and an unpleasant awareness of their own voice vibrating in their ear ( 12 ) . symptomatic cranial nerve viii involvement in this patient prompted treatment for neurosyphilis , despite equivocal ( but typical ) csf findings . interpreting csf findings in hiv - positive patients with syphilis is challenging because commonly encountered mild lymphocytic pleocytosis may be attributable to hiv . csf - vdrl is often negative , with a 20%70% false - negative rate ( 15 ) . optimally managing patients with hiv and syphilis has been debated ; to date routine recommendations are the same as for hiv - negative persons ( 16 ) . although any patient in whom syphilis is diagnosed and who has neurologic symptoms should undergo lumbar puncture , csf evaluation should also be considered in asymptomatic patients in whom syphilis is diagnosed and who have an rpr titer > 1:32 or a cd4 + count < 350 , as these markers have been associated with increased risk for neurosyphilis ( 10 ) . because of the high rate of relapse that has been reported in some series ( 4,7,8 ) , close clinical and serologic follow - up is essential . a study of 59 patients with neurosyphilis showed that hiv - positive study participants were 2.5 times less likely to normalize csf - vdrl reactivity than hiv - negative patients . this effect was even more pronounced in patients with cd4 + counts < 200 ( 17 ) . the findings suggest that more intensive therapy for neurosyphilis in immunocompromised patients merits further study . after an all - time low case - rate of syphilis in 2000 , reports of rising trends , specifically in groups at risk , such as men who have sex with men , were reported in 2001 ( 18 ) . the outbreaks marked a 9.1% overall increased rate of primary and secondary syphilis ( 19 ) and were characterized by a high rate of hiv infection . parallel increases in hiv infection rates were a concern because of the common mechanism of transmission and the increased efficiency of hiv transmission with coexistent genital ulcers ( 20 ) . in 2001 , increases in hiv rates were reported in several states with large urban populations ; men who have sex with men accounted for the largest known subgroup at risk in incident adult or adolescent hiv cases ( 32% ) and aids cases ( 44% ) ( 21 ) . new hiv diagnoses increased in 29 states with mandatory reporting from 1999 to 2002 , notably by 17% among gay and bisexual men ( 22 ) . syphilis incidence also continued to rise in the united states in 2002 , with a 12.4% increase since 2001 ( 19 ) , and the highest trends were estimated to be among men who have sex with men . in san francisco , primary and secondary syphilis rates increased by > 1,000% from 1998 to 2002 among men who have sex with men ( 23 ) . high - risk behaviors have been documented in this group ( 24 ) and factor prominently in syphilis reemergence in the early 21st century . this case report describes a patient who had tullio phenomenon as the index symptom of neurosyphilis with previously undiagnosed hiv infection . his rpr titer was 1:128 , his cd4 count was preserved , and he responded well clinically and serologically to standard therapy . to our knowledge , this case is the first report of syphilis occurring as tullio phenomenon in an hiv - positive patient . we suggest that syphilis be considered in patients who have cranial nerve viii symptoms and an appropriate risk - factor profile . eradicating treponemes may be limited from sanctuary sites such as the cns . because control of syphilis likely depends not only on antimicrobial effect but also on host immune response , awareness of unusual symptoms of a relatively common disease will benefit not only the patient but also public health efforts in managing both syphilis and hiv infection . preventive and educational efforts focused on men who have sex with men may prove particularly important in modifying behaviors that foster the growth of both epidemics .

the incidence of syphilis has consistently increased from 2000 to 2002 . we report a case of acquired syphilis with symptoms of tullio phenomenon in a patient concurrently diagnosed with hiv infection . the resurgence of syphilis in hiv - positive groups at high risk has public health implications for prevention of both diseases .

The Case Conclusions

PMC4462773

iran by a population of 78 million , 30 provinces , 400 districts and more than 65,000 villages comprises of a 65% of the population that are living in urban areas . according to the 4 5-year national development plan the family physician reform should be extended to the whole country . therefore , family physician program was launched for the first time in 2005 in rural areas and cities with a population below 20,000 . after that and toward extension of this program in urban areas , two provinces of fars , in the south of iran with a population around 4.4 million , and mazandaran , in the north of iran with an approximate population of 3 million , were selected for pilot this program from 8 of july 2012 . similar to any other project , family physician program has its advantage and disadvantages which have to be evaluated in order to get an optimum result . this study as the first population - based study in this issue , aimed to measure the knowledge and practice of people lives in shiraz toward family physician program to present an evidenced - based feedback to national and regional policy makers to improve planning and management of this program . this cross - sectional , questionnaire - based study was conducted from october to december 2014 in shiraz , south of the iran . the sample size was calculated as 1382 , supposed level of knowledge of people toward family physician program as 50% , dropout rate of 20% , design effect of 3 , 5% precision level and a confidence level of 95% . multistage randomized and proportional to size sampling was used . in each address , one person who was at least 18 years and was a resident at shiraz for at least 2 years was asked to fill the questionnaire . the coded anonymous questionnaire comprised of a brief introductory paragraph about title , aims identification and phone call number of the executor of this study , followed by consent form that emphasized on voluntary participation and keeping confidentiality . they asked about their demographic and socioeconomic information including age , gender , level of education , marital status , job status , position in the family ( as breadwinner of family or other family member ) , number of family members and monthly income . being under the coverage of main and supplementary insurance systems and also family physician program was queried . the questionnaire contained questions about knowledge and items about practice of people regarding urban family physician program . in the knowledge section , participants were asked about choosing and changing family physician , family physician addresses , tasks of family physician , work time of family physician in holidays and nonholidays , address of reference and proper action in cases of having complaints or need to more information , electronic record form , referral form and visit - fee . in the practice section , reference to family physician and nonfamily physician , waiting time in the family physician 's waiting room , phone counseling with family physician , average of payment upon each referral to family physician , having problem in obtaining prescribed drugs by family physician , having problem in accessing the specialist family physician and being interviewed and examined completely by family physician in each visit were queried . the questionnaire was validated by two experts in family physician program and its reliability according to cronbach 's alpha was calculated as 0.64 through pilot testing of the questionnaire . all data were entered into spss version 20 software ( spss , chicago , il , usa ) . the accuracy of data entry was ensured by randomly selecting and checking completed questionnaires against their corresponding data in the spss software . chi - squared , t - tests , pearson correlation and stepwise linear regression model were used . voluntary participation in this study , designing of an anonymous questionnaire , possibility of access to executives of this study via two exclusive phone lines and keeping confidentiality in all aspects of research were some ethical aspects that were applied . furthermore , the research protocol as described here was approved by the ethics committee of the health policy research center affiliated with shiraz university of medical sciences . voluntary participation in this study , designing of an anonymous questionnaire , possibility of access to executives of this study via two exclusive phone lines and keeping confidentiality in all aspects of research were some ethical aspects that were applied . furthermore , the research protocol as described here was approved by the ethics committee of the health policy research center affiliated with shiraz university of medical sciences . participation rate of participants was 1257 of 1382 ( 90.9% ) and 997 ( 79.3% ) filled the questionnaire at home addresses [ table 1 ] . mean age of participants was 38.1 13.2 years and of total 1257 , 634 ( 50.4% ) were men , 882 ( 70.2% ) were married and 474 ( 37.7% ) had associate or bachelor degree of education [ table 1 ] . social and demographic characteristics of participants in the population - based study aimed to determine correlates of knowledge and practice toward urban family physician program in shiraz , southern iran ( n=1257 ) six hundred seventeen ( 49.1% ) had job with mean income 1000$/month [ table 1 ] . the mean family member was 3.9 1.5 and 539 ( 42.9% ) were breadwinners of their families . one thousand hundred nineteen ( 89% ) and 479 ( 38.1% ) were under the coverage of one of the main and supplementary insurance systems respectively [ table 1 ] . one thousand fifty - eight ( 84.1% ) of respondents and 1012 ( 80.5% ) of their families members were under the coverage of urban family physician program [ table 1 ] . peoples total knowledge toward urban family physician program was 5 2.7 of 19 , showed that 1121 ( 89.2% ) had a low level of knowledge [ table 2 ] . southern iran ( n=1257 ) of total , 879 ( 69.9% ) of people knew about family physician choosing rules but 880 ( 69.9% ) did not know that , it is possible to change their family physician and 59 ( 4.6% ) stated that family physicians should present both preventive and medical services to their clients . four hundred seventy - fours ( 37.7% ) knew about their family physicians substitutes and 58 ( 4.6% ) were informed about where they should refer in the absence of their family physician . three hundred and fifty - three ( 28% ) and 2 ( 0.1% ) knew correctly about how much they should pay to general and specialist family physician in each visit , respectively . of 1257 , 22 ( 1.8% ) knew that where they should refer if need any information or have any complaint about family physician program while 1173 ( 93.2% ) did not know or could not correctly tell the 4 digits phone number of unit responding to complaints about family physician program . a few of people were informed about referral form ( 233 ; 18.5% ) , about what they should do with filled referral forms ( 154 ; 12.3% ) and about electronic health record ( 11 ; 0.8% ) . family physician office distance to home was less that 1 km in 538 ( 42.8% ) of the responders [ table 2 ] . univariate analysis showed that knowledge toward family physician program was lower in younger than 30 and older than 60 years people , in males , in singles , in whom with < 8 years of education , in whom that were not under coverage of main or supplementary insurance systems and in whom were not under the coverage of family physician program [ table 3 ] . single variable analysis of correlates of knowledge and practice of people toward urban family physician program in shiraz south of iran stepwise linear regression model showed that peoples total knowledge toward their rights in urban family physician program by adjusted r 0.18 and constant = 8.5 ( 95% confidence interval [ ci ] = 7.69.4 , p < 0.001 ) was in order correlated to being under coverage of urban family physician program ( = 2 , 95% ci = 1.42.5 , p < 0.001 ) , being other family member ( s ) under the coverage of urban family physician program ( = 1.1,95% ci = 0.71.6 , p < 0.001 ) , being under the coverage of one of the main insurance systems ( = 0.5 , 95% ci = 0.011 , p = 0.04 ) and being married ( = 0.4 , 95% ci = 0.10.8 , p = 0.002 ) . peoples practice toward urban family physician program has gained mean 2.3 0.9 of total score 7 in this study , showed that 942 ( 74% ) had poor performance while 86 ( 6.8% ) had moderate and 3 ( 0.2% ) had expected level of practice . of total 1257 , 882 ( 70.2% ) stated that they became sick during previous year of this study and 700 ( 55.6% ) referred to their family physician , showing 700 of 882 ( 79.3% ) referral rate to family physicians . eighty ( 6.4% ) had phone counseling with their family physician in the similar period [ table 4 ] . mean number of references to family physicians in whom that were under the coverage of family physician program was 2.4 3.6 in the previous year of this study while mean number of references to nonfamily physicians in whom that were not under the coverage of family physician program was 2.4 4.3 in the same year ( p = 0.3 ) [ table 4 ] . one hundred seventy - eight ( 14.2% ) had changed their family physicians during last year of this study and 152 ( 20.6% ) paid higher than legally approved visit - fee to their family physician . two hundred twelve ( 16.9% ) had problems in providing drugs that were prescribed by their family physicians and 342 ( 27.2% ) had problems in access to specialist family physician [ table 4 ] . practice and problems of people toward urban family physician program in shiraz , southern iran ( n=1257 ) univariate analysis showed that practice toward family physician program was lower in men , in whom which were not under the coverage of main insurance systems and in whom that were not covered by family physician program [ table 3 ] . stepwise linear regression model showed that total practice of people toward their rights in urban family physician program by adjusted r square 0.54 and constant ( = 4.6 , 95% ci = 4.34.8 , p < 0.001 ) was in order correlated to being under coverage of urban family physician program ( = 1.2 , 95% ci = 0.91.4 , p < 0.001 ) , being other family members under coverage of urban family physician program ( = 0.9 , 95% ci = 0.71.1 , p < 0.001 ) and having higher than 1000 $ income monthly ( = 0.2 , 95% ci = 0.050.3 , p = 0.008 ) . after 9 years of establishment and modest achievements in rural family physician program in iran , thought and policy of extension of this system to urban settings has been dominating in recent years as evidenced in health sector reform of this country . therefore , as the pilot , this national project was launched in 2012 in two provinces of iran , including 4.5 million populated fars provinces in the south of the iran . in shiraz , the capital city of fars province , with a population 1.5 million , 650 general family physicians and 300 specialist family physician were included in the family physician program . considering that urban family physician program is a complex and multi - disciplinary structure , it is necessary to monitoring its performance periodically from different aspects . one of the important aspects of the monitoring could be regarded as the assessment of the trend of knowledge and practice of the people toward this program and before and after implemented interventions . therefore , after 2.5 years of starting this program and as the first official report , this study was conducted to evaluate the knowledge and practice of the people toward family physician program . present study demonstrated that the knowledge of the people about their rights in this program is generally low . the results also showed that only few people knew about what to do when they had any question or any complain about the program . this should be considered as an important obstacle toward improvement of the program since the policy makers may hardly get access to the voice of the people . furthermore , most of the people did not know what to do when their family physicians are absent and how to find an alternative one . this leads to ignore or delay to visit by the family physician and gradually results in mistrust to and outgoing from the program . the results of the present study revealed that the lack of knowledge was more common among those who were not under coverage of any health insurance system and also among single people . furthermore , results remarked that the practice of the people toward urban family physician program was so weak . a significant portion of the people had problems with providing drugs that were prescribed by their family physicians and also to access specialist family physicians . furthermore , about one fifth of the people complained that they had paid higher that legally approved visiting fees . this matter could be solved if people get more informed about their rights meanwhile teach them how send their feed backs and complains . however , establishment of an effective and continuous supervision system may also come to help in this regard . another achievement of this survey was that , poor practice is common among those with lower outcome . we found that low knowledge toward this program was not related to level of income , therefore above result pointed that low economics may suffer from weaker infrastructures of family physician system in their areas although other studies are needed to prove such claim . another finding was that practice of people toward urban family physician system had a poor correlation with their knowledge as it was endorsed in previous studies with emphasis on that educating alone may not lead into a better good level of practice . hence , strengthening the software and hardware resources are mandatory for the sake of good performance of this system . present study marked that the reference rate of the patients to family physicians is high in the current system . however , this was not so different from those who were not under coverage of family physician and were referred to out of the family physician system doctors . there are few studies that demonstrate that the number of unnecessary patients referrals to pharmacies , laboratories , and radiology centers has been increased as a result of running family physician program , it is needed to perform other studies about the cost effectiveness of the urban family physician program in our setting , as well as the efficiency of monitoring - evaluation system . saying about limitations in this study , it should be clear that despite our effort to design the questionnaire simple and user friendly and also providing prepaid envelope for resending the filled questionnaires , approximately 10% of the people did not answer the questionnaire . it was half of dropout rate of 20% that we assumed for estimation of sample size and we also noticed that the nonrespondents did not show statistically difference among different postareas , therefore it is unlikely that it could have influence on the results and their representativeness . another point was that this study was conducted in shiraz , the most populated city of the fars province that does not have exactly the same situation as the small cities of this province . however , by choosing participants randomly and from different socioeconomic classes , the possible discrepancy may be faded . this study showed that the knowledge and practice of the people toward family physician program are weak . therefore , continuous education and effective training of people about their rights in this program could lead to a better performance of them and come into play for future outcome of this program . last but not least , lessons from this project could help policymakers at national level before any decision to extension this program to whole the country or even may be , followed by neighboring and regional countries that look to iran as a hub for regional health sector reforms .

background : urban family physician program has been launched as a pilot in fars and mazandaran provinces of iran since 2012 . attitudes of policy makers and people toward urban family physician program have become challenging . this study shows what people know and practice toward this program.methods:this cross - sectional population - based study was conducted by a multistage randomized sampling in shiraz , southern iran . knowledge and practice of adults toward urban family physician program were queried through filing the questionnaires . single and multiple variable analyzes of data were performed.results:participation rate was 1257 of 1382 ( 90.9% ) , and the mean age of the respondents was 38.1 13.2 years . of 1257 , 634 ( 50.4% ) were men and 882 ( 70.2% ) were married . peoples total knowledge toward urban family physician program was 5 2.7 of 19 , showed that 1121 ( 89.2% ) had a low level of knowledge . this was correlated positively and in order to being under coverage of this program ( p < 0.001 ) , being under coverage of one of the main insurance systems ( p = 0.04 ) and being married ( p = 0.002 ) . the mean score of people 's practice toward the program was 2.3 0.9 of total score 7 , showed that 942 ( 74% ) had poor performance , and it was correlated positively and in order to being under coverage of this program ( p < 0.001 ) and having higher than 1000 $ monthly income ( p = 0.004 ) . correlation of people 's knowledge and practice toward the program was 24%.conclusions : current evidences show a low level of knowledge , poor practice and weak correlation of knowledge - practice of people toward urban family physician program .

INTRODUCTION METHODS Ethics statement RESULTS DISCUSSION CONCLUSIONS

PMC5110349

an estimated 1,000 cases of spinal cord injury ( sci ) related to athletics are treated yearly in the united states , representing 8.9% of total sci cases,1 2 and although much has been written about both surgical and nonsurgical treatment methods , the literature guiding return to function is scant . transient neurapraxia and cervical cord neurapraxia ( ccn ) have been written about extensively , but still only very low - level medical evidence exists regarding management.3 4 5 6 the risk of recurrence after return to sports has been debated in the literature , and there is no definitive universally accepted guideline.1 7 various criteria based on numerous retrospective studies for return to play ( rtp ) have been suggested by torg,8 watkins,9 cantu et al,10 bailes et al,11 and torg and ramsey - emrhein6 ; however , the decision regarding rtp is individualized to the specific athlete , the level of function , and the expectations of the athlete.7 12 13 14 15 moreover , these return criteria are subjective , difficult to apply clinically , and poorly validated on prospective studies . completion of a randomized trial regarding rtp may not ever become possible , and instead information on medical decision - making must be found in other sources . a recent meta - analysis of literature evaluating evidence for rtp with various injury patterns concluded that only grade c or d practice recommendations supported by level iii evidence at best were available for rtp after sci.16 that is , evidence supporting interventions is compiled from limited cohort studies and clinical trials , resulting in clinicians using significant judgment of the current evidence to make patient treatment decisions . in patients with sci , the data are clear that improved function is dependent upon early initiation of rehabilitation17 ; however , in patients with minimal or no deficits , the expectations are greater than in patients with a severe or complete sci . once the patient has fully recovered from the injury , decisions must be made to release the patient to a specific level of activity , with return to sports being one of the more demanding levels of function . consensus opinion regarding rtp may provide better evidence than individual case reports or small case series regarding opinions about return to sporting activity . consensus regarding expert opinion can be especially useful in guiding surgical decision - making where other types of evidence are absent or interpretation of available evidence is subjective.18 19 this approach has been widely used in the spine literature for interpreting guidelines and assessing interobserver reliability in clinical decision - making.20 21 22 23 24 this study was designed to identify the maximum level of sporting activity that a group of experienced spine trauma surgeons would allow patients to participate in after recovery as a guide to making general recommendations , which from a medical perspective is essentially a subjective determination of the likelihood that an individual who returns to sports will suffer an additional significant injury directly related to the original trauma . whether a patient can function at the preinjury performance level would depend on many factors and can not be addressed in this article . a treating physician is frequently faced with the decision to release a patient to a given level of contact and currently must make a decision based on his or her own anecdotal experience with little supportive literature . the aim of this study is to offer the treating physician a consensus analysis of expert opinion regarding rtp that can be incorporated with the unique factors of the case for the final individual decision . twenty - five spine surgeons in the spine trauma study group ( stsg ) who consider spine trauma to be a significant component of their practice , all from separate level 1 trauma centers , were surveyed.20 21 22 23 24 the survey was administered at a national meeting discussing guidelines for cervical neurapraxia . the stsg was founded in 2004 and consists of 50 surgeons from 12 countries specifically focused on the study of traumatic spine injuries . each surgeon was presented 10 common case scenarios involving cervical injuries and asked to identify the level of sports participation they would allow following recovery ( tables 1 and 2 ) . the levels of sports were defined as high - contact , intermediate - contact , noncontact , or no sports , representing the frequency and severity of expected stress on the spine . cases were categorized into those involving cervical neurapraxia and stenosis , atlantoaxial cervical injury , subaxial cervical injury , and general cervical injury . participants were also asked how soon after recovery they would allow a return to activity and what would be the minimum imaging studies necessary to make the decision . the surveys were completed simultaneously after an explanation of each scenario , the definition of level of play , the use of time to return as that of return to maximum participation , and the use of imaging tools . abbreviations : acdf , anterior cervical diskectomy and fusion ; ncaa , national collegiate athletic association ; mri , magnetic resonance imaging . each brief case scenario ( table 3 ) represented increased levels of injury and assumed that the patient has fully recovered subjectively and objectively . full clinical recovery was defined as minimal to no neck pain , return of full or near - full range of motion , and return of normal motor and sensory function . after the recommendations for full recovery were collected , the surgeons were presented with the same scenarios but instructed that the patient had persistent symptoms , such as moderate neck pain , upper extremity paresthesias , or single - level radicular weakness ( table 4 ) . because this study focused on cervical injury , the levels of contact were stratified by the frequency and severity of head / neck impact ( table 1 ) . the surveyed surgeons were given seven specific time frames within which they would allow the patient to return to the maximum level of play : same game , 1 to 2 days , 1 week , 2 to 4 weeks , 2 to 3 months , 3 to 6 months , or greater than 6 months ( table 4 ) . finally , the surgeons were asked what imaging studies were the minimum necessary to make the final rtp decision after a history and physical exam plain radiographs , computed tomography ( ct ) scanning , and/or magnetic resonance imaging ( mri ) scanning . no difference between orthopedic surgeons and neurosurgeons recommendations seen , mann - whitney u test . no difference between orthopedic surgeons and neurosurgeons recommendations seen , mann - whitney u test . after the surveys were completed , the data was tabulated for analysis of each case scenario . the responses from the orthopedic surgeons were compared with those from the neurosurgeons to determine whether any significant differences in recommendations existed using the kruskal - wallis and mann - whitney u test . a p value < 0.05 was considered significant . fourteen orthopedic surgeons and 11 neurosurgeons who were members of the former stsg completed the survey . a summary of the level of play recommendations for each scenario with full recovery is shown in table 3 . there were no differences between orthopedic and neurosurgeons ( results not shown ) , so the data was analyzed as one group , which is consistent with a previous finding from this group of fellowship - trained spine surgeons regarding evaluation of cervical dislocation injuries.20 the scenarios in which the surgeons most consistently allowed for return to high - contact sports were the episodes of ccn with early resolution of symptoms and no stenosis on mri ( case 1 , 88% , p < 0.0001 and case 3 , 64% , p = 0.03 ) . in the setting of diffuse stenosis and early resolution of ccn , the percentage of surgeons allowing return to high - contact sports dropped to 35% ( case 2 , p = 0.6 ) and 27% ( case 4 , p = 0.6 ) , with greater heterogeneity of opinions . cases in which some surgeons favored allowing return to high - contact sports included c1 ring or c2 hangman 's fractures that healed nonoperatively ( 67% , case 5 , p = 0.005 ) , c5c6 unilateral facet dislocation presenting neurologically intact with subsequent posterior fusion ( 56% , case 8 , p = 0.02 ) , and herniated disks repaired operatively ( 71% , case 9 , p = 0.003 ) . the surgeons generally favored a return to a less vigorous level of activity such as intermediate or noncontact sports when the case involved ccn with os odontoideum and c1c2 fusion ( 82% , case 6 , p = 0.04 ) , c5 flexion compression of american spinal injury association grade d with c4c6 anterior cervical corpectomy and fusion ( 80% , case 10 , p = 0.06 ) , and c5 burst fracture treated nonoperatively ( 52% , case 7 , p = 0.03 ) . good consensus was seen for these cases in favoring return to a degree of activity less than high contact . changes in the clinical scenario to indicate a lack of patient symptom resolution resulted in greater variation and less consensus of recommendations and a lower number of physicians recommending return to high - contact sports ( results not shown ) . with a lack of resolution of symptoms , only case 2 ( p = 0.03 ) and case 4 ( p = 0.02 ) showed significant consensus in recommending noncontact or no sports activity . table 4 outlines the time frame within which surgeons would allow rtp at the level they recommended . a relative consensus in recommending return after 2 to 4 weeks was seen in cases 1 to 4 involving cervical neurapraxia and stenosis . all surgeons recommended waiting 2 to > 6 months for cases 5 to 10 , involving atlantoaxial , subaxial , or general cervical spine injury patterns . there was no difference in the recommendations of orthopedic surgeons and neurosurgeons for level of activity or time to rtp ( results not shown ) . recommendations for x - rays ( 64 to 92% ) , cts ( 20 to 84% ) , and mris ( 50 to 100% ) varied among different cases , indicating a high consensus for obtaining imaging in making recommendations ( results not shown ) . there were also no differences in recommendations between orthopedic surgeons and neurosurgeons for imaging prior to making rtp decisions . most surgeons favored extensive imaging with radiographs , ct , and mri before allowing rtp . decisions about safe rtp after cervical injury can be difficult because there are opposing forces to be considered , such as the patient 's desires and the medicolegal implications . other than for ccn , there is almost no literature to determine an appropriate strategy for return to sports after cervical injury . torg et al reported that cervical stenosis was predictive of another episode of ccn ( 53% ) but not predictive of catastrophic injury25 ; however , repeated episodes of neurapraxia and cord contusions were thought to be a relative contraindication for rtp . more recently , brigham and capo followed four professional athletes who had cord contusions from presumed hypermobility at c3c4 or a disk herniation elsewhere in the spine.7 despite the positive findings on radiographic images , the players were completely asymptomatic after stabilization and subsequently returned to professional sports . the authors emphasize close observation , careful assessment , and thorough counseling of the patients . the results of studies of return to professional sports after treatment of cervical injury by hsu and colleagues supported rtp after treatment of cervical disk herniations , with a greater rate of return for operatively managed cases12 26 ; however , the authors discussed the unclear consensus in management of patients with herniated disks and concomitant cervical stenosis . despite evidence to suggest that athletes with spinal stenosis may return to high - contact sports if they are asymptomatic,3 6 the current study reveals the prevailing caution regarding rtp when an athlete has lost the space available for the spinal cord . morganti et al completed a similar rtp survey based on case scenarios of cervical trauma administered to members of the cervical spine research society , the herodicus sports medicine society , and members of the authors ' own department.27 an evaluation of 113 responses ( 32.7% response rate ) demonstrated that the consensus on rtp was poor and that most of the differences were based on type of subspecialty interest ( i.e. , spine or sports ) and seniority . although 49% of respondents reported using guidelines at the time for decision - making , only 1 of 10 survey cases was evaluated as appropriate in this manner . the results of the study presented a question of how recommendations for rtp could be made in the face of limited data . in contrast , our study was directed specifically at spine surgeons at level 1 trauma centers who include trauma as a significant component of their practice . the surgeons surveyed for this study had a thorough understanding of the available literature on transient neurapraxia , including a recent issue of spine that was focused on spine trauma and included an evidence - based review of rtp after transient neurapraxia.28 the conclusions of that review were based on a consensus of members of the stsg , as well as available literature.5 because there is so little literature available on the other scenarios , most of those recommendations were based on expert opinion from clinical experience . some important differences can be observed in the rtp recommendations after transient neurapraxia . if a patient had congenital stenosis after an episode of neurapraxia , then experienced trauma spine surgeons were distinctly less willing to allow that patient to return to a high - contact sport . if the neurapraxia was brief , 88% would allow return to high - contact sports if the athlete did not have congenital stenosis whereas only 35% would allow the return if congenital stenosis existed . if the deficit lasted for a few hours rather than resolving quickly , only 64% would allow return to high - contact sports even if the patient did not have congenital stenosis and just 27% would allow return to high - contact sports if congenital stenosis existed on mri . thus , it appears that duration of neurapraxia , perhaps indicating a more significant injury , was important in the rtp decision , as was the presence of congenital stenosis . our study did not address the issue of repetitive neurapraxia , which could also influence decision - making just as repeated cerebral concussions do.29 the case scenarios set forth do not cover the entire gamut of potential cervical injuries but they were thought to include a broad representation of the common injury patterns so that some extrapolation to other injury patterns may be made . for example , a single - level posterior fusion for facet fracture without dislocation could be assessed in a similar fashion to a single - level posterior fusion for a unilateral facet dislocation in scenario 6 . the only other injury patterns in which a majority of those surveyed would allow return to high - contact sports were in the scenarios that resulted in a stable single - level subaxial fusion , either anterior or posterior , and nondisplaced , healed upper cervical fractures . in the scenarios of a healed posterior c1c2 fusion ( even with normal neurology ) , those with two - level fusions , and those in which patients had an incomplete sci ( excluding transient neurapraxia ) , only a small minority of less than 20% would consider return to high - contact sports . absolute contraindications to high - contact sports have generally included patients with odontoid abnormalities , atlanto - occipital fusion , klippel - feil fusions above c3 , and acute fracture with instability.16 limitations of this study include the reliance on expert opinion for surgical recommendations because of the difficulty of studying these injury patterns in the active athlete . the findings are highly dependent on individual interpretation of data and personal experience ; however , in the face of convincing data , consensus opinion can be a source of guidance on patient management as well as starting point for further exploration . other limitations of the study include an inability to totally account for all mechanisms and types of cervical sport injury in making practice recommendations . clinicians applying this survey may not find every scenario fits their specific patient , although the principles evaluated in each case may be widely applied . although this study will not completely answer the questions about rtp , it establishes a reasonable consensus of expert surgeon opinion with substantial experience to guide the treating physician involved in similar case scenarios . it can also serve as a basis upon which future prospective , multicenter studies can be designed to confirm or disprove current dogma .

study design survey . objective sports - related spinal cord injury ( sci ) represents a growing proportion of total scis but lacks evidence or guidelines to guide clinical decision - making on return to play ( rtp ) . our objective is to offer the treating physician a consensus analysis of expert opinion regarding rtp that can be incorporated with the unique factors of a case for clinical decision - making . methods ten common clinical scenarios involving neurapraxia and stenosis , atlantoaxial injury , subaxial injury , and general cervical spine injury were presented to 25 spine surgeons from level 1 trauma centers for whom spine trauma is a significant component of their practice . we evaluated responses to questions about patient rtp , level of contact , imaging required for a clinical decision , and time to return for each scenario . the chi - square test was used for statistical analysis , with p < 0.05 considered significant . results evaluation of the surgeons ' responses to these cases showed significant consensus regarding return to high - contact sports in cases of cervical cord neurapraxia without symptoms or stenosis , surgically repaired herniated disks , and nonoperatively healed c1 ring or c2 hangman 's fractures . greater variability was found in recommendations for patients showing persistent clinical symptomatology . conclusion this survey suggests a consensus among surgeons for allowing patients with relatively normal imaging and resolution of symptoms to return to high - contact activities ; however , patients with cervical stenosis or clinical symptoms continue to be a challenge for management . this survey may serve as a basis for future clinical trials and consensus guidelines .

Introduction Methods Results Discussion

PMC3389703

rectal cancer is often camouflaged to be part of colorectal cancer with australian statistics approximating 14 225 cases of bowel cancer in 2008 with a higher predominance among men and those above 50 years of age . meanwhile , the american counterpart recorded rectal and colon cancer to be the third leading malignancy plaguing both sexes in 2012 whereby 9% of deaths in each gender group was attributed to the disease . the risk of death before age 75 has declined over the years from a high of 1 in 50 in 1987 to 1 in 91 in 2007 and this is attributed to better early detection of precancerous lesions and management of the disease [ 1 , 2 ] . treatment of rectal cancer is primarily surgical and is highly dependent on the preoperative staging . early cancers , especially t1 tumors , have been controversially proposed for local excision either via transanal excision or transanal endoscopic microsurgery ( tems ) [ 46 ] . while some report good outcomes measurable to radical surgery , others beg to differ prompting the need for salvage therapy [ 47 ] . later stages of cancer usually follow the traditional approach of abdominoperineal resection ( apr ) or anterior resection and its success at reducing local recurrence is improved by total mesorectal excision ( tme ) [ 8 , 9 ] . however , these procedures are associated with their own set of morbidity and mortality [ 10 , 11 ] . other therapeutic modalities such as chemotherapy and radiotherapy have been included in conjunction with surgery particularly in advanced cancers . they can be used preoperatively or postoperatively either to increase the chances of a sphincter - preserving procedure to allow better quality of life or with a curative intent [ 1214 ] . an overall cancer - specific 5-year survival of 77% has been reported . in this paper , we seek to discuss the modern approach to rectal cancer surgery at all disease time points from preinvasive and early rectal cancer , resectable rectal cancer , and locally advanced and metastatic rectal cancer with an emphasis on presenting some of the controversies and the accepted standards of treatment . the advent of endoscopic mucosal resection ( emr ) for rectal tumours could not have been timelier as the race to provide a treatment that is highly efficacious and of low morbidity continues . emr has been in practice for a few decades now and is commonly used to address gastrointestinal pathologies such as a barrett 's oesophagus , and early gastric cancers ( egc ) with a reported local recurrence rate of 2% in egc [ 1618 ] . the procedure focuses on removal of diseased mucosal tissue or at most , the superficial submucosa instead of a full - thickness excision [ 16 , 19 ] . it can be done by means of a strip biopsy , local injection of hypertonic saline - epinephrine in the inject , lift and cut technique , cup and suction otherwise known as the emr - cap technique or emr with band ligation . if necessary , more than one of the aforementioned methods can be applied [ 16 , 20 , 21 ] . emr is an alternative to the locally - approached transanal excision ( tae ) and transanal endoscopic microsurgery ( tems ) . generally , local excision of rectal cancer is indicated for early disease that encompasses its precursor ( dysplasia or adenoma ) , t1 tumours that display moderate - to - well differentiation and no lymphatic or vascular invasion [ 6 , 16 , 17 , 22 ] . at present , it is known that emr can be performed on flat , sessile , or lateral spreading rectal tumours [ 2224 ] . the success of emr is reflected through its high overall cure rate with some reporting 91% for treatment - nave patients and others at 96% [ 23 , 25 ] . one of the common consequences of emr is bleeding which occurs from 1%45% of cases . the bleed can be minor and is easily manageable with haemostatic clips or severe requiring blood transfusions or even surgery [ 19 , 24 , 26 ] . 0.7% to 4% of cases are complicated with perforation which can appear later as abdominal distension and pain necessitating further operation [ 25 , 26 ] . while emr is an excellent therapeutic option for rectal tumours , it is operator dependent . identifying the lesion especially if it is a lateral spreading tumour can be challenging to the untrained eye as it displays subtle changes but a meta - analysis showed that the chances of a complete en bloc resection is directly proportional to experiences if the operator . the concern is that complete resection and a proper histological evaluation is rendered difficult with larger lesions , thus running a risk of local recurrence [ 23 , 25 , 28 ] . in spite of this , some studies showed that the success of the resection is not statistically different between the two techniques [ 26 , 29 ] . complicating failure of the mucosa to lift during the inject , lift and cut technique may occur secondary to submucosal fibrosis . the success rate of a repeated resection is reduced from 91.0% in a treatment - nave patient to 74.5% in a previously attempted lesion . it is reported that the time for conversion of a precursor lesion to cancer is variable , with dwelling times in the adenoma state ranging from 4 years to as long as 48 years . in fact , flat adenomas need not necessarily be treated as it is almost always noninvasive . this questions the need for emr in such lesions and more so , the implication on the patient who is no doubt heading for months of unwarranted anxiety . nevertheless , emr is a safe and effective treatment modality that is minimally invasive and only requires conscious sedation [ 25 , 26 , 28 ] . it is also efficient with moss et al . reporting a mean procedural duration of 25 minutes while another study accounted a range of 25137 minutes [ 25 , 29 ] . when possible , patients can be treated as an outpatient with discharges within the same day [ 31 , 32 ] . a comparison between tae and endoscopic resection showed that the latter was associated with a significantly shorter hospital stay of 2.7 1.1 days with a mean difference of 6.2 days . similarly , tems recorded a range of 044 days of hospitalization while emr had a range of 027 days . emr per se is not as costly as the other procedures available , thus allowing a cheaper and less invasive option for the patient . this translates into reduced expenditure for the spender [ 20 , 29 , 33 ] . on the other hand , tems and tae lesions larger than 8 cm in diameter can be removed with good effect via tems [ 34 , 35 ] . where emr may fail to completely remove the tumour , both tems and tae first attempt of tems for large rectal adenoma is reported to have a lower early local recurrence rate at 10.2% compared to emr at 31.0% ( p < 0.001 ) . meanwhile , low risk - t1 tumour recurrence rate following tems is 010% while santos et al . tae is estimated to have a 15% local recurrence rate of the malignancy at five years . it would seem that the recurrence rate following tae is high compared to emr but contradicting this is a 32-patient study by lee et al . which showed no recurrences of cancer following either endoscopic resection or tae at a median followup of 15 months ( range 699 ) . studies evaluating the disease - specific and overall survival rates ( tems versus radical surgery and tae versus radical surgery ) showed that the values were not statistically significant to one another indicating the efficacy of these procedures [ 5 , 38 ] . emr appears to be favourable as tems and tae have the added adverse effects including wound breakdown , incontinence , urgency , strictures , neuralgia , and anovaginal fistula [ 34 , 35 , 37 , 39 ] . barendse et al . studied both emr and tems and discovered that the former was associated with half the percentage ( 12% ) of postoperative complications compared to the latter ( 24% ) . however , given the variable recurrence rates , there is some apprehension towards emr . in view of this instead , it is a judgment call by the surgeon and more importantly the patient himself based on the local expertise and the pros and cons of each option available . as we push the fort of combination treatment , it is likely that in the future , local excisional strategies will become a more commonly adopted strategy in complete or subcomplete responding tumors after chemoradiotherapy . however , the limitation of mesorectal sampling may mean that more intensive followup is required to detect recurrence at the local excisional site and/or mesorectal lymph nodes . its proximity to the anal sphincter also makes this a major consideration into the surgical approach towards resection . in the localized setting , a multimodality approach has in recent years been developed and investigated in trials to improve local recurrence , disease - free and overall survival using a variety of sequences of chemotherapy and radiotherapy . prior to surgery , adequate local staging is paramount in the surgical planning and accurate prediction of the extent of bowel wall involvement may be obtained through endorectal ultrasonography and magnetic resonance imaging may serve the similar purpose but also identify the involvement of lymph node metastases . the aims of rectal cancer surgery are to remove the tumor with an adequate distal margin of a minimum of 2 cm in the case of a low rectal tumor with sphincter preservation or 5 cm in the case of a rectosigmoid / upper rectal tumor with restoration of intestinal continuity through an anastomosis . if a 2 cm distal margin can not be secured , an abdominoperineal excision with enbloc resection of the entire anorectum and an end colostomy is required . surgery should be performed using a no - touch technique with high ligation of the inferior mesenteric artery to achieve adequate lymphatic sampling through harvesting of the sigmoid mesentery and mesorectum . tumors of the middle and lower rectum require a total mesorectal excision ( tme ) . tme reduces the risk of local recurrence and although a prospective randomized trial has not been conducted to verify its efficacy , longitudinal data derived from the netherlands where a tme trial was conducted following rigorous training of colorectal surgeons demonstrated that there was an observed reduction in rate of local recurrence from 16% to 9% with tme surgery being an independent predictor of overall survival . further , data from the mrc cr07 and ncic - ctg co16 randomized trials demonstrated that the plane of surgery achieved in patients undergoing rectal cancer surgery impacted on local recurrences with a 3-year local recurrence rate of 4% for patients whose surgery was completed with achievement of the mesorectal plane , 7% for intramesorectal plane and 13% for muscularis propria plane . pertinent also in low rectal cancers requiring abdominoperineal excision , to avoid a coning effect in the deep pelvis as the tumor is approached from both the abdomen and perineum , extended abdominoperineal excision incorporating resection of the levator muscles to reduce inadvertent bowel perforation and breaching of the circumferential resection margin . today , in the current era of laparoscopic surgery where shorter postoperative hospital stays , reduction in pain scores , shorter time of return of bowel function , lower treatment cost , and improved cosmesis may be achieved , these standardized surgical resections have been demonstrated to be feasible in the laparoscopic approach . initially , the laparoscopic approach was first examined in colon cancer with at least 4 large randomized trials ; cost study group trial from the usa , color trial from europe , mrc clasicc trial from the uk , and a trial in rectosigmoid cancers from the prince of wales hospital in hong kong demonstrating equivalent oncologic efficacy with similar overall survival , disease - free survival and local and distant recurrences [ 4649 ] . these studies although predominantly examined in the setting of colon cancer were quick to translate into standard practice for rectal cancer despite limited large scale prospective randomized trials . however , there remain concerns over the ability to achieve adequate mesorectal excision and clear surgical margins in laparoscopic rectal cancer surgery . in the uk mrc clasicc trial , there was a 34% conversion rate from laparoscopic to open surgery in the rectal cohort , increase performance of tme surgery to ensure adequacy of the distal resection margin in the laparoscopic group because of the inability to palpate the tumor for localization . nonetheless , there was no difference in positive circumferential resection margin , local recurrence , disease - free , and overall survival in both the laparoscopic versus open anterior resection and abdominoperineal resection groups . the prince of wales hospital group from hong kong reported a small prospective randomized trial of laparoscopic assisted versus open abdominoperineal resection for low rectal cancer randomizing 99 patients ( 51 lap - assisted and 48 open ) demonstrating earlier return of bowel function , decrease time to mobilization , lesser analgesia requirement , longer operative time , and higher direct cost in the lap - assisted group without difference in morbidity and mortality . in an update of this trial , after 10 years of followup , the authors reported higher rates of bowel obstruction requiring hospitalization and intervention in the open group but similar oncologic outcomes were shown with 10-year survival of 83.5% and 78% ( p = 0.595 ) and 10-year disease - free survival 82.9% and 80.4% ( p = 0.698 ) in the lap - assisted and open group , respectively . in the corean trial that randomized 170 patients in each arm to laparoscopic and open surgery for mid or low rectal cancer after preoperative chemoradiotherapy , the laparoscopic group had lower amount of blood loss , longer operative time , quicker recovery of bowel function , and a lesser amount of analgesic requirement . surgical quality indicators including the circumferential resection margin , macroscopic quality of the tme specimen , number of harvested lymph nodes , and perioperative morbidity were similar between groups . in a spanish randomized trial of 204 patients of whom 78.6% in the open group and 76.2% in the laparoscopic group underwent sphincter - preserving surgery ; blood loss was greater in the open surgery group , operative time was longer in the laparoscopic group , and return to diet and hospital stay was longer in the open surgery group . complication rates were similar between groups but a larger number of lymph nodes were isolated in the laparoscopic group . together , these three small randomized trials suggest that the laparoscopic approach achieves improved short - term outcomes without compromising the surgical quality of rectal cancer operations in skilled hands but a longer operative time is required . longer followup of these trials and results of ongoing larger trials will confirm the long - term oncologic outcomes of laparoscopic rectal cancer surgery . thorough preoperative clinical staging is paramount in the sequencing of multimodality therapy for rectal cancer . for smaller tumors t1/t2 , surgery alone with wide surgical resection of low anterior resection or abdominoperineal resection for distal lesions not amendable to low anterior resection may be performed . this allows sampling of mesorectal lymph node for accurate pathological staging . in patients who are medically unfit or who adamantly refuse to undergo standardized resectional surgery , local excision with or without chemoradiotherapy this strategy fails to sample the mesorectal lymph nodes that are essential in disease staging . in a large single institution cohort study comparing their retrospective experience of 350 with stage i rectal cancer of whom 283 patients ( 80.9% ) underwent standardized resection and 67 patients ( 19.1% ) undergoing local excision , 5-year local recurrence was 14.1% in the local excision group compared to 3.3% in the standardized resection group . this significantly higher local recurrence rate may then be salvaged through multimodality approach combining preoperative chemoradiotherapy and surgery . however , at times , these local recurrences may not be resected with standardized resectional surgery and may require radical surgeries such as a pelvic exenteration . for clinically staged t3/t4 rectal tumors without clinically identified nodal disease ( stage ii ) who undergo tme surgery with either a low anterior resection or abdominoperineal resection with harvesting of at least 12 lymph nodes examined and staged as pn0 chemoradiation is not required . chemoradiation may be considered in the setting of pt3n0 tumors with adverse pathologic features , non - tme surgery or in those with fewer than 12 lymph nodes harvested . for t3/t4 tumors with lymph node metastases ( stage iii ) identified clinically , treatment involves both chemoradiation with fluorouracil ( 5-fu ) and total mesorectal excision ( tme ) based surgery . postoperative chemoradiation was shown to achieve superior results over postoperative radiation alone with a 34% reduction in recurrence rate with reductions observed for local recurrences and distant metastasis . when postoperative chemotherapy was compared to radiotherapy in the nsabp r-01 randomized trial , postoperative chemotherapy appeared to improve survival and radiotherapy reduced the incidence of locoregional recurrence without survival improvements . given the benefits of chemoradiation in achieving local control as an adjunct to surgery , the german rectal cancer study group then conducted a randomized trial of 421 patients to determine the perisurgical sequencing of chemoradiation for rectal cancer . these investigators compared preoperative to postoperative chemoradiation and demonstrated that the 5-year cumulative incidence of local recurrence was 6% in the preoperative arm compared to 13% in the postoperative arm ( p = 0.006 ) with fewer grad 3/4 acute and long - term toxic effects of chemoradiation observed in the preoperative arm compared to the postoperative arm . in a smaller korean trial , the improved effects of local control was not demonstrated in the preoperative compared to the postoperative chemoradiation arm , however , it was shown that an increased rate of sphincter preservative surgery could be achieved . the exact type of preoperative therapy was also recently debated with a short course radiation ( 25 gy in 5 fractions ) followed by surgery a week after or a long course chemoradiation ( 50.4 gy in 28 fractions combined with systemic chemotherapy ) followed by surgery four to six weeks after . the brief use of radiotherapy in the short course setting has been argued upon its role in providing adequate tumor response to allow sphincter preservative surgery . two randomized trials ; polish ( n = 312 ) and australian ( n = 326 ) compared these two regimens and both trials showed a lower rate of early acute toxicity and reduce cost of treatment without any difference in long - term oncologic outcomes [ 59 , 60 ] . after preoperative chemoradiation , guidelines recommend adjuvant chemotherapy for patients with node positive disease . however , the eortc 22921 trial of 785 clinically staged t3/t4 rectal cancer patients randomized to receive adjuvant fluorouracil based chemotherapy after preoperative ( chemo ) radiotherapy and surgery showed no survival benefit of chemotherapy on disease - free survival . however , specific subgroup analysis was performed to determine the appropriate role of adjuvant chemotherapy and showed that pathologically staged t0 - 2 ( ypt0 - 2 ) patients appeared to benefit in terms of both disease - free and overall survival from adjuvant chemotherapy compared to ypt3/t4 patients . importantly , adjuvant chemotherapy did not appear to demonstrate any difference in outcomes of patients with ypn0 or ypn+ disease . this demonstrates that further benefits of adjuvant chemotherapy are only observed in responding patients ( ypt0 - 2 ) . further trials are required in this area to determine the appropriate role of adjuvant chemotherapy and the selection of high - risk populations who may then benefit from other modern adjuvant agents . tumors extending beyond the rectal wall with invasion into surrounding viscera are considered locally advanced rectal cancer . often in patients who develop local recurrence , recurrent disease often similarly involve adjacent structures where the previously excised rectal tumor was located . although its incidence has decreased following total mesorectal excision and the incorporation of preoperative chemoradiation , when it occurs , it remains a debilitating condition that is difficult to treat . palliative radiotherapy may provide brief symptom relief for an average of 3 months with median survival in these patients being between 12 and 24 months [ 6264 ] . surgery may provide a long - term palliation to the debilitating symptoms of pelvic recurrences . in the curative setting , delivery of long course preoperative chemoradiotherapy may induce tumor down - staging to facilitate surgical resection . in a randomized trial comparing neoadjuvant radiotherapy to chemoradiotherapy in 207 patients with locally unresectable t4 primary rectal or local recurrent rectal cancer , chemoradiotherapy compared to radiotherapy facilitated higher potential for an r0 resection ( 84% versus 68% ; p = 0.009 ) , improved local control in patients who underwent a r0 or r1 resection ( 82% versus 67% at 5 years ; p = 0.03 ) , improved time to treatment failure ( 63% versus 44% ; p = 0.003 ) , cancer - specific survival ( 72% versus 55% ; p = 0.02 ) and overall survival ( 66% versus 53% ; p = 0.09 ) . the surgery involved necessitated pelvic exenteration where adjacent organs are resected with an aim to achieve clear margins . in patients with primary t4 rectal cancer and recurrent rectal cancer , 28% and 20% of patients in the chemoradiotherapy arm and 27% and 46% in the radiotherapy arm , respectively , required exenteration . intraoperative radiotherapy ( external - beam ) ( iort ) is another approach to improve local control . this treatment modality has been investigated in patients with locally advanced unresectable rectal cancer after chemoradiotherapy down - staging and surgery . valentini et al . reported 100 patients with t4m0 tumors undergoing r0 resection after down - staging by chemoradiotherapy and showed that 5-year local control was 90% in patients with r0 surgery and 100% in patients with r0 surgery and iort . further , iort did not appear to compensate for suboptimal surgery with 5-year overall survival of 68% observed in patients with r0 surgery compared to 22% in r1 or r2 surgery . such radical surgery however is not widely performed and only available in specialized institutions . in a pattern of care study of the united states population through data identified from the surveillance , epidemiology and end results ( seer ) registry , only 33% of patients with locally advanced adherent colorectal cancer underwent multivisceral resection for which was shown to be associated with improved overall survival . in patients with synchronous rectal cancer with liver metastases , there remains an enigma over the appropriate sequencing of chemotherapy , radiotherapy , and surgery . in a study from the erasmus university , van der pool et al . reported a consecutive series of 57 patients of whom 29 patients underwent resection of the primary tumor first , 8 patients underwent simultaneous rectal and liver resection and 20 underwent a liver - first approach achieving a median survival of 47 months and 5-year survival of 38% . this was achieved in a multidisciplinary setting where an individualized approach towards treatment was taken . in general , if resection of both primary tumor and liver metastases may be completed in one surgery , this approach may be favored . if the liver metastases are not completely resectable during the rectal surgery or are too advanced for hepatectomy irrespective , neoadjuvant chemotherapy is preferred followed by a liver - first approach followed by restaging and preoperative radiotherapy and rectal surgery . in patients with metachronous liver metastases , results of large clinical series have shown that median survival range from 43 months to 64 months with 5-year survival ranging between 37% to 51% [ 68 , 69 ] . of note , in a large international multi - institutional registry study , rectal primary tumor were associated with extrahepatic recurrences after hepatectomy for liver metastases , hence emphasizing the importance of local control in the pelvis . however , there is no difference in colon or rectal based primary tumor site impacting outcomes after hepatectomy for colorectal liver metastases . epidemiological and observatory data from the followup of patients with curatively treated colorectal cancer have shown that rectal cancer patients have a higher preponderance to developing recurrence in the lungs [ 7173 ] . in a large population based study of 30 years in burgundy ( france ) , mitry et al . reported that lung metastases often accompanied liver metastases with synchronous lung metastases being more common in left colonic and rectal cancers [ 7173 ] . surgery for lung metastases is indicated if the lung metastases are the only site of disease and a complete resection may be achieved . where extrapulmonary metastases are present , a highly selective approach should be taken often after adequate tumor response to systemic chemotherapy to select patients whose disease is amendable to resection of both lung and extra - pulmonary metastases . the highest level of evidence for resection of lung metastases comes from a large systematic review of 20 published studies for pulmonary metastasectomy for colorectal lung metastases . report a median 5-year overall survival of 40% in this selected group of patients who underwent surgery . however , given that the liver will often be involved when there is lung metastases , it is important that the selection of patients for pulmonary metastasectomy should include a sufficient disease - free interval from previous liver resection , use of prethoracotomy cea levels and the absence of mediastinal lymph node involvement as a separate selection criteria in this group of patients . presently , a randomized trial ( pulmicc ) funded by cancer research uk is seeking to investigate if pulmonary metastasectomy contributes to improved survival of patients with colorectal lung metastases by randomizing patients with a history of resected colorectal cancer who are found to have pulmonary metastases to be randomly allocated to active monitoring or active monitoring with pulmonary metastasectomy with overall survival , relapse - free survival , lung function , and patient - reported quality of life as endpoints of this clinical trial . shedding of tumor during the difficult abdominoperineal resection , low anterior resection operation , or invasion of a large t3/t4 tumor in the upper rectum above the peritoneal reflection may result in the shedding of free peritoneal tumor cells within the abdominopelvic peritoneal cavity . the growth and implantation of these cells may result in the development of peritoneal metastases ( carcinomatosis ) . results of cytoreductive surgery and hyperthermic intraperitoneal chemotherapy ( hipec ) have shown that this combined modality technique allows complete excision of peritoneal tumors with locoregional control achieved through the chemoperfusate . in colorectal cancer , a randomized trial comparing cytoreductive surgery and hipec demonstrated a median survival of 22.3 months compared to 12.6 months in patients receive systemic chemotherapy with or without palliative surgery . however , in this trial of 105 patients , only 12 patients had rectal cancer . again , in a large registry study of the french experience of hipec in colorectal cancer , of 523 patients included , only 36 patients ( 7% ) had primary colorectal tumor of rectal origin . in another international registry of 506 patients with colorectal peritoneal metastases undergoing cytoreductive surgery and hipec , there were 40 patients ( 8% ) with the primary tumor of rectal origin and the median survival of these patients was 19.2 months compared to 24 months in patients with tumors of sigmoid origin , 17 months for patients with tumors of the right colon and 20 months for patients with tumors of the left colon . these results inform us that peritoneal metastases from rectal cancer is less common but prevent us from drawing any meaningful conclusion on whether there may be disparate survival outcomes for colon and rectal cancer patients with peritoneal metastases . based on the currently available evidence , selected rectal cancer patients with limited peritoneal disease burden may be considered for cytoreductive surgery and hipec . rectal cancer surgery has made significant advancement at all - time points of the natural history of this disease . there are now minimally invasive local excision options that are currently being tested for efficacy as we await further clinical trials to verify its efficacy for pre - invasive and early lesions . laparoscopic rectal cancer surgery incorporating total mesorectal excision is now emerging as the standard surgical approach with ongoing clinical trials that will confirm its short and long - term oncologic efficacy . there is now evidence based results from clinical trials for both preoperative short and long - course chemoradiation prior to surgery for resectable tumors for which has been shown to improve local control of disease albeit its aim achieving sphincter preservative surgery where possible . ultimately , the goal of this being to achieve adequate sampling of mesorectal lymph nodes to provide adequate information for tumor staging and prediction of local and distant recurrences for which will guide treatment decisions . there is now evidence for resecting metastases from rectal cancer from local recurrences , liver , lung , and peritoneal metastases based on a body of retrospective clinical data with long - term followup .

rectal cancer is a distinct subset of colorectal cancer where specialized disease - specific management of the primary tumor is required . there have been significant developments in rectal cancer surgery at all stages of disease in particular the introduction of local excision strategies for preinvasive and early cancers , standardized total mesorectal excision for resectable cancers incorporating preoperative short- or long - course chemoradiation to the multimodality sequencing of treatment . laparoscopic surgery is also increasingly being adopted as the standard rectal cancer surgery approach following expertise of colorectal surgeons in minimally invasive surgery gained from laparoscopic colon resections . in locally advanced and metastatic disease , combining chemoradiation with radical surgery may achieve total eradication of disease and disease control in the pelvis . evidence for resection of metastases to the liver and lung have been extensively reported in the literature . the role of cytoreductive surgery and hyperthermic intraperitoneal chemotherapy for peritoneal metastases is showing promise in achieving locoregional control of peritoneal dissemination . this paper summarizes the recent developments in approaches to rectal cancer surgery at all these time points of the disease natural history .

1. Introduction 2. Role of Surgery for Advanced and Metastatic Rectal Cancer 3. Conclusion

PMC3579339

the study was approved by the research ethics boards of the university of ottawa and ottawa hospital . two of the participants were competitive athletes training 6 days per week , while those remaining were recreationally active . all participants had been regularly performing both aerobic and resistance exercise at least three times weekly for a minimum of 6 months . participants were using either multiple daily injections ( mdis ) of insulin or continuous subcutaneous insulin infusion with an insulin pump . the same cohort of participants also took part in a previously published study from the same research group ( 20 ) . testing took place in the human and environmental physiology research unit at the university of ottawa . participants provided written informed consent prior to being tested for vo2max , muscular strength ( eight repetition maximum ) , and hba1c as previously described ( 20 ) . the cgms system gold ( medtronic , northridge , ca ) was used in this study so that participants would be blinded to their glucose values and would not change their behavior based on real - time glucose monitoring . onetouch ultrasmart handheld glucose meters ( lifescan ; johnson & johnson , milpitas , ca ) and coded strips ( same code throughout the study ) were provided for capillary glucose tests . twenty - four hours after the end of the exercise / no - exercise control session , cgm units were retrieved and data were downloaded ( minimed solutions v.3.0c ; medtronic , northridge , ca ) . over each monitoring period , participants consumed the same self - selected breakfast , lunch , and dinner daily at the same times of day and recorded food and insulin intake on study log sheets . participants refrained from exercise for 24 h before insertion of the sensor ( 48 h before the experimental session ) and avoided caffeine and alcohol during the monitoring period . participants arrived at the laboratory at 4:00 p.m. on the day after the sensor insertion . the following sessions were performed , separated by at least 5 days : 1 ) resistance exercise , three sets of eight repetitions maximum of seven different exercises with 90-s rest between sets ( duration 45 min ) ; 2 ) aerobic exercise , 45 min of treadmill exercise ( 60% of vo2max ) ; and 3 ) no - exercise control , 45 min of seated rest . testing sessions for the female participants , who were using monophasic oral contraceptives , took place during the active pill - consumption phase . participants reduced their insulin doses on exercise days by making either a 10% decrease in intermediate or long - acting insulin ( mdi ) or a 50% decrease in basal rate starting 1 h before exercise and maintained until the end of exercise for pump users . if blood glucose was < 5 mmol / l upon arrival , those using insulin pumps decreased their basal rate a further 25% . participants consumed a standard snack ( glucerna chocolate graham snack bars , 150 calories , 25 g carbohydrate ; abbott laboratories , abbott park , il ) at 4:00 p.m. every day , including the exercise day , with the bar consumed upon arrival at the laboratory . capillary glucose was checked 60 and 30 min before exercise and immediately prior to exercise to ensure glucose levels 5.5 and 13.9 mmol / l . venous blood samples were collected through an intravenous catheter at baseline and 5 , 10 , 15 , 30 , and 45 min during all three testing sessions ( resistance exercise , aerobic exercise , and no - exercise control ) and at the 50- , 55- , 60- , 65- , 75- , 85- , 95- , and 105-min blood was immediately mixed by inversion , centrifuged ( 4,000 revolutions / min for 4 min ) , and stored at 80c . the hexokinase timed end point method was used to determine plasma glucose levels using the beckman coulter unicel dxc600 synchron clinical analyzer ( beckman coulter , fullerton , ca ) and synchron cx systems glucose reagent ( cat . glucose levels were compared among sessions using two - way repeated - measures ( time and condition ) anova . exercise and recovery periods were examined separately among the three sessions ( aerobic , resistance , and no - exercise control ) . the exercise period consisted of the 5- , 10- , 15- , 30- , and 45-min time points , while the recovery period consisted of the remaining time points . paired sample t tests were used to perform pairwise post hoc comparisons for each time point between conditions ( aerobic , resistance , or no - exercise control ) within exercise and recovery separately and to examine changes from baseline and changes from the end of exercise within each exercise condition . cgm data were examined as 15-min averages in the following windows : 24-h pre - exercise , overnight ( 12:00 a.m. to 6:00 a.m. ) pre - exercise , 16 h postexercise , overnight postexercise , and 24 h postexercise . a two - way ( time and condition ) repeated - measures anova was used to compare among conditions in the 16-h postexercise period . paired sample t tests were then used to perform pairwise post hoc comparisons for each 15-min segment . the minimum , maximum , and mean blood glucose ; amount of time spent in hypoglycemic and hyperglycemic states ; and areas under the curve ( aucs ) for time spent in hypo- and hyperglycemic states were determined for each window . pre - exercise values were compared with postexercise values within exercise conditions using related - samples wilcoxon signed rank tests . differences among conditions were examined using related - samples friedman two - way anova by ranks . agreement between cgm data and capillary glucose over the 3 days was determined by performing pearson correlations between sensor glucose and self - recorded capillary glucose values . daily total insulin and carbohydrate intake was calculated based on the information provided in participant logs . comparisons among conditions for each day were made using related - samples friedman two - way anova by ranks . where significant results were found , related - samples wilcoxon signed rank tests ensued for determination of where the differences lie . analyses were performed using spss 18.0 for windows ( spss , chicago , il ) . testing took place in the human and environmental physiology research unit at the university of ottawa . participants provided written informed consent prior to being tested for vo2max , muscular strength ( eight repetition maximum ) , and hba1c as previously described ( 20 ) . the cgms system gold ( medtronic , northridge , ca ) was used in this study so that participants would be blinded to their glucose values and would not change their behavior based on real - time glucose monitoring . onetouch ultrasmart handheld glucose meters ( lifescan ; johnson & johnson , milpitas , ca ) and coded strips ( same code throughout the study ) were provided for capillary glucose tests . twenty - four hours after the end of the exercise / no - exercise control session , cgm units were retrieved and data were downloaded ( minimed solutions v.3.0c ; medtronic , northridge , ca ) . over each monitoring period , participants consumed the same self - selected breakfast , lunch , and dinner daily at the same times of day and recorded food and insulin intake on study log sheets . participants refrained from exercise for 24 h before insertion of the sensor ( 48 h before the experimental session ) and avoided caffeine and alcohol during the monitoring period . participants arrived at the laboratory at 4:00 p.m. on the day after the sensor insertion . the following sessions were performed , separated by at least 5 days : 1 ) resistance exercise , three sets of eight repetitions maximum of seven different exercises with 90-s rest between sets ( duration 45 min ) ; 2 ) aerobic exercise , 45 min of treadmill exercise ( 60% of vo2max ) ; and 3 ) no - exercise control , 45 min of seated rest . testing sessions for the female participants , who were using monophasic oral contraceptives , took place during the active pill - consumption phase . participants reduced their insulin doses on exercise days by making either a 10% decrease in intermediate or long - acting insulin ( mdi ) or a 50% decrease in basal rate starting 1 h before exercise and maintained until the end of exercise for pump users . if blood glucose was < 5 mmol / l upon arrival , those using insulin pumps decreased their basal rate a further 25% . participants consumed a standard snack ( glucerna chocolate graham snack bars , 150 calories , 25 g carbohydrate ; abbott laboratories , abbott park , il ) at 4:00 p.m. every day , including the exercise day , with the bar consumed upon arrival at the laboratory . capillary glucose was checked 60 and 30 min before exercise and immediately prior to exercise to ensure glucose levels 5.5 and 13.9 mmol / l . venous blood samples were collected through an intravenous catheter at baseline and 5 , 10 , 15 , 30 , and 45 min during all three testing sessions ( resistance exercise , aerobic exercise , and no - exercise control ) and at the 50- , 55- , 60- , 65- , 75- , 85- , 95- , and 105-min time points during recovery . blood was immediately mixed by inversion , centrifuged ( 4,000 revolutions / min for 4 min ) , and stored at 80c . the hexokinase timed end point method was used to determine plasma glucose levels using the beckman coulter unicel dxc600 synchron clinical analyzer ( beckman coulter , fullerton , ca ) and synchron cx systems glucose reagent ( cat . glucose levels were compared among sessions using two - way repeated - measures ( time and condition ) anova . exercise and recovery periods were examined separately among the three sessions ( aerobic , resistance , and no - exercise control ) . the exercise period consisted of the 5- , 10- , 15- , 30- , and 45-min time points , while the recovery period consisted of the remaining time points . paired sample t tests were used to perform pairwise post hoc comparisons for each time point between conditions ( aerobic , resistance , or no - exercise control ) within exercise and recovery separately and to examine changes from baseline and changes from the end of exercise within each exercise condition . cgm data were examined as 15-min averages in the following windows : 24-h pre - exercise , overnight ( 12:00 a.m. to 6:00 a.m. ) pre - exercise , 16 h postexercise , overnight postexercise , and 24 h postexercise . a two - way ( time and condition ) repeated - measures anova was used to compare among conditions in the 16-h postexercise period . paired sample t tests were then used to perform pairwise post hoc comparisons for each 15-min segment . the minimum , maximum , and mean blood glucose ; amount of time spent in hypoglycemic and hyperglycemic states ; and areas under the curve ( aucs ) for time spent in hypo- and hyperglycemic states were determined for each window . pre - exercise values were compared with postexercise values within exercise conditions using related - samples wilcoxon signed rank tests . differences among conditions were examined using related - samples friedman two - way anova by ranks . agreement between cgm data and capillary glucose over the 3 days was determined by performing pearson correlations between sensor glucose and self - recorded capillary glucose values . daily total insulin and carbohydrate intake was calculated based on the information provided in participant logs . comparisons among conditions for each day were made using related - samples friedman two - way anova by ranks . where significant results were found , related - samples wilcoxon signed rank tests ensued for determination of where the differences lie . analyses were performed using spss 18.0 for windows ( spss , chicago , il ) . twelve ( 10 male and 2 female ) nonobese ( bmi 25.3 3.0 kg / m ) , physically active ( vo2max 51.2 10.8 ml kg min ) individuals aged 1762 years ( mean age 31.8 15.3 years ) took part in the study . mean diabetes duration was 12.5 10.0 years , and participants were in moderate to good control of their blood glucose levels ( hba1c 7.1 1.1% ) . five participants were receiving insulin by mdi , while seven were using continuous subcutaneous insulin infusion . 1 . information regarding treadmill speeds / inclines as well as the workloads for the resistance exercise sessions is provided in supplementary table 1 . a significant interaction between time and exercise modality was observed ( p < 0.001 ) for mean exercise glucose levels indicating that the total declines and the rates of decline in plasma glucose levels differed among sessions ( fig . 1 ) . there were no significant differences among sessions in pre - exercise baseline plasma glucose concentration . a gradual decline in plasma glucose concentration occurred with resistance exercise ( from 8.4 2.7 to 6.8 2.3 mmol / l over the 45-min session ) , resulting in levels that were significantly lower than baseline by the end of exercise ( p = 0.008 ) . no changes from baseline were detected throughout the first 45 min of the no - exercise session ( from 8.4 3.5 to 8.6 3.8 mmol / l [ p = 0.585 ] ) . in contrast , during the aerobic exercise , plasma glucose levels declined rapidly and more dramatically ( from 9.2 3.4 to 5.8 2.0 mmol / l over 45 min [ p = 0.001 ] ) , resulting in significant changes from baseline within 10 min . glucose levels in the aerobic session were lower than the no - exercise session after 30 min of the activity . mean se plasma glucose during the experimental sessions ( represented by box ) and 60 min of recovery ( n = 12 for aerobic exercise and no - exercise control ; n = 11 for resistance exercise ) . , no - exercise control ; , resistance exercise , , aerobic exercise . differences were only considered statistically significant if still significant after bonferroni corrections for multiple comparisons . during exercise , participants were provided with glucose tablets if blood glucose fell to < 4.5 mmol / l . a significant interaction of time and exercise modality was also observed in mean plasma glucose levels during recovery ( p < 0.001 ) . plasma glucose levels were stable after the resistance exercise and no - exercise sessions but increased by 2.2 0.6 plasma glucose levels were not different from either no - exercise or resistance exercise at 60 min postexercise . the number of participants requiring glucose tablets during the testing session were two , nine , and three for the no - exercise control , aerobic , and resistance exercise sessions , respectively ( supplementary table 2 ) . differences were significant between no - exercise control and aerobic exercise ( p = 0.007 ) . there were no significant differences in carbohydrate intake among conditions on the day before or the day after the laboratory session or in the 6 h after exercise ( table 1 ) ; however , carbohydrate intake was higher on the exercise testing day in the aerobic exercise session compared with the resistance exercise session ( p = 0.013 ) , mostly because of differences in supplementation during exercise . two participants using insulin pumps chose to omit their usual insulin bolus with the glucerna bar before exercise , and one insisted on suspending basal insulin ( instead of a 50% reduction ) when learning upon arrival at the laboratory that it was the day for aerobic activity . daily insulin intake did not differ significantly among conditions on any day of sensor wear . insulin and carbohydrate intake during the 6 h after exercise * pearson correlations between capillary glucose levels measured on handheld meters and interstitial glucose levels measured by cgm were 0.95 , 0.90 , and 0.94 during nonlaboratory periods in the resistance exercise , aerobic , and no - exercise control sessions , respectively . during the 24 h before either exercise trial or no - exercise control , there were no significant differences among sessions in the total time spent in hypoglycemia , auc for hypoglycemia , number of hyperglycemic events , time spent in a hyperglycemic state , auc for hyperglycemia , or mean blood glucose . postexercise cgm data were only available for 11 and 10 of 12 participants in the no - exercise and aerobic exercise sessions , respectively , because of equipment malfunction in the remaining three sessions . data were available for all 12 participants in the resistance exercise session . in total , there were 124 paired handheld meter and cgm values for the no - exercise control condition , 113 for the aerobic condition , and 115 for the resistance exercise condition . a marginal effect of time ( p = 0.073 ) was found in the analysis of the cgm data from 1 to 6 h postexercise . higher mean interstitial glucose concentrations were found in the fourth and fifth hours after the aerobic exercise session compared with the resistance exercise session ( p = 0.018 at 5 h postexercise ) ( fig . , no - exercise control session ; , aerobic exercise session ; , resistance exercise session . the box represents the period of time where glucose was significantly higher after aerobic exercise compared with resistance exercise ( p < 0.05 ) . n = 11 ( no - exercise control ) , n = 10 ( aerobic ) , and n = 12 ( resistance ) . although there were twice as many nocturnal hypoglycemic excursions ( table 2 ) detected by cgm devices after resistance exercise ( nine in total ) versus aerobic exercise and no exercise ( four for each ) , differences among conditions were not statistically significant . there was , however , a trend of more episodes of nocturnal hyperglycemia after resistance exercise ( p = 0.059 ) compared with the pre - exercise night , but differences in mean glucose levels were not significant . summary of overnight cgm data for the night after resistance exercise , aerobic exercise , and no - exercise control 1 . information regarding treadmill speeds / inclines as well as the workloads for the resistance exercise sessions is provided in supplementary table 1 . a significant interaction between time and exercise modality was observed ( p < 0.001 ) for mean exercise glucose levels indicating that the total declines and the rates of decline in plasma glucose levels differed among sessions ( fig . 1 ) . there were no significant differences among sessions in pre - exercise baseline plasma glucose concentration . a gradual decline in plasma glucose concentration occurred with resistance exercise ( from 8.4 2.7 to 6.8 2.3 mmol / l over the 45-min session ) , resulting in levels that were significantly lower than baseline by the end of exercise ( p = 0.008 ) . no changes from baseline were detected throughout the first 45 min of the no - exercise session ( from 8.4 3.5 to 8.6 3.8 mmol / l [ p = 0.585 ] ) . in contrast , during the aerobic exercise , plasma glucose levels declined rapidly and more dramatically ( from 9.2 3.4 to 5.8 2.0 mmol / l over 45 min [ p = 0.001 ] ) , resulting in significant changes from baseline within 10 min . glucose levels in the aerobic session were lower than the no - exercise session after 30 min of the activity . mean se plasma glucose during the experimental sessions ( represented by box ) and 60 min of recovery ( n = 12 for aerobic exercise and no - exercise control ; n = 11 for resistance exercise ) . , no - exercise control ; , resistance exercise , , aerobic exercise . differences were only considered statistically significant if still significant after bonferroni corrections for multiple comparisons . during exercise , participants were provided with glucose tablets if blood glucose fell to < 4.5 mmol / l . a significant interaction of time and exercise modality was also observed in mean plasma glucose levels during recovery ( p < 0.001 ) . plasma glucose levels were stable after the resistance exercise and no - exercise sessions but increased by 2.2 0.6 plasma glucose levels were not different from either no - exercise or resistance exercise at 60 min postexercise . 1 . information regarding treadmill speeds / inclines as well as the workloads for the resistance exercise sessions is provided in supplementary table 1 . a significant interaction between time and exercise modality was observed ( p < 0.001 ) for mean exercise glucose levels indicating that the total declines and the rates of decline in plasma glucose levels differed among sessions ( fig . 1 ) . there were no significant differences among sessions in pre - exercise baseline plasma glucose concentration . a gradual decline in plasma glucose concentration occurred with resistance exercise ( from 8.4 2.7 to 6.8 2.3 mmol / l over the 45-min session ) , resulting in levels that were significantly lower than baseline by the end of exercise ( p = 0.008 ) . no changes from baseline were detected throughout the first 45 min of the no - exercise session ( from 8.4 3.5 to 8.6 3.8 mmol / l [ p = 0.585 ] ) . in contrast , during the aerobic exercise , plasma glucose levels declined rapidly and more dramatically ( from 9.2 3.4 to 5.8 2.0 mmol / l over 45 min [ p = 0.001 ] ) , resulting in significant changes from baseline within 10 min . glucose levels in the aerobic session were lower than the no - exercise session after 30 min of the activity . mean se plasma glucose during the experimental sessions ( represented by box ) and 60 min of recovery ( n = 12 for aerobic exercise and no - exercise control ; n = 11 for resistance exercise ) . , no - exercise control ; , resistance exercise , , aerobic exercise . differences were only considered statistically significant if still significant after bonferroni corrections for multiple comparisons . during exercise , participants were provided with glucose tablets if blood glucose fell to < 4.5 mmol / l . a significant interaction of time and exercise modality was also observed in mean plasma glucose levels during recovery ( p < 0.001 ) . plasma glucose levels were stable after the resistance exercise and no - exercise sessions but increased by 2.2 0.6 plasma glucose levels were not different from either no - exercise or resistance exercise at 60 min postexercise . the number of participants requiring glucose tablets during the testing session were two , nine , and three for the no - exercise control , aerobic , and resistance exercise sessions , respectively ( supplementary table 2 ) . differences were significant between no - exercise control and aerobic exercise ( p = 0.007 ) . there were no significant differences in carbohydrate intake among conditions on the day before or the day after the laboratory session or in the 6 h after exercise ( table 1 ) ; however , carbohydrate intake was higher on the exercise testing day in the aerobic exercise session compared with the resistance exercise session ( p = 0.013 ) , mostly because of differences in supplementation during exercise . two participants using insulin pumps chose to omit their usual insulin bolus with the glucerna bar before exercise , and one insisted on suspending basal insulin ( instead of a 50% reduction ) when learning upon arrival at the laboratory that it was the day for aerobic activity . daily insulin intake did not differ significantly among conditions on any day of sensor wear . pearson correlations between capillary glucose levels measured on handheld meters and interstitial glucose levels measured by cgm were 0.95 , 0.90 , and 0.94 during nonlaboratory periods in the resistance exercise , aerobic , and no - exercise control sessions , respectively . during the 24 h before either exercise trial or no - exercise control , there were no significant differences among sessions in the total time spent in hypoglycemia , auc for hypoglycemia , number of hyperglycemic events , time spent in a hyperglycemic state , auc for hyperglycemia , or mean blood glucose . postexercise cgm data were only available for 11 and 10 of 12 participants in the no - exercise and aerobic exercise sessions , respectively , because of equipment malfunction in the remaining three sessions . , there were 124 paired handheld meter and cgm values for the no - exercise control condition , 113 for the aerobic condition , and 115 for the resistance exercise condition . a marginal effect of time ( p = 0.073 ) was found in the analysis of the cgm data from 1 to 6 h postexercise . higher mean interstitial glucose concentrations were found in the fourth and fifth hours after the aerobic exercise session compared with the resistance exercise session ( p = 0.018 at 5 h postexercise ) ( fig . 2 ) . mean se glucose as measured by cgm from 1 to 12 h postexercise . , no - exercise control session ; , aerobic exercise session ; , resistance exercise session . the box represents the period of time where glucose was significantly higher after aerobic exercise compared with resistance exercise ( p < 0.05 ) . n = 11 ( no - exercise control ) , n = 10 ( aerobic ) , and n = 12 ( resistance ) . although there were twice as many nocturnal hypoglycemic excursions ( table 2 ) detected by cgm devices after resistance exercise ( nine in total ) versus aerobic exercise and no exercise ( four for each ) , differences among conditions were not statistically significant . there was , however , a trend of more episodes of nocturnal hyperglycemia after resistance exercise ( p = 0.059 ) compared with the pre - exercise night , but differences in mean glucose levels were not significant . summary of overnight cgm data for the night after resistance exercise , aerobic exercise , and no - exercise control resistance exercise resulted in much smaller declines in blood glucose during exercise than aerobic exercise or no exercise in individuals with type 1 diabetes . less carbohydrate supplementation was required during resistance exercise versus aerobic exercise , which would have attenuated some of the hypoglycemic effects of the aerobic activity . in contrast to resistance exercise and no exercise , aerobic exercise was associated with greater increases in glucose levels during early recovery , which resulted in a trend toward higher glucose concentrations in late recovery ( as measured by cgm 36 h postexercise ) . these trends were observed in the absence of any significant differences in insulin dosage or carbohydrate intake during this time . mean blood glucose levels after resistance exercise were similar to those when no exercise was performed : more stable during early recovery and within a healthier range ( 56 mmol / l ) during late recovery . as such , performance of resistance exercise may represent an alternative strategy to prevent the acute decline in blood glucose levels observed with aerobic exercise while maintaining more favorable postexercise glucose levels . there was , however , a tendency toward more frequent , albeit mild , nocturnal hypoglycemia after resistance exercise sessions , which deserves further scrutiny . the mechanisms for the more dramatic reduction in blood glucose levels during aerobic versus resistance exercise are unclear , but the reliance on anaerobic sources of fuel production during resistance exercise rather than aerobic sources ( i.e. , less reliance on blood glucose ) ( 21,22 ) may have played a role . previous studies involving anaerobic activity in individuals with type 1 diabetes ( intermittent 4-s sprints or a 10-s sprint pre- or postexercise ) found slower declines in blood glucose concentration during exercise and smaller decreases in postexercise glucose concentrations in comparison with low - intensity aerobic exercise alone . insulin and cortisol levels were comparable across conditions in these studies and were therefore unlikely to be responsible for the differential patterns of blood glucose response ( 1114 ) . growth hormone and catecholamines , meanwhile , were elevated after sprinting , potentially enhancing lipolysis and glycogenolysis , respectively , thereby potentially stabilizing blood glucose levels ( 1114 ) . it is undetermined whether these hormones are responsible for stabilizing blood glucose levels after resistance exercise in individuals with type 1 diabetes ; however , both growth hormone and catecholamines are known to increase significantly in individuals without diabetes during resistance exercise protocols similar to the one used in the current study ( 23,24 ) . attenuated declines in blood glucose concentration may also be related to increased lactate production during resistance exercise . in comparing the hormonal responses to various resistance exercise protocols , smilios et al . ( 23 ) found that two sets of 10 repetitions of chest press , lateral pull down , and squat ( a stimulus of smaller magnitude than the one used in the current study ) resulted in a fourfold increase in blood lactate levels , with elevated lactate persisting for at least 30 min postexercise in individuals without diabetes ( 23 ) . while we are unaware of published data on lactate production during resistance exercise in individuals with type 1 diabetes , there is no reason to believe that lactate production would be impaired in this population . indeed , other anaerobic activity ( high - intensity cycling ) produced elevated lactate levels persisting up to 30 min postexercise in individuals with type 1 diabetes ( 1114,25 ) . we did not measure lactate in the current study but can surmise that blood lactate levels would have increased more during resistance exercise where glycolysis predominates ( 22 ) than during aerobic exercise where lipolysis generates much of the energy required ( 26 ) , especially in physically fit individuals ( 21 ) . overall , there were no significant differences among the conditions with respect to any measures of hypoglycemia or mean nocturnal blood glucose levels ( table 2 ) , although resistance exercise was associated with a nonsignificant trend for more nocturnal hypoglycemia . while we are unaware of any study examining nocturnal blood glucose levels after resistance exercise in type 1 diabetic subjects , mcmahon et al . ( 16 ) found that adolescents with type 1 diabetes had a higher glucose infusion requirement to maintain euglycemia between midnight and 4:00 a.m. after performing evening aerobic exercise than if no exercise had been performed . this coincides with the time when the lowest nocturnal glucose levels were found after both exercise sessions in our study ( fig . 2 ) , although differences among conditions were not significant . as mcmahon et al . ( 16 ) surmised that delayed increases in postexercise glucose needs relate to replenishment of glycogen stores , a higher frequency of low blood glucose after resistance exercise ( which relies more on glycogen for fuel ) ( 22 ) might be expected . it is also possible that differences in food and insulin intake ( table 2 ) , while not statistically significant , could have had a minor effect on postexercise glucose profiles . in addition , while participants were asked to match their food and insulin intake both pre- and postexercise as closely as possible among the sessions , some differences may not have been reported . this does not , however , detract from the findings , as patient decisions regarding insulin dosage and carbohydrate intake play an essential role in diabetes management . as there is currently very little information available with respect to insulin adjustments for resistance exercise , participants in the current study were relying to a great extent on personal experience and judgment . higher physical activity levels in individuals with type 1 diabetes have been associated with lower frequency and severity of diabetes complications ( 1 ) ; however , fear of hypoglycemia is generally the strongest barrier to physical activity for this population ( 27 ) . resistance exercise is associated with improvements in muscular strength ( 4 ) , improved lipid profiles ( 4 ) , lower insulin needs ( 4,5 ) , and lower self - monitored blood glucose levels ( 4,5 ) in individuals with type 1 diabetes . it also carries many of the same benefits as aerobic exercise ( higher bone mineral density , increased insulin sensitivity , and improved cardiovascular function ) ( 28 ) and may therefore be a safe and effective option for this population . interestingly , we observed more exercise - associated glycemic fluctuation with aerobic exercise compared with resistance exercise . during the activity , aerobic exercise was associated with greater reductions in glycemia , while in early recovery there was more rebound hyperglycemia compared with resistance exercise . thus , one could conclude that resistance exercise may be more beneficial as far as glucose stability is concerned . moreover , as individuals with type 1 diabetes may also have an increased risk of myopathy ( 29 ) and complications associated with insulin resistance ( 29,30 ) , performing regular resistance exercise may help maintain or improve muscle mass and metabolism . meanwhile , it should also be noted that postexercise hypoglycemia might occur more frequently in individuals who have changed their exercise routine to incorporate resistance training or for patients unaccustomed to exercise ( 15 ) . in summary , our findings suggest that in trained individuals with type 1 diabetes who habitually practice both aerobic and resistance exercise , resistance exercise may result in more stable glucose levels both during and after exercise than aerobic exercise , which may explain the beneficial effects on hba1c found in previous intervention studies involving resistance exercise . the trend toward more frequent , albeit mild , nocturnal hypoglycemia after resistance exercise reported in our study , however , indicates the possible need to develop more effective clinical management protocols for different forms of exercise .

objectivein type 1 diabetes , small studies have found that resistance exercise ( weight lifting ) reduces hba1c . in the current study , we examined the acute impacts of resistance exercise on glycemia during exercise and in the subsequent 24 h compared with aerobic exercise and no exercise.research design and methodstwelve physically active individuals with type 1 diabetes ( hba1c 7.1 1.0% ) performed 45 min of resistance exercise ( three sets of seven exercises at eight repetitions maximum ) , 45 min of aerobic exercise ( running at 60% of vo2max ) , or no exercise on separate days . plasma glucose was measured during and for 60 min after exercise . interstitial glucose was measured by continuous glucose monitoring 24 h before , during , and 24 h after exercise.resultstreatment-by-time interactions ( p < 0.001 ) were found for changes in plasma glucose during and after exercise . plasma glucose decreased from 8.4 2.7 to 6.8 2.3 mmol / l ( p = 0.008 ) during resistance exercise and from 9.2 3.4 to 5.8 2.0 mmol / l ( p = 0.001 ) during aerobic exercise . no significant changes were seen during the no - exercise control session . during recovery , glucose levels did not change significantly after resistance exercise but increased by 2.2 0.6 mmol / l ( p = 0.023 ) after aerobic exercise . mean interstitial glucose from 4.5 to 6.0 h postexercise was significantly lower after resistance exercise versus aerobic exercise.conclusionsresistance exercise causes less initial decline in blood glucose during the activity but is associated with more prolonged reductions in postexercise glycemia than aerobic exercise . this might account for hba1c reductions found in studies of resistance exercise but not aerobic exercise in type 1 diabetes .

RESEARCH DESIGN AND METHODS Experimental design CGM Experimental sessions Insulin adjustments and glucose supplementation Blood sampling and analyses Statistical analyses RESULTS Plasma glucose Exercise. Recovery. Carbohydrate intake and insulin dosage CGM data CONCLUSIONS Supplementary Material

PMC3570907

flavonoids comprise a large group of plant metabolites , 6,000 of which have been identified to date . quercetin is a major natural flavonoid existing in the skin of many fruits and vegetables , as well as in leafy vegetables , berries , black tea , and various fruit juices . since it can be found in many plant - derived foods , it is present in most people 's diet . having many antioxidant , anticarcinogenic , anti - inflammatory , and heart - protecting effects , quercetin decreases the risk of cancers and various chronic diseases . thus , it is produced as a dietary supplement and is even added to some food and beverages . despite the large number of studies investigating the in vitro effects of quercetin , few have demonstrated its in vivo effects . there might be differences between the in vivo and in vitro effects of quercetin owing to its digestion , absorption , and metabolism effects . some animal studies have described the observed increased endurance performance and maximal oxygen consumption ( vo2max ) and therefore fitness following quercetin consumption as a result of elevated number of intracellular mitochondria caused by the flavonoid.[68 ] however , this association has not yet been proved in human studies . the improved physical performance caused by quercetin reported by some studies might be attributable to the decreased membranes in muscles , which in turn reduces the negative and exhaustive effects of excessive oxygen radicals during physical activity . proving this hypothesis to be right would mean quercetin to be able to reduce muscular damage and soreness , as well as neuromuscular dysfunction following exercise . however , quercetin has been reported to have contrasting antioxidant effects . although some studies found improved neuromuscular function and decreased soreness , others only mentioned improved muscular strength as a result of long - term quercetin consumption . however , they did not find quercetin to have significant effects on these indices . as mentioned previously , although in vitro and animal studies have suggested quercetin to have positive effects on athletic performance , inflammatory indices , and muscular damage , a definite judgment can not be made about its effects on athletes because of the fewer number of human studies and their contrasting findings . on the other hand , there is a growing interest in supplement use among athletes . therefore , this study evaluated the effects of supplementary quercetin on athletic performance , muscular damage , and body composition in male athlete students . this double - blind clinical trial involved 60 male students at isfahan university of medical sciences having an athletic history of at least 3 years . the subjects were excluded if they followed less than 70% of the study procedure or were unwilling to continue . the trial was approved by the research and ethics committee , faculty of nutrition , isfahan university of medical sciences , isfahan , iran , and registered in irct . the participants were first explained about the objectives and methods of the study . after obtaining written informed consents , height was measured to the nearest 0.5 cm by a tape meter in standing position without shoes . weight was measured in light clothing without shoes by a scale with an accuracy of 100 g , following which body mass index ( bmi ) was calculated as weight divided by squared height ( kg / m ) . a bioimpedence device was used to measure body water percentage and fat - free mass percentage . to evaluate body performance indices , exercise test was performed for all participants using the bruce protocol and hp cosmos treadmill ( mercury , germany ) . at the end of the test , vo2max and the individuals were then assigned into four groups of 15 using permuted block randomization . the first to fourth groups received a 500 mg supplemental quercetin capsule plus a 250 mg vitamin c pill , a 500 mg supplemental quercetin capsule plus a 250 mg placebo vitamin c pill , a 500 mg placebo quercetin capsule plus a 250 mg vitamin c pill , and a 500 mg placebo quercetin capsule plus a 250 mg placebo vitamin c pill , respectively , daily for 8 weeks . the participants were asked to continue their routine diet and physical activity during the study and they were monitored through phone calls or text messages . at the end of the intervention period , the remainder of the pills was evaluated to assess supplement intake . due to the double - blind nature of the study , neither the researchers nor the participants were aware of the content of the capsules . data were analyzed by paired t - test , analysis of covariance ( ancova ) , and repeated measure analysis of variance ( anova ) in spss15 . data were analyzed by paired t - test , analysis of covariance ( ancova ) , and repeated measure analysis of variance ( anova ) in spss15 . since four individuals were excluded due to unwillingness or other reasons , a total number of 56 participants were studied . mean ages of subjects in groups 1 to 4 were 20.93 1.53 , 21.50 2.17 , 21.21 1.52 , and 20.46 1.18 years , respectively ( p > 0.05 ) . table 1 shows the body composition indices among the four groups before and after the study . as seen , lean body mass ( lbm ) , total body water ( tbw ) , basal metabolic rate ( bmr ) , and total energy expenditure ( tee ) increased significantly in the first group . the comparison of body composition indices between four groups as presented in table 2 , body performance indices shows vo2max in group 1 significantly increased after the intervention . in addition , as the results of ancova after excluding the initial effects of vo2max suggested , vo2max increased in the first and third groups following the intervention . however , repeated measure anova did not reveal the differences to be significant . although the distance covered significantly increased in group 4 , ancova and repeated measure anova did not show significant differences . this randomized clinical trial comprised four groups who were evaluated to determine the effects of quercetin intake on physical and body performance and muscle injury . the results revealed significant differences in lactate dehydrogenase ( ldh ) , vo2max , tee , tbw , and lbm among the quercetin and vitamin c groups . however , after eliminating confounding effects of initial variables , only vo2max changes remained significant . our study is in line with the study of cureton et al . , who assessed the ergogenic effects of quercetin on 30 non - athletic men in a double - blind clinical trial . during 7 to 16 days , they administered 1 g of daily quercetin to the intervention group and the same amount of placebo to the control group . finally , they did not find significant changes either in ergogenic indices , such as phosphocreatine recovery time constant , vo2max , and perception of effort , during submaximal exercise test , or in the total work during a 10-min cycling with maximum power . similarly , ganio et al . performed a double - blind clinical trial on 11 non - athletic inactive participants ( five males and six females ) . although their intervention and control groups received , respectively , 1,000 mg of daily quercetin and placebo for 22 weeks , no significant differences were observed in terms of vo2max between the two groups . utter et al . also compared the effects of 250 mg of daily quercetin for 3 weeks with placebo among marathon runners and cyclists . they did not report any significant difference in the ratings of perceived exertion between the two groups . a crossover clinical trial by macrae et al . compared the effects of quercetin and a combination of quercetin and vitamins on 11 male cyclists during a 6 week period . although their results did not reveal significant differences in the total time of a 30 km ride and vo2max after the intervention , a significant increase was observed in peak power among the second group of cyclists . in a clinical trial , davis et al . evaluated the effects of quercetin on exercise performance among 12 volunteers . they divided the participants into two groups of intervention ( 500 mg daily quercetin ) and control ( 500 mg daily placebo ) . unlike in other studies , they found significant improvements in time to fatigue , vo2max , and endurance among non - athletic individuals during a 30 km bicycle ride . they performed a 12 week treatment with two doses of quercetin along with vitamin c and niacin on 941 male and female subjects aged 18 - 85 years . the participants were randomly divided into three groups of 500 mg daily quercetin , 1,000 mg daily quercetin , and placebo . their results did not show any significant differences between the intervention and placebo groups in terms of bmi or any other body composition indices . egert et al . investigated the effects of quercetin consumption on 93 obese subjects aged 25 - 65 in a crossover study . the participants received 6 weeks of 150 mg daily quercetin followed by a 5 week washout and a course of placebo . however , crp and body composition indices , including weight , waist circumference , body fat mass , and fat - free mass , did not significantly change after the intervention period . another study by egert et al . evaluated 35 healthy subjects in three groups of 50 , 100 , and 150 mg of daily quercetin . the study did not indicate any significant difference in resting energy expenditure or weight after a 2 week quercetin supplementation . similar to previous studies , the present study did not show any significant differences between the quercetin and placebo groups . therefore , it might be concluded that quercetin alone does not affect body composition and body performance indices . although different studies have used various doses of quercetin during various periods of time , we selected a dose within their range . however , higher doses might be able to make significant differences in the above - mentioned indices . since the findings of the present and previous studies are in contrast with in vitro and animal studies , a longitudinal research with long follow - up is suggested to evaluate the effects of quercetin . moreover , studies assessing the effects of quercetin on cardiovascular disease risk factors , endothelial dysfunction , and atherosclerosis incidence might reveal beneficial effects of this flavonoid . clinical trials with larger sample sizes of athletes and non - athletes are also recommended .

background : flavonoids comprise a large group of plant metabolites , 6,000 of which have been identified to date . some studies have shown the increased aerobic performance and maximal oxygen consumption ( vo2max ) and therefore fitness following quercetin intake as a result of elevated number of intracellular mitochondria caused by the flavonoid.methods:this double - blind clinical trial comprised 60 male students having an athletic history of at least 3 years . body composition , exercise performance , and some blood biomarkers were analyzed . the individuals were selected by convenient sampling , and then were assigned into four groups of equal number by using permuted block randomization . the first to fourth groups received a 500 mg supplemental quercetin capsule plus a 250 mg vitamin c pill , a 500 mg supplemental quercetin capsule plus a 250 mg placebo vitamin c pill , a 500 mg placebo quercetin capsule plus a 250 mg vitamin c pill , and a 500 mg placebo quercetin capsule plus a 250 mg placebo vitamin c pill , respectively , daily for 8 weeks . the participants were asked to continue their routine diet and physical activity during the study and they were monitored through phone calls or text messages.results:lean body mass , total body water , basal metabolic rate , and total energy expenditure increased significantly in the quercetin group after intervention . on the other hand , vo2max increased in the quercetin and quercetin + vitamin c groups following the intervention , non-significantly.conclusion:our findings suggest that supplementation with quercetin in athletes may improve some indices of performance .

INTRODUCTION METHODS Statistical analysis RESULTS DISCUSSION CONCLUSION

PMC3466023

the clinical , radiographic , and histological diagnosis of periapical lesions has been a challenge [ 1 , 2 ] . current diagnostic methods help in fair assessment of accurate size and nature of a periapical lesion which determine the treatment and prognosis of the tooth in question [ 35 ] . making the correct pulpal and periapical diagnosis is helpful for treatment and prognosis of the tooth . even if biopsy is the gold standard in differentiating granulomas from cysts , clinicians are aware of the difficulty in obtaining biopsies in routine clinical practice [ 6 , 7 ] . therefore , there is an immediate need for a noninvasive method to diagnose lesions involving the periapical area . this could be due to fact that interpretation of images which influences success or failure also depends on several factors , including the clinician 's experience in interpreting images . however , due to inherent drawbacks such as superimposition and distortion , it is sometimes difficult to detect periapical ( pa ) lesions on two - dimensional images . two - dimensional radiographs can image pa lesions to be detected only when bone mineral loss reaches 30%50% due to structured noise of superimposed cortices . therefore , only 5055% of small and medium sized lesions can be diagnosed as periapical disease . reports indicate that cbct images provide clinically relevant information not found in periapical images [ 1013 ] . a recent study used cbct as the reference imaging modality ( gold standard ) to compare the accuracy of periapical and panoramic radiography in detecting periapical lesions . the question that is valid to ask now is , does evaluation of a periapical lesion with cbct change the estimation of size and choice of treatment among endodontists compared to periapical radiography ? selecting the most appropriate choice of treatment using the most accurate imaging modality would ultimately reduce cost and morbidity significantly in patients undergoing endodontic therapy . the purpose of this study was to compare lesion size and choice of treatment relative to the available radiographic information from periapical radiography and cbct . the null hypothesis is that there is no difference in the lesion size and choice of treatment of periapical lesions between conventional periapical radiographs and cbct images . the study group comprised twenty - four subjects , 11 women , and 13 men , with an average age of 53 years ( range 1888 years ) table 1 . approximately one hundred subjects were examined to achieve a study sample of twenty - four . all subjects reported to the endodontic division of the university of detroit mercy school of dentistry with symptoms suggestive of a periapical lesion . history of present illness and clinical examination ( including palpation , percussion , and cold test ) of the tooth involved was performed before any radiographic procedure was undertaken . subjects were recruited to the study only after the initial intraoral periapical radiograph showed a periapical lesion of size greater than 3 mm . both single rooted and multirooted teeth with periapical lesion size equal to or greater than 3 mm on intraoral periapical radiography if a patient had more than one tooth that qualified for the study , the tooth with the most severe symptoms and maximum size of the periapical lesion as determined by conventional radiography was selected . previously root - treated teeth and teeth with restorations were also included in the study . endodontically involved teeth that had history of trauma or radiographic evidence of fracture were excluded from the study . no specific control group was used for either of the radiographic modalities tested since teeth other than the study tooth in the same jaw were also imaged and served as internal controls . the study was reviewed and approved by the university of detroit mercy institutional review board ( udm irb protocol no . two - dimensional radiographs ( intraoral periapical ) were obtained with an intraoral dental x - ray machine ( planmeca intra , planmeca usa inc , il , usa ) using the paralleling axis technique and round collimator ( 2.86 diameter ) with variable kvp and mas and focal spot size 0.7 mm 0.7 mm . , long island city , ny , usa ) were used to record the images . schick cdr software was used to display images in real - time on a monitor . the images were stored as 8-bit tiff ( tagged image file format ) files at maximum quality ( 100% ) ( see figure 1 ) . adequate image quality essential for diagnosis was established in a subjective manner after comparing previous images obtained from this radiographic modality and standardizedwith the ones that would be used for this study . the size of the periapical lesions was measured with a measurement tool available in the schick software . teeth with periapical lesions equal to or greater than 3 mm as seen on the two - dimensional radiographs were further recommended for a cbct scan . dimensional calibration for size was applied to the two - dimensional images upon export to the study software . calibration was applied using the calibration tool in the software in which all the images were observed . a particular distance was measured on the periapical image obtained upon exposure , and the same distance was measured when this image was exported to the software through which the images were available for the observers to view . after explaining the cbct scan procedure and obtaining approval from the patient for the imaging procedure , a cbct scan of the study patient was acquired using the 1719 platinum next generation i - cat cbct scanner ( imaging sciences international , hatfield , pa , usa ) and standard scanning protocols ( pulsed exposure , 120 kvp , 3 to 7 ma , 14.7 second exposure time , 0.25 0.25 0.25 mm isotropic voxel size , 14 bit , maxilla or mandible ) ( see figure 2 ) . collimation was fully adjusted to include the maxilla or mandible only . a limited ( maxilla or mandible ) fov ( field of view ) the fov for the maxilla and mandible was 16 cm ( d ) 6 cm ( h ) . a cesium iodide flat panel detector was used to acquire images . only the arch ( maxillary / mandibular ) with the tooth and associated periapical lesion was scanned . all pertinent patient information on the scanned images was anonymized prior to being viewed by observers . scan data of subjects was exported from proprietary i - cat vision software ( i - cat vision q , imaging sciences international , hatfield , pa , usa ) to a previous version of i - cat software in.xstd format . images from both modalities were then imported into an interface viewing software , xv lite software ( apertyx inc . ( figure 1 : intraoral periapical radiograph , figure 2 : cbct image as viewed by observers ) the two - dimensional images were spatially calibrated according to known dimensions of the native images . periapical images were viewed in an office on a dell ultrasharp 2407wfp 24-inch widescreen flat panel lcd monitor ( dell inc . , round rock , texas , usa ) , running under microsoft windows xp professional sp-1 ( microsoft corp , redmond , wa , usa ) . the monitor specifications include a native resolution of 1920 1200 at 60 hz , pixel pitch of 0.27 mm , brightness of 450 cd / m , and contrast ratio of 1000 : 1 . the same monitor was not used for viewing both pa and cbct images for accession purposes . it was easier for observers to view cbct images at a monitor attached to the cbct scan acquisition hardware . the pa images were viewed by the observers at the principal investigator 's office as these images could be easily exported from the endodontic department upon capture to that office . three endodontists were senior faculty in the department of endodontics and three of them were junior part - time faculty . the observers were asked to perform the following with the two imaging modalities separately : ( a ) measure the extent of the periapical lesion ( greatest distance ( diameter ) in millimeters and ( b ) choose treatment for particular tooth ( root canal treatment , periapical surgery , root canal treatment and periapical surgery and no endodontic treatment ) . the observations were performed in two separate sessions : one for pa images and another for cbct images . this was done to enable observers could score all images between the two modalities in a timely fashion . all observers examined 24 images acquired from 24 different teeth ( 24 subjects ) from the two imaging modalities . overall , a total of 288 scores were that is , 6 observers x obtained ( 24 images for pa + 24 images for cbct ) each for lesion measurement and treatment choice . mann - whitney u test was used to assess for differences in the measurement of lesion sizes by all observers among the two modalities ( p > 0.05 ) . wilcoxon signed ranks test was used to look for differences in the measurement of lesion sizes among the two modalities by each observer . intraclass correlation coefficient was calculated among observers for each modality with respect to lesion size and choice of treatment . chi - square test was done to look for differences in the choice of treatment selected by all observers for the two modalities . the method of bland and altman was used to assess observer agreement of selected treatment between the two imaging modalities . the mean for lesion sizes among the two modalities for the study sample is shown in figure 3 . the 95% confidence interval for either the lower or upper limit of agreement was less than two standard deviations ( 2sd = 22.86 = 5.72 ) . table 2 shows no statistically significant difference between the two modalities in terms of the lesion size measured by individual observers ( mann - whitney u = 9720.500 , z = .916 , p > 0.05 ) . the intraclass correlation coefficient for the observers was 0.465 for treatment decision , and the high agreement ( 0.947 ) for lesion size . chi - square test revealed no significant difference in the treatment plan selected by observers between the two modalities ( (3 ) = .036 , p > 0.05 ) . for some treatment decisions , there was equal or almost equal selection between the two modalities . figure 5 shows trend among observers in selecting treatments between the two modalities . the 95% confidence interval for either the lower or upper limit of agreement was less than two standard deviations ( 2sd = 22.86 = 5.72 ) . this implies that the chance that observers chose different treatments from the two imaging modalities is minimal . the intraclass correlation among observers for each modality and both the imaging modalities together with reference to treatment selection and lesion size was calculated . ( tables 4 and 5 ) . though there was no statistical significance between the two modalities in terms of lesion size measured by individual observers , there was appreciable variability when the lesion size measurements of all the six observers were averaged ( figure 6 ) . with the introduction of cone beam ct in dentistry , several applications of this advanced imaging modality , including endodontics , are being investigated . in endodontics , the use of cbct involves diagnosis of pathosis , treatment planning , and diagnosis of trauma to dentoalveolar structures and evaluation of previously root - treated teeth , especially for missed canals [ 1619 ] . even though the benefits of cbct in endodontics are well understood , this particular study was undertaken to assess if the visualization of the third dimension as seen in cbct images would alter the choice of treatment made by endodontists . it is also interesting that the number of various treatment decisions ( root canal treatment , periapical surgery , root canal treatment plus periapical surgery , and no endodontic treatment ) was equal between the two imaging modalities . this led investigators of this study to believe that although cbct images show more information , this additional information would not necessarily translate into selection of a treatment different from the decisions made with the periapical images . in our study , six endodontists viewed images from both modalities ( pa and cbct ) and made their treatment decisions . the intraclass correlation with regards to the treatment decision was only moderate ( 0.465 ) . this could be attributed to the varying clinical experience levels ( novice to highly skilled ) . previous studies indicate that the long - term stability of observers in detecting periapical radiolucencies on conventional radiographs was satisfactory . two observers were well versed in interpreting cbct images and were using this technology on a regular basis while others had only knowledge of the cbct technology but were not well experienced in interpreting images . with reference to lesion size , there was , however , a high level of agreement ( 0.947 ) among observers between the two imaging techniques . this finding is in accordance with similar studies which confirm that periapical lesion measurements ( when adequately calibrated ) are the same between cbct images and traditional two - dimensional radiographic images . it is important to analyze the difference in radiation doses from the two imaging modalities under investigation in this study . several studies have assessed the effective radiation dose from different cbct scanners available in the market . comparisons in radiation dose between medical ct and cbct have also been made through scientific studies [ 23 , 24 ] . the mean organ dose to organs such as the brain , thyroid , and parotid gland becomes extremely important while performing a cbct scan . cbct doses also differ with reference to the particular scanning protocol that is being selected for a specific study . short scan times and standard resolution ( not high resolution ) scan protocols would reduce the radiation doses from these procedures . the potential risk to the patient due to this increase in radiation dose can be minimized by using a limited field of view ( fov ) . newer cbct scanners customized specially for endodontic purposes have the ability to scan only the particular tooth in question . however , in our study , the cbct scanner utilized did not have the ability to scan only the tooth and the entire jaw ( maxilla / mandible ) had to be imaged . the effective dose using the 2007 icrp ( international council on radiation protection ) calculation for the scanner and the protocols used in this study varies from 40 to 69 sv . the effective dose from the next generation cbct scanner used in this study is comparable to the dose from newer cbct machines currently being marketed only for endodontic purposes , for example kodak 9000 , with an effective dose of 21 sv for a 4 5 cm jaw sextant . also , we used a scan protocol with an option to obtain higher resolution images since there was a need to display the best quality images for the observers to view . the scan resolution used in this study is similar to other studies of this nature . also lesion size differences between the two imaging modalities can be compared only when highly resolvable images are available . this study is not without its limitations : ( i ) the study sample ( n = 24 ) is relatively small and it is not known if a larger sample would have produced a different outcome , ( ii ) history and clinical information ( signs and symptoms ) of study subjects were not provided to the observers at the time of the viewing sessions , so it is not certain if this information would have produced a significant difference in treatment selection between the two imaging modalities , ( iii ) the clinical experience of observers varied from novice to most skilled , ( iv ) the radiation dose from the cbct imaging procedure in the presence of an already existing radiographic procedure ( periapical radiographs ) should be validated , and a separate study comparing the effective dose of radiation used in cbct imaging and conventional radiography for endodontic purposes is required , and ( v ) it is not known if a different resolution of cbct images would have affected the results since native resolution of cbct images was used by observers with no image enhancements ( other than brightness and contrast ) being performed for either modalities . it is now well recognized that prospects for the use of cbct in endodontics in the future appear promising . however , there are several factors such as diagnostic yield , radiation dose and selection criteria to be considered before this technology becomes incorporated into the diagnostic armamentarium in endodontics . since interpretation of cbct images requires additional training , care must be taken to avoid misinterpretation by clinicians who have not had the required training . for example , with an untrained eye , artifacts such as beam hardening due to metallic restorations on cbct images could be misdiagnosed as a carious lesion . endodontists aspiring to use this technology should either train themselves or seek the help of a maxillofacial radiologist who can interpret the images for them . also , when cbct images do not offer additional clues to diagnosis , periapical radiographs should be referred for more information . therefore , the notion that cbct would replace conventional periapical radiographs is far - fetched . another factor to be considered is the viability and cost - effectiveness of using cbct in a clinical setting . not all endodontic offices currently include cbct in their diagnostic work up . at the present time , the request for cbct scans for endodontic purposes is not uniform between specialists for the same reason . the cost of a cbct scan is several fold compared to a conventional periapical radiograph and the increase in cost needs to be justified . in conclusion , it was determined from our study that the choice of treatment in endodontics does not change significantly even with the inclusion of an advanced imaging modality such as cone beam ct . the results of this study , however , should be interpreted with caution . although cbct performed almost the same as periapical radiography , the potential advantages of cbct in other areas of endodontics including assessing proximity of teeth to anatomic structures , such as mandibular canal and maxillary sinus , can not be underestimated . this study also proves the robust diagnostic potentials of traditional two - dimensional imaging modalities . further studies with a larger sample size are underway to further confirm the results obtained from this study and identify appropriate areas in endodontics where cbct imaging would play a vital role .

objectives . to compare the ability of endodontists to determine the size of apical pathological lesions and select the most appropriate choice of treatment based on lesions ' projected image characteristics using 2 d and 3 d images . study design . twenty - four subjects were selected . radiographic examination of symptomatic study teeth with an intraoral periapical radiograph revealed periapical lesions equal to or greater than 3 mm in the greatest diameter . cone - beam computed tomography ( cbct ) images were made of the involved teeth after the intraoral periapical radiograph confirmed the size of lesion to be equal to greater than 3 mm . six observers ( endodontists ) viewed both the periapical and cbct images . upon viewing each of the images from the two imaging modalities , observers ( 1 ) measured lesion size and ( 2 ) made decisions on treatment based on each radiograph . chi - square test was used to look for differences in the choice of treatment among observers . results . no significant difference was noted in the treatment plan selected by observers using the two modalities ( 2(3 ) = .036 , p > 0.05 ) . conclusion . lesion size and choice of treatment of periapical lesions based on cbct radiographs do not change significantly from those made on the basis of 2 d radiographs .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion

PMC4635830

world health organization ( who ) estimated that over 237 million people required treatment for schistosomiasis in 2010 with estimates of up to an additional 779 million at risk globally . schistosomiasis is endemic in 76 countries worldwide and besides malaria is the second important parasitic disease for public health . of the 662 million people infected worldwide , 85% are from africa . in tanzania , schistosomiasis is highly endemic , and its prevalence varies from one region to another , with a prevalence of up to 80% in highly endemic areas . intestinal schistosomiasis is caused by schistosoma mansoni , and infections are acquired by contact with freshwater containing parasite larvae . the disease is hyper - endemic in the great lake regions of east africa , owing to the favorable habitat for snails of the biomphalaria genus , which are the intermediate host . recent studies around lake victoria indicated that the prevalence in schoolchildren vary widely [ 8 - 12 ] . found that 14% of 1-year - old children along the kenyan shores of lake victoria were s. mansoni positive , whereas odogwu et al . found a prevalence of 47.4% in children <3 years of age around lake victoria in uganda the prevalence in school - aged children in these areas could be as high as 86 - 90% . in children , schistosomiasis normally presents with generalized , non - specific signs and symptoms , making it difficult to identify disease - specific morbidity indicators and challenging to develop tools for assessing those indicators . over time , morbidity may progress from subtle manifestations such as anemia , to severe , debilitating , and irreversible conditions such as growth stunting , impaired cognitive development , increased susceptibility to co - infection , decreased quality of life , exercise intolerance , infertility , portal hypertension , and liver failure [ 16 - 22 ] . who estimated that more than a billion people are chronically infected with soil - transmitted helminths ( sths ) . ascaris lumbricoides , hookworms ( ancylostoma duodenale and necator americanus ) , and trichuris trichiura are the most common sth species with global prevalence of about 1,000 , 900 - 1,300 , and 500 million people , respectively [ 24 - 26 ] . as such , sth infections are still considered to be the most prevalent infections of mankind . nowadays , sth has been classified among the most prevalent neglected tropical diseases ( ntds ) as they persist exclusively in the poorest populations . findings from a study done among schoolchildren in a lake victoria shore line ward in tanzania showed that the prevalence of hookworms was the second to intestinal schistosomiasis . in kenya , the prevalence of sths is prominently attributed to a. lumbricoides , hookworms , and t. trichiura . hookworm infections observed in the lake basin in both tanzania and kenya were similarly high , ranging from 37.0 - 42.5% . other studies in magu district , tanzania , reported a prevalence of ascariasis of < 1% , and handzel et al . reported in kenya 's nyanza province the prevalence of 22.9% and 17.9% for a. lumbricoides and possible factors associated with sth infections among the studied children included age ( school - age ) , absence of toilet and piped water supply in the household , large family size ( 7 members ) , and not washing hands before eating and after defecation . although helminths can infect all members of a population , there are specific groups who are more vulnerable and at a greater risk of infection . for schistosomes and sths , the most vulnerable groups are preschool children , school - aged children , and women of child - bearing age , including adolescent girls although much of the morbidity associated with infection can be reversed with the use of effective anthelmintic drug treatments . preschool children and school - aged children including adolescents tend to harbor the greatest numbers of intestinal worms and schistosomes and as a result experience growth stunting and diminished physical fitness as well as impaired memory and cognition . these adverse health consequences combine to impair childhood educational performance , reduce school attendance , with hookworms being well - known causes of anemia because of intestinal blood loss . chemotherapy with praziquantel ( pzq ) is currently the mainstay of control , which is available at a low cost . moreover , due to their geographical overlap between schistosomes and sth infections , they could be simultaneously treated with 2 drugs , albendazole and praziquantel . as such , the successful sth control programmes have enormous benefits of improved nutritional and health status of the children , higher educational attainment , labor force participation , productivity , and income among the most vulnerable populations [ 42 - 44 ] . an added externality is the impact that ntds have on hiv / aids , tuberculosis , and malaria . several recent papers highlight the immunosuppressive features of helminths ( especially the sths , schistosomes , and filariae ) and their possible impact on promoting susceptibility to the big 3 diseases . new data suggest that control of ntds could become a powerful tool for combating hiv / aids , tuberculosis , and malaria . this paper presents data using a rapid assessment methodology to examine the prevalence of schistosomiasis and sth infections in schools around the tanzania perimeter of lake victoria . the study area is located on the northwest of tanzania around lake victoria ( fig . 1 ) . it stretches from the southwest of the lake through south to the eastern side . the area is comprised of kagera , mwanza , mara on the lake shore , and shinyanga about 60 km away from the lake . the study area is bordered by uganda and rwanda in the north and west , respectively . it is also bordered by tabora and manyara regions in the south and east , respectively . the main ethinic groups are ; wahaya and wasubi in kagera region , wasukuma , wazinza , and wasumbwa in mwanza region , wajita , wakurya , and waluo in mara region , and again wasukuma and wasumbwa in shinyanga region . much of the activities have a bearing to schistosomiasis and sth infections as they performed without protective gear in the area where the level of sanitation and hygiene is as low as in any poor resource settings . collection of stool and urine specimens was done at the selected schools . each child was given 1 stool container and 1 urine container on the first day and asked to bring the urine and stool specimens . the smears were examined for hookworms and other helminth eggs or larvae within 1 hr after preparation in order to capture hookworm eggs before they hatch . the egg counts on each of the 2 slides were added together and divided by 2 to get the mean number of egg counts for the 2 slides . urine samples were collected after 10.00 a.m. to diagnose s. haematobium based on detection of eggs using the filtration technique . urine samples were mixed thoroughly and 10 ml were drawn using a syringe and passed through the membrane where eggs were logged . examination was done on site where detected eggs were counted and expressed as the number of eggs per 10 ml of urine . data entry was done using dbase iv ( borland international , scotts valley , california , usa ) , and a double entry system was used for quality control . data were transferred to stata version 8 software ( statacorp 2000 , college station , texas , usa ) for analysis . analysis was done by generation of some frequency tables , cross tabulations , and calculation of the prevalence . the ethical and scientific clearance was obtained from the medical research coordinating committee of the national institute for medical research before the implementation of the study . the study team visited villages and schools where community leaders and teachers were respectively met and the objectives , procedure , and potential harm and benefits of the study were explained to them . the leaders in turn convened meetings of the community members , and the same was explained to them before the consent to participate in the study was sought . any participant would be free to withdraw from the study at any time of the study period when he or she felt to do so . the decision to refuse or withdraw from the study would have no negative effect on the benefits provided during and after the study . all subjects who would be found infected with schistosomes and intestinal helminths were treated following standard treatment guidelines using praziquantel and albendazole tablets . participants were informed that information will be confidentially kept using code numbers instead of names of participants . the study area is located on the northwest of tanzania around lake victoria ( fig . 1 ) . it stretches from the southwest of the lake through south to the eastern side . the area is comprised of kagera , mwanza , mara on the lake shore , and shinyanga about 60 km away from the lake . the study area is bordered by uganda and rwanda in the north and west , respectively . it is also bordered by tabora and manyara regions in the south and east , respectively . the main ethinic groups are ; wahaya and wasubi in kagera region , wasukuma , wazinza , and wasumbwa in mwanza region , wajita , wakurya , and waluo in mara region , and again wasukuma and wasumbwa in shinyanga region . much of the activities have a bearing to schistosomiasis and sth infections as they performed without protective gear in the area where the level of sanitation and hygiene is as low as in any poor resource settings . was given 1 stool container and 1 urine container on the first day and asked to bring the urine and stool specimens . the smears were examined for hookworms and other helminth eggs or larvae within 1 hr after preparation in order to capture hookworm eggs before they hatch . the egg counts on each of the 2 slides were added together and divided by 2 to get the mean number of egg counts for the 2 slides . urine samples were collected after 10.00 a.m. to diagnose s. haematobium based on detection of eggs using the filtration technique . urine samples were mixed thoroughly and 10 ml were drawn using a syringe and passed through the membrane where eggs were logged . examination was done on site where detected eggs were counted and expressed as the number of eggs per 10 ml of urine . data entry was done using dbase iv ( borland international , scotts valley , california , usa ) , and a double entry system was used for quality control . data were transferred to stata version 8 software ( statacorp 2000 , college station , texas , usa ) for analysis . analysis was done by generation of some frequency tables , cross tabulations , and calculation of the prevalence . the ethical and scientific clearance was obtained from the medical research coordinating committee of the national institute for medical research before the implementation of the study . the study team visited villages and schools where community leaders and teachers were respectively met and the objectives , procedure , and potential harm and benefits of the study were explained to them . the leaders in turn convened meetings of the community members , and the same was explained to them before the consent to participate in the study was sought . any participant would be free to withdraw from the study at any time of the study period when he or she felt to do so . the decision to refuse or withdraw from the study would have no negative effect on the benefits provided during and after the study . all subjects who would be found infected with schistosomes and intestinal helminths were treated following standard treatment guidelines using praziquantel and albendazole tablets . participants were informed that information will be confidentially kept using code numbers instead of names of participants . a total of 5,848 schoolchildren from 36 selected schools in the 4 regions of the lake victoria basin in tanzania were recruited for the study ( table 1 ) . the same numbers of girls and boys aged between 7 and 16 years from class 1 to 7 were selected for the study . intestinal schistosomiasis caused by s. mansoni was prevalent in 3 regions of kagera , mwanza , and mara . urogenital schistosomiasis caused by s. haematobium was found in children from 3 regions of mwanza , mara , and shinyanga but not in kagera . among the 3 regions , the highest prevalence ( 16.7% ) the mean prevalence of both schistosomiasis and sths in all regions ranged from low to moderate ones ( table 1 ) . in kagera region , all the common intestinal helminths , namely s. mansoni , a. lumbricoides , t. trichiura , and hookworm infections were prevalent ( table 2 ) . bwina primary school in chato district recorded an extremely high prevalence of intestinal schistosomiasis of 86.5% followed by bunena in bukoba urban district with a prevalence of 16.8% , and other schools had a prevalence of less than 10% . the highest prevalence was 71.4% at runazi school followed by kiziramuyaga 59.5% and bwanga 37.9% ( table 2 ) . the prevalence of ascariasis was the highest at buzirayombo 33.3% , followed by bwanga 28.4% , bunena 25.6% , and kyenshama 25.6% ( table 2 ) . the prevalence of trichuriasis in the region was relatively low with a mean of 1.5% where kiziramuyaga had the highest prevalence of 7.1% . in mwanza region , 3 helminth species detected included s. mansoni , s. haematobium , and hookworms ( table 3 ) . the highest prevalence of s. mansoni infection was recorded at nyamikoma primary school that registered 79.2% , followed by bungonya 63.1% and nyakaliro 63.0% ( table 3 ) . bungonya primary school had the highest prevalence of hookworms of 36.9% followed by mwaginghi 34.0% and nyamikoma 21.3% . the highest prevalence ( 32.2% ) of urogenital schistosomiasis was at bugogo primary school ( 32.3% ) , and mwaginghi and kigongo were the second with a prevalence of both 28.0% . lumeji was the fourth with 21.3% prevalence while the rest of schools had prevalence less than 10% ( table 3 ) . the distribution of schistosomiasis and sths in mara region was low relative to other regions ( table 4 ) . s. mansoni was highly prevalent at mwisenge 36.1% , nyamitwebili 30.2% , gamasara 15.9% , and minigo 11.7% . the prevalence was the highest ( 27.2% ) at guta a school followed by minigo 11.7% and bulamba 2.7% . the prevalence of hookworms in mara region ranged from 2.4% at mwisenge to 19.3% at minigo primary school . the prevalence of trichuriasis was the lowest of all the helminths in region . in shinyanga region , the highest prevalence ( 30.3% ) was noted at luhumbo school in shinyanga rural district seconded by 24.8% at songwa primary school in kishapu district . intestinal schistosomiasis was not noted in the whole study areas , whereas the hookworm prevalence was low ; ranging from 0% at songwa school to 17.1% at bukomela school . no ascariasis nor trichuriasis cases were noted at any of the schools in shinyanga region . the results showed that generally the prevalence of s. mansoni , s. haematobium , and sths are considerably high in the study areas . . however , the prevalence of s. mansoni in kagera region is very low with the exception of a few pockets in chato district which is currently in geita region . this could be attributed to the fact that lake shores in kagera region are open instead of bays when wind blows make the waves splash the shores making the place an unconduncive habitat for snail intermediate hosts . moreover , some of the shores in kagera region are formed by escarpments thus deep and less habitable by the snails . the situation is quite different from shores in chato district which is a bay thus most of its shores are not susceptible to strong winds . the distribution of s. haematobium and s. mansoni along lake victoria is largely related to the distribution of the intermediate hosts . along the shore of the lake , members of the genus biomphalaria , the intermediate host for s. mansoni , are common with populations living along the lake shores and islands being highly affected by s. mansoni as the risk of infection increases . apart from the fact that schistosomiasis is focal , the noted high prevalence of the disease in this district could be attributed to the presence of bays that experience less speedy winds and strong waves to the shores making the place unconduncive habitat for snails . the highest prevalence of s. mansoni at bwina primary school in kagera region could be attributed to the location of the study site . bwina ward is a thin peninsular with an average width of less than 2 km . as such , most of the area is surrounded by lake victoria water that is inhabited by biomphararia species . bwanga and kiziramuyaga localities are close to the lake area that has small bays that are conduncive areas for the snail hosts . the absence of urogenital schistosomiasis in kagera region could be due to the absence of ponds and streams , and the fact that no paddy cultivation is practiced in this area . the prevalence of sth infections in kagera region was relatively higher than that in other regions . this could be due to the difference in natural vegetations and gardens as a result of rain variations . kagera is sunny and warm most of the year with cool evenings and rains occuring almost every morning from march through may . sths are highly affected by surface temperature , altitude , soil type , and rainfall . this has an implication of the region having the best breeding ground of sths as well as more people consuming semicooked vegetables that may carry helminth eggs . in mwanza region , the distribution of s. mansoni was similar to that of mara with more happenings close to the lake and s. haematobium on the hinterland . the high prevalence of intestinal and urogenital schistosomisiasis in the study area was a function of the distance from lake victoria , the former being more prevalent at localities close to the lake , whilist the latter is more so away from it [ 52 - 54 ] . moreover , in areas where the prevalence of s. haematobium was high , there was a significant prevalence of hookworms . the findings are in line with other studies in magu district in mwanza region [ 10 - 12 ] . the spatial distribution of s. haematobium is in accordance to the presence of ponds and streams as well as the wetness and warmth of the soil that are prerequisites for proliferation of the 2 helminths . we could not easily establish why there were no ascaris or trichuris infections in mwanza and shinyanga regions that are situated in the middle of the study area . difference in soil structure and texture as well as climate among the regions could be the reasons for the difference . kagera region on the west bordering southern uganda and mara region on the west which borders western kenya have similar prevalence of the sths as compared to mwanza and shinyanga regions . the prevalence of hookworm infections , 34% at mwaginghi in kwimba district , and 21.7% at nearby nyamikoma location in magu district , was similar to an ealier report in the same area . despite the fact that mara region is closer to the western province in kenya with similar types of sth infections this study recoded a mean regional prevalence ranging from 1% to 8% whereas studies in kenya s nyanza province reported the prevalence of 22.9% and 17.9% for a. lumbricoides and t. the high prevalence of intestinal schistosomiasis at mwisenge and nyamitwebili schools were associated with their being very close to the lake shore . the high prevalence of urogenital shistosomiasis at guta a and minigo could be ascribed to paddy fields , that are good habitats for the snail intermediate host of s. haematobium , that were enormous in the sourounding areas . in mara region , moreover , in areas where schistosomiasis was high , there was a significant prevalence of hookworms . this association was reported elsewhere ; these findings are in line with that from magu district in mwanza region and in western kenya . as expected , the prevalence of intestinal schistosomiasis was extremely low in shinyanga region that is more than 150 km away from the lake but had the highest prevalence of urogenital schistosomiasis . the results showed that schistosomisasis and 3 sths infections are co - endemic in lake victoria basin in tanzania with a high probability of polyparasitism in the study participants . the prevalence of s. mansoni , s. haematobium , and sths ranged from low to moderate in most parts of the study area . intestinal schistosomiasis was prevalent along the lake victoria shores and decreased with distance from it . conversely , the prevalence of urogenital schistosomiasis increased with distance from the lake . from the study findings this could be given in a participatory manner so that each member gets engaged in the learning process especially through peer educators . second , study teams need to conduct regular research in order to control incidence and reinfection rates in the area by carrying out regular treatment exercises . third , community - based provision of adequate safe water supply and sanitation facilities are imperative . water supply could be done through construction / drilling of wells at each sub - village , institutions , and health facility .

the objectives of this study was to conduct a survey on schistosomiasis and soil - transmitted helminth ( sth ) infections in order to come up with feasible control strategies in lake victoria basin , tanzania . depending on the size of the school , 150 - 200 schoolchildren were recruited for the study . duplicate kato - katz stool smears were prepared from each child and microscopically examined for schistosoma mansoni and sths . urine specimens were examined for schistosoma haematobium eggs using the filtration technique . after the survey , mass drug administration was done using praziquantel and albendazole for schistosomiasis and sths infections , respectively . a total of 5,952 schoolchildren from 36 schools were recruited for the study and had their stool and urine specimens examined . out of 5,952 schoolchildren , 898 ( 15.1% ) were positive for s. mansoni , 754 ( 12.6% ) for hookworms , 188 ( 3.2% ) for ascaris lumblicoides , and 5 ( 0.008% ) for trichuris trichiura . out of 5,826 schoolchildren who provided urine samples , 519 ( 8.9% ) were positive for s. haematobium eggs . the results revealed that intestinal schistosomiasis , urogenital schistosomiasis , and sth infections are highly prevalent throughought the lake basin . the high prevalence of intestinal and urogenital schistosomisiasis in the study area was a function of the distance from lake victoria , the former being more prevalent at localities close to the lake , whilst the latter is more so away from it . control of schistosomiasis and sths in the study area requires an integrated strategy that involves provision of health education to communities , regular treatments , and provision of adequate safe water supply and sanitation facilities .

INTRODUCTION MATERIALS AND METHODS Study area and population Specimen collection and examinations Data management and analysis Ethical considerations RESULTS DISCUSSION

PMC4987943

in addition to transmission of genetic information from dna to proteins , rna is capable of performing a wide range of biological functions in cells , including catalysis , genetic control and molecular recognition ( 1 ) . because the functions of rnas are largely determined by their diverse three - dimensional ( 3d ) structures , tools capable of efficiently and accurately comparing two rna 3d structures are important in computational structural biology . currently , several popular and useful tools of aligning two rna 3d structure have been proposed based on heuristic approaches , such as sara ( 2,3 ) , iparts ( 4 ) , setter ( 5,6 ) and rass ( 7,8 ) . both sara and iparts align two rna 3d structures by using a similar approach , which reduces the 3d structures into one - dimensional ( 1d ) sequences according to some local structure features in the nucleotide backbone conformation ( i.e. backbone unit vectors used in sara and backbone pseudo - torsion angles used in iparts ) and then applies traditional sequence alignment algorithms to align the resulting 1d sequences ( 24 ) . as to setter , it divides the rna 3d structure into non - overlapping local structural units , called generalized secondary structure units ( gssus ) , and then obtains their structural alignment by using a comparison method based on a distance measured by rmsd ( root mean square deviation ) transformation between all possible pairs of gssus ( 5,6 ) . rass develops a method based on elastic shape analysis , which treats the structures of rnas as 3d curves with their 1d nucleotide sequence encoded on additional three dimensions , so that the structural alignment of two rnas is performed in a joint sequence - structure space of six dimensions ( 7,8 ) . the method we used to implement iparts ( 4 ) is the so - called structural alphabet ( sa)-based approach , which uses an sa of 23 letters to reduce rna 3d structures into 1d sequences of sa letters and applies traditional sequence alignment to these sa - encoded sequences for determining their global or local similarity . in fact , the accuracy performance of our iparts largely depends on the quality of the sa , which was constructed from a list of 117 rna 3d structures using the pseudo - torsion angles of their nucleotide backbones . it has been shown that for rnas , two pseudo - torsion angles ( and ) are sufficient to describe the backbone conformation of each nucleotide ( 9 ) . actually , during the last 5 years after the introduction of our iparts , several hundreds of new rna 3d structures have been determined and already deposited in the pdb / ndb databases ( 10,11 ) . these newly determined rna 3d structures should benefit us to improve the accuracy of our iparts by constructing a new and sufficiently high quality sa . in addition , as was reported in the study of rass ( 7,8 ) , both 1d nucleotide sequences and 3d structures of rnas need to be taken into account when determining their functions , because 1d sequence carries side chain information of nucleotides , 3d structure carries the backbone geometry information of nucleotides and both types of information are different and can play important roles in determining rna functions . in this study , we have re - implemented our previous tool iparts as a new web server named iparts2 ( meaning iparts version 2 ) by constructing a totally new sa , which consists of 92 elements with each element carrying both information of base ( 1d ) and backbone geometry ( 3d ) for a representative nucleotide , from a representative and sufficiently non - redundant list of 876 atomic - resolution rna 3d structures with 65154 nucleotides in total ( 12 ) . this sa is significantly different from the one used in iparts , because the latter , constructed by using 117 crystal rna structures with 9527 nucleotides , consists of only 23 elements , each of which carries only the backbone geometry information of a representative nucleotide . like in iparts , we also equip iparts2 with two capabilities of aligning two rna 3d structures : ( i ) global alignment that can be used to determine their overall structural similarity and ( ii ) local alignment that can be used to find their locally similar substructures . it is worth mentioning here that the function of local alignment in iparts2 is unique when compared with other tools sara , setter and rass , because they all provide the function of global alignment only . for validation , we have used a benchmark dataset fscor with 419 rna 3d structures to test our iparts2 and compare the accuracy performance of its global alignment with its previous version iparts , as well as other popular tools sara , setter and rass . our experimental results have finally shown that our current iparts2 indeed outperforms its previous version iparts and also achieves better accuracy than sara , setter and rass in rna alignment quality and function prediction . in this study , we have implemented iparts2 by using an improved sa - based algorithm as follows . first , 63402 non - terminal nucleotides from the rna 3d hub non - redundant list ( version 1.89 ) of 876 rna 3d structures ( 12 ) were classified into 23 conformation clusters according to their backbone pseudo - torsion angles . next , 23 capital letters were used to represent the center nucleotides of these 23 clusters and for each letter , four different background colors were further used to separately represent four possible base types a , g , c and u of the corresponding center nucleotide . as a result , we constructed an sa of 92 elements with each element ( a letter on a colored background ) carrying both information of backbone geometry ( letter ) and base ( background color ) for a representative nucleotide . finally , the sa was used to reduce input rna 3d structures into 1d sa - encoded sequences and a traditional sequence alignment , such as global alignment ( without penalty to end gaps ) ( 13 ) or local alignment ( 14 ) , was applied to them for determining their global or local similarity . in addition , for the accuracy of aligning two sa - encoded sequences , the statistical method proposed by henikoff and henikoff ( 15 ) was applied to derive a blosum - like substitution matrix that can reward more similar sa - encoded sequences with high scores . we refer the reader to the supplementary data for the details of the above improved sa - based algorithm . it is worth mentioning here that the local alignment algorithm we used to implement iparts2 is slightly different from the one used in iparts , because we further utilized the technique mentioned in ( 16 ) to modify the local alignment algorithm such that the local alignments returned by iparts2 are non - intersecting , where two alignments are said to be non - intersecting if they do not have a match or mismatch in common . usually , non - intersecting local alignments of rna structures are more of practical interest to the user . currently , iparts2 can be accessed by an easy - to - operate web interface as illustrated in figure 1 . it provides the user two kinds of alignments for comparing two rna 3d structures : ( i ) global alignment for determining their whole structural similarity , and ( ii ) local alignment for finding common similar substructures . basically , iparts2 takes as input two rna 3d structures , each of which can be either a pdb / ndb i d or a pdb file uploaded by the user , their chain ids if they have multiple chains , and optionally the starting and ending residue numbers of substructures to be aligned . if required , the user can run iparts2 by modifying the default settings of all the parameters , including alignment method ( whose default is global alignment ) , gap open and extension penalties ( whose default values are 9 and 1 , respectively ) , and number of suboptimal alignments ( at least one ) . in the output page , next , iparts2 continues to show its running time , as well as its alignment results , including structural alignment score ( sas ) ( refer to the experimental results section for its definition ) between input rna 3d structures with corresponding raw score in parentheses , number of aligned nucleotide pairs , rmsd and optimal / suboptimal alignments of their sa - encoded sequences and corresponding rna sequences . note that each letter in the aligned sa - encoded sequences is displayed with a colored background , which indicates the base type ( a , g , c or u ) of the corresponding nucleotide . finally , iparts2 shows a jsmol graphical display ( without installing java plugin ) of aligned rna 3d structures , so that the user can visually view , rotate and enlarge the 3d structures of input rna molecules and their structural superposition and download their alignment and pdb files . note that in the jsmol visualization , end - gap residues in global alignment or non - aligned residues in local alignment are displayed in light colors . first , we tested iparts2 by running its global alignment on a benchmark dataset called fscor and evaluated its accuracy in function assignment by comparing its receiver operating characteristic ( roc ) curve with those obtained by iparts ( 4 ) and other existing popular tools , including sara ( 2,3 ) and setter ( 5,6 ) . the fscor dataset originally proposed in ( 3 ) contains 419 rna 3d structures that are classified into 168 functional classes . we ran all the tools mentioned above locally by aligning all 87571 pairs of rna 3d structures in the fscor dataset . to take the quality of the structural alignments into account , the roc curves of all the tools were computed based on a geometric match measure called sas , which is defined to be ( rmsd 100)/(number of aligned nucleotide pairs ) ( 17,18 ) , instead of native alignment score . the reason is that , as suggested in ( 18 ) , a better structural alignment should match more residues and also have lower rmsd , and the geometric match measure sas is better than the native alignment score to separate good structural alignments from less good ones . two rna structures in the fscor dataset are said to be functionally identical if they have the same deepest scor classification ( i.e. their geodesic distance d = 0 ) or functionally similar if they differ at least in the deepest scor classification ( i.e. d 2 ) . to obtain the roc curve of each tool , the alignments of all pairs of rna structures computed by the tool are sorted by their sas values . a threshold of sas is then varied between the minimum and maximum of the sorted sas values for producing the points of the roc curve . for a fixed threshold , all pairs of aligned rna structures whose sas values are above the threshold are assumed positive and all below it negative . moreover , the pairs assumed positive are counted as true positives ( tp ) if they are functionally identical ( d = 0 ) or similar ( d 2 ) and false positives ( fp ) otherwise ; the pairs assumed negative are counted as true negatives ( tn ) if they are functionally non - identical ( d > 0 ) or dissimilar ( d > 2 ) and false negatives ( fn ) otherwise . the point of the roc curve corresponding to the fixed threshold is then produced by plotting its tp rate tp/(tp + fn ) on the y - axis and its fp rate fp/(fp + tn ) on the x - axis . as a result , the roc curves for all the evaluated tools mentioned above are displayed in figures 2 and 3 for d = 0 and d 2 , respectively . these experimental results have shown that our iparts2 outperforms its previous version iparts and other tools sara and setter for the function assignment in the fscor dataset , because iparts2 has the highest auc values of 0.914 and 0.772 for d = 0 and d 2 , respectively . roc curves for d = 0 based on the sas values of all aligned pairs of rna 3d structures in the fscor dataset , where the auc values of iparts , sara , setter and iparts2 are 0.861 , 0.883 , 0.843 and 0.914 , respectively . note that the auc value of rass computed by using the 67006 pairs of rna 3d structures is 0.892 . roc curves for d 2 based on the sas values of all aligned pairs of rna 3d structures in the fscor dataset , where the auc values of iparts , sara , setter and iparts2 are 0.740 , 0.761 , 0.713 and 0.772 , respectively . note that the auc value of rass computed by using the 67006 pairs of rna 3d structures is 0.758 . next , we also compared the capabilities of iparts , sara , setter and iparts2 for the function assignment with rass ( 7,8 ) using the fscor dataset . as mentioned before , rass is a recently developed tool of comparing two rnas by considering both information of their sequences ( bases ) and 3d structures ( backbone geometry ) . when running rass on the fscor dataset , however , we noticed that for 20565 pairs among 419 rna 3d structures , rass was not able to provide their structural alignments so that their sas values were not able to be computed . therefore , for a fair comparison of all the evaluated tools , we calculated their roc curves only using those 67006 pairs of rna 3d structures whose structural alignments were able to be provided by rass . in this situation , iparts2 still performs better than all other tools , including rass , according to the auc values of their roc curves ( refer to supplementary figures s5 and 6 ) . for the results of additional experiments , we refer the reader to the supplementary data . finally , for the running time comparison of all the tools mentioned before , we used five datasets containing two or more rna 3d structures of various lengths as follows : ( i ) five trna structures ( 1ehz : a , 1h3e : b , 1i9v : a , 2tra : a and 1yfg : a ) with an average length of 76 nucleotides , ( ii ) three ribozyme p4-p6 domains ( 1gid : a , 1hr2:a and 1l8v : a ) with an average length of 157 nucleotides , ( iii ) two domains v of 23s rrna ( 1ffz : a and 1fg0:a ) with an average length of 496 nucleotides , ( iv ) two 16s rrna ( 1j5e : a and 4v4q : aa ) with an average length of 1522 nucleotides and ( v ) two 25s rrna ( 4v7r : b1 and 4v7r : d1 ) with an average length of 3396 nucleotides . the average running times of all the tools were obtained by running them with their default parameters on local machine with intel cpus with 3.4 ghz and 32 gb of ram under linux system . as shown in table 1 , setter is the fastest tool among all the five tools . however , our iparts2 , as well as iparts , outperforms both sara and rass , and it can finish its alignment job in several seconds up to a couple of minutes . in this study , we have re - implemented our previous tool iparts into a new web server iparts2 by constructing a totally new sa of 92 elements , with each element carrying both information of base ( 1d ) and backbone geometry ( 3d ) for a representative nucleotide . according to our experimental results on a benchmark dataset , iparts2 indeed outperforms iparts and also achieves better accuracy than other popular tools , such as sara , setter and rass , in rna alignment quality and function prediction . therefore , iparts2 can serve as a useful tool for aligning two rna 3d structures , which can further provide insight into structural and functional properties of rnas . ministry of science and technology of taiwan [ most104 - 2221-e-007 - 027-my2 , in part ] . funding for open access charge : ministry of science and technology of taiwan [ most104 - 2221-e-007 - 027-my2 ] .

since its first release in 2010 , iparts has become a valuable tool for globally or locally aligning two rna 3d structures . it was implemented by a structural alphabet ( sa)-based approach , which uses an sa of 23 letters to reduce rna 3d structures into 1d sequences of sa letters and applies traditional sequence alignment to these sa - encoded sequences for determining their global or local similarity . in this version , we have re - implemented iparts into a new web server iparts2 by constructing a totally new sa , which consists of 92 elements with each carrying both information of base and backbone geometry for a representative nucleotide . this sa is significantly different from the one used in iparts , because the latter consists of only 23 elements with each carrying only the backbone geometry information of a representative nucleotide . our experimental results have shown that iparts2 outperforms its previous version iparts and also achieves better accuracy than other popular tools , such as sara , setter and rass , in rna alignment quality and function prediction . iparts2 takes as input two rna 3d structures in the pdb format and outputs their global or local alignments with graphical display . iparts2 is now available online at http://genome.cs.nthu.edu.tw / iparts2/.

INTRODUCTION MATERIALS AND METHODS USAGE OF iPARTS2 EXPERIMENTAL RESULTS SUMMARY Supplementary Material SUPPLEMENTARY DATA FUNDING

PMC3276008

a drug intended for use in humans should have an ideal balance of pharmacokinetics and safety , as well as potency and selectivity . human oral bioavailability is an important pharmacokinetic property which describes the fraction of an administered drug that reaches the systematic circulation and its site of action , to exert its pharmacological and therapeutic effects . bioavailability is 100% when a medication is administered parenterally as it goes straight into the bloodstream and is usually completely used by the body . however , when a medication is administered via other routes ( such as orally ) , its bioavailability decreases . prediction of oral bioavailability is not an easy task , as bioavailability depends on superposition of two processes : absorption and liver first - pass metabolism . absorption in turn depends on solubility and permeability of compounds , as well as interactions with transporters and metabolizing enzymes in gut wall . permeability further depends on the size of the molecule , as well as its capacity to make hydrogen bonds , its overall lipophilicity and possibly its shape and flexibility . molecular flexibility , for example , as evaluated by counting the number of rotatable bonds , has been identified as a factor influencing bioavailability.-[24 ] the bioavailability of drugs from oral formulations is also influenced by many physiological factors including gastrointestinal fluid composition , ph and dynamics , transit and motility and transport . these factors may vary with age , gender , race , food , and disease . oral bioavailability is denoted by the letter f. to lower the attrition rate of drug development there is a need to develop strong and accurate computational methods that can predict and prioritize compounds before they are synthesized or moved towards to preclinical and clinical development . various prediction models are reported in the literature on known oral bioavailable drugs such as statistical models,[715 ] mechanistic models,[1621 ] qsar / qspr models,[2228 ] genetic programming,[2933 ] artificial neural networks , machine learning classification,[3436 ] etc . we have selected oral bioavailability data from various literature studies.[4153741 ] the whole dataset comprises of 1664 drugs . redundancy was completely removed by manually screening and selected dataset for this study comprises of chemically diverse 511 drugs . drugs having oral bioavailability less than 30% were regarded as low orally bioavailable drugs and drugs with oral bioavailability 30% or more were regarded as high orally bioavailable . class labels were defined as 1 for high oral bioavailability and 0 for low oral bioavailability . further the whole dataset of 511 drug molecules was randomly split into training set of 384 drugs and test set of 127 drugs . training set was used for training various classifiers , while testing set was not exposed to the system during descriptor selection , learning , kernel selection , and hyper - parameter selection phases . in classification problem usually the data that is to be classified is associated with a large number of features or descriptors . as a result feature or descriptor selection is a process of identifying and removing as much of the irrelevant and redundant information as possible . the removal of irrelevant and redundant information often improves the performance of machine learning algorithms . twelve optimal descriptors were selected using the sequential forward feature selection ( sffs ) algorithm . iteratively algorithm adds to the basis each feature which was not previously selected and retains the feature subset that results in the highest estimated performance . the search terminates after the accuracy of the current subset can not be improved by adding any other feature . sffs is stated as : given a feature set x-{xi | i=1 n } , find a subset ym = { xi , , the set of optimal descriptors include molecular mass ( ma ) , molecular surface area ( msa ) , molecular volume ( mv ) , molecular refractivity ( mr ) , total hydrogen count ( hc ) , partition coefficient ( logp ) , rotatable bonds ( rtb ) , total polar surface area ( tpsa ) , solubility index ( logs ) , shape flexibility index ( sfi ) sum of e - states indices ( sesi ) and count of hydroxyl groups ( hyg ) . different feature values for dataset falls in different ranges hence to avoid the discrepancy we have further scaled down these numeric values between 1 to 1 . such scaling facilitates better representation of feature values in kernel function and also avoid numerical difficulties during the calculation . in this process , input vector for training as well as the test set has been quantified as x = ( x1 , x2 , , x13 ) , each labeled by corresponding y = 0 or y = 1 depending on whether it represents high orally bioavailable drug or low orally bioavailable drug , respectively . training set was then subjected to the support vector machine ( svm ) classifier , which involved fixing several hyper - parameters which further determines the function optimized by svm . it is extremely crucial and has a profound impact on the performance of trained classifier . we used several kernels : linear , polynomials , and radial bias function ( rbf ) initially to determine which of them is applicable to our data and is able to classify it efficiently . we found rbf as the suitable classifier function ( as the number of features was not very large in comparison to the dataset ) for which training errors on low oral bioavailability data ( false negatives ) outweigh errors on high oral bioavailability data ( false positives ) . k(xi , xj ) = exp ( | | xi xj | | ) .(1 ) this kernel ( 1 ) is best for the data in which the class - conditional probability distribution function approaches the gaussian distribution . it maps the non - linear data into a higher dimension space where data is linearly separable . its exponential nature can be expanded into an infinite series , giving rise to an infinite - dimension polynomial kernel . however , this kernel is bit difficult to design , in the sense that it is difficult to arrive at an optimum and choose the corresponding c that works best for a given problem . this has been taken care by running grid parameter search exploring all combinations of c and with each cross - validation routine , where ranged from 2 to 2 and c ranged from 2 to 2 . to identify an optimal hyper - parameter set we have performed a two - step grid - search on c and with the use of 10 folds cross - validation , by dividing training set into 10 subsets of equal size ( ~38 drugs each having 12 descriptors ) . pairs of ( c ; ) have been tried and the one with the best cross - validation accuracy has been picked . using rbf kernel , the best cross - validation accuracy was obtained at = 0.0078125 and c = 512 . the result obtained showed a good classification accuracy of 88.54% during the cross - validation . we have selected oral bioavailability data from various literature studies.[4153741 ] the whole dataset comprises of 1664 drugs . redundancy was completely removed by manually screening and selected dataset for this study comprises of chemically diverse 511 drugs . drugs having oral bioavailability less than 30% were regarded as low orally bioavailable drugs and drugs with oral bioavailability 30% or more were regarded as high orally bioavailable . class labels were defined as 1 for high oral bioavailability and 0 for low oral bioavailability . further the whole dataset of 511 drug molecules was randomly split into training set of 384 drugs and test set of 127 drugs . training set was used for training various classifiers , while testing set was not exposed to the system during descriptor selection , learning , kernel selection , and hyper - parameter selection phases . in classification problem usually the data that is to be classified is associated with a large number of features or descriptors . as a result so first and foremost step is to reduce the dimensions . feature or descriptor selection is a process of identifying and removing as much of the irrelevant and redundant information as possible . the removal of irrelevant and redundant information often improves the performance of machine learning algorithms . twelve optimal descriptors were selected using the sequential forward feature selection ( sffs ) algorithm . sffs algorithm starts with an empty set of features . in first iteration , algorithm considers all feature subsets with only one feature . iteratively algorithm adds to the basis each feature which was not previously selected and retains the feature subset that results in the highest estimated performance . the search terminates after the accuracy of the current subset can not be improved by adding any other feature . sffs is stated as : given a feature set x-{xi | i=1 n } , find a subset ym = { xi , , xm } , with m < n , that optimizes an objective function j(y ) . the set of optimal descriptors include molecular mass ( ma ) , molecular surface area ( msa ) , molecular volume ( mv ) , molecular refractivity ( mr ) , total hydrogen count ( hc ) , partition coefficient ( logp ) , rotatable bonds ( rtb ) , total polar surface area ( tpsa ) , solubility index ( logs ) , shape flexibility index ( sfi ) sum of e - states indices ( sesi ) and count of hydroxyl groups ( hyg ) . different feature values for dataset falls in different ranges hence to avoid the discrepancy we have further scaled down these numeric values between 1 to 1 . such scaling facilitates better representation of feature values in kernel function and also avoid numerical difficulties during the calculation . in this process , input vector for training as well as the test set has been quantified as x = ( x1 , x2 , , x13 ) , each labeled by corresponding y = 0 or y = 1 depending on whether it represents high orally bioavailable drug or low orally bioavailable drug , respectively . training set was then subjected to the support vector machine ( svm ) classifier , which involved fixing several hyper - parameters which further determines the function optimized by svm . it is extremely crucial and has a profound impact on the performance of trained classifier . we used several kernels : linear , polynomials , and radial bias function ( rbf ) initially to determine which of them is applicable to our data and is able to classify it efficiently . we found rbf as the suitable classifier function ( as the number of features was not very large in comparison to the dataset ) for which training errors on low oral bioavailability data ( false negatives ) outweigh errors on high oral bioavailability data ( false positives ) . k(xi , xj ) = exp ( | | xi xj | | ) .(1 ) this kernel ( 1 ) is best for the data in which the class - conditional probability distribution function approaches the gaussian distribution . it maps the non - linear data into a higher dimension space where data is linearly separable . its exponential nature can be expanded into an infinite series , giving rise to an infinite - dimension polynomial kernel . however , this kernel is bit difficult to design , in the sense that it is difficult to arrive at an optimum and choose the corresponding c that works best for a given problem . this has been taken care by running grid parameter search exploring all combinations of c and with each cross - validation routine , where ranged from 2 to 2 and c ranged from 2 to 2 . to identify an optimal hyper - parameter set we have performed a two - step grid - search on c and with the use of 10 folds cross - validation , by dividing training set into 10 subsets of equal size ( ~38 drugs each having 12 descriptors ) . pairs of ( c ; ) have been tried and the one with the best cross - validation accuracy has been picked . using rbf kernel , the best cross - validation accuracy was obtained at = 0.0078125 and c = 512 . the result obtained showed a good classification accuracy of 88.54% during the cross - validation . to optimize the svm parameters and c , 10-fold cross - validation was applied on each of the training datasets bin , exploring various combinations of c ( 2 to 2 ) and ( 2 to 2 ) . in 10-fold cross - validation , the training dataset ( 384 drugs , each having 12 descriptors ) was spilt into 10 subsets , each of equal size , where one of such subsets was used as the test dataset while the other subsets were used for training the classifier . the process is repeated 10 times using a different subset of a corresponding test and training datasets , hence ensuring that all subsets are used for both training and testing . a twofold grid optimization has been considered and the result shown [ figure 2 ] suggests that the optimized c and were found to be 512 and 0.0078125 , respectively . contour plot of grid search result showing optimum values of hyper - parameter the best combination of and c that was obtained from grid based optimization is used for training a rbf - based svm classifier using entire training data ( 384 drugs each having 12 descriptors ) . the result obtained showed a good classification accuracy of 88.54% during the cross - validation . the reported accuracy on the training datasets depicts the effectiveness and reliability of this prediction method ; but still it may or may not give the equivalent or better accuracy when applied on the novel drugs , i.e. drugs with an unknown oral bioavailability profile . therefore , it is extremely important to test the svm classifier on the non - cross validated test set which is out - of - sample and independent of the training set data . we applied the svm classifier on the whole test set ( 127 ligands each having 12 descriptors ) , the classifier incurred an accuracy of 96.85% by using the rbf kernel with = 0.0078125 and c = 512 . this prediction accuracy suggests that svm - based prediction of oral bioavailability can be considered as a helpful tool in drug discovery and development . the efficiency of a classifier was further evaluated with the help of various quantitative variable : ( a ) true positive ( tp ) , represents total number of correctly classified high orally bioavailable drugs , ( b ) true negative or ( tn ) , represents total number of correctly classified low orally bioavailable drugs ( c ) false positive ( fp ) , represents total number of incorrectly classified low orally bioavailable drugs , ( d ) false negatives ( fn ) , represents total number of incorrectly classified high orally bioavailable drugs . using these quantitative variables , several statistical metrics were calculated to measure the effectiveness of the oral bioavailability - svm classifier . sensitivity ( sn ) and specificity ( sp ) metrics , which indicate the ability of a prediction system to classify the high and low orally bioavailable drugs , were calculated by equations ( 2 ) and ( 3 ) and receiver operating characteristic curve ( roc ) for the same was plotted [ figure 3 ] . receiver operating characteristic ( roc ) plot for a classifier with optimized values of c and sn ( % ) = [ tp/ ( tp+fn)]*100 .(3 ) to indicate an overall performance of the classifier system ; accuracy ( ac ) , for the percentage of correctly classified drugs and the matthews correlation coefficient ( mcc ) were computed as follows : ac = [ ( tp + tn)/ ( tp+fp+tn+fn)]*100 .(4 ) mcc= [ ( tp*tn)-(fp*fn)]/ ( tn+fp ) ( tn+fn ) ( tp+fp ) ( tp+fn ) .(5 ) sensitivity ( sn ) came out to be 95.60% with a false positive proportion ( fp ) of 0.79% whereas specificity ( sp ) came out to be 97.30% with a false negative ( fn ) proportion of 3.15% . similarly youden 's index ( youden 's index = sensitivity + specificity 1 ) was 0.929 and matthews correlation coefficient ( mcc ) was found to be 0.909 . the overall accuracy ( ac ) calculated using equation ( 4 ) was 96.1% which is significantly higher than existing methods . the area under roc curve was found to be 0.943 with a standard error of 0.0253 . the prediction model derived from svm can serve as primary tool for generating some idea about oral bioavailability of ligands . user just needs to calculate the 12 physicochemical descriptors , as these values are prerequisite for prediction of oral bioavailability through the generated svm model [ figure 1 ] . the ligand with unknown oral bioavailability can be tested against the prediction model . for given 12 physicochemical properties this svm model can predict the oral bioavailability of the ligand under consideration . at preliminary level , this model can predict that whether the oral bioavailability of the ligand under study is low or high . numerous attempt have been made to predict oral bioavailability of drugs and ligands by computational and experimental method in past . some of those prediction models are listed in table 1 along with the current study and the model generated by svm seems to be more satisfactory in terms of prediction accuracy . comparative study of some of the oral bioavailability prediction models with current study absorption of drug taken orally is a complex process and , although related to drug physicochemical properties , it is related in fairly complex ways . physiological and environmental conditions influence the bioavailability of drugs such as the presence or the absence of food , residence time of the drug in contact with the small intestinal epithelium , etc and make the absorption prediction further complex . failure to appreciate this complexity in attempting to build models may lead to the generation of model with low confidence . an alternative approach to modeling oral bioavailability is to develop structure - based models for the properties contributing to the absorption process , such as solubility and permeability ( included in presented model as logs and logp ) . for example , if a potential drug is expected to have poor oral bioavailability due to low - intrinsic aqueous solubility , then this is a property amenable to manipulation by the formulation scientist . on the other hand , if the compound is both poorly soluble and permeable , along with a significant metabolic liability , optimization may be very difficult if not impossible . such candidates present high risks to successful development and should be identified as such early in the drug identification and development process . the svm classifier with radial basis function kernel with = 0.0078125 and c = 512 applied on the test datasets . it suggests that while considering chemoinformatics approaches into account , svm - based prediction of oral bioavailability can be a significantly important tool for drug development and discovery at a preliminary level .

objective : a computational model for predicting oral bioavailability is very important both in the early stage of drug discovery to select the promising compounds for further optimizations and in later stage to identify candidates for clinical trials . in present study , we propose a support vector machine ( svm)-based kernel learning approach carried out at a set of 511 chemically diverse compounds with known oral bioavailability values.material and methods : for each drug , 12 descriptors were calculated . the selection of optimal hyper - plane parameters was performed with 384 training set data and the prediction efficiency of proposed classifier was tested on 127 test set data.results:the overall prediction efficiency for the test set came out to be 96.85% . youden 's index and matthew correlation index were found to be 0.929 and 0.909 , respectively . the area under receiver operating curve ( roc ) was found to be 0.943 with standard error 0.0253.conclusion:the prediction model suggests that while considering chemoinformatics approaches into account , svm - based prediction of oral bioavailability can be a significantly important tool for drug development and discovery at a preliminary level .

INTRODUCTION MATERIALS AND METHODS Dataset Descriptor selection Support vector machine description RESULTS DISCUSSION CONCLUSION

PMC2633151

the removal of infected carious dentin is an exacting procedure routinely accomplished during tooth preparation , prior to placing a restoration . although explorer - verified hardness equal to that of normal dentin is traditionally considered the ideal endpoint of excavation , caries indicator dyes have been developed to provide a more objective and easily recognized visual differentiation for this endpoint.14 these dyes also distinguish between the outer layer of very soft highly infected carious dentin and the deeper layer of somewhat softened uninfected or at most lightly infected dentin.5,6 caries detector ( kuraray america , ny , ny ) and caries finder red ( danville materials , san ramon , ca ) are two representative products , consisting of 1% acid red 52 dye ( sulforhodamine b ) in propylene glycol.7 a recent approach to minimizing unwanted staining by caries indicator dyes has been to change the solvent for the dye compound . the rationale is based upon two studies that showed diminished diffusion into porous tissues of dyes dissolved in higher molecular weight solvents.810 instead of propylene glycol ( mw=76 ) ( pg ) or a mixture of pg and water as used in many currently marketed caries dye products , new formulations using larger molecules such as polypropylene glycol ( mw=300 , for example ) ( ppg ) have been proposed . in 2005 , a us patent application was filed for this type of caries detecting solution.11 this application discloses a range of inventive examples including solutions containing various mixtures of ppg with a molar weight of 300 , polyethylene glycol with molar weights of 400 and 4000 , pg , glycerin and water . two new caries indicator dye products are now available in japan ( caries check red and caries check blue , nishika co. , yamanashi , jp ) consisting of 1% acid red 52 or brilliant blue dye in 300 mw ppg . a few studies do indicate , at least indirectly , that ppg - based dye solutions may provide a more conservative excavation endpoint . when the final excavated surfaces determined by pg - based dye solution or ppg - based dye solution were compared using micro - vickers hardness ( mvh ) , it was found that the ppg dye - determined group was significantly softer than the pg dye - determined group ( mean mvh 32.7 vs. 44.7).12 since hardness generally increases with increasing depth in dentin carious lesions this result would suggest a shallower , more conservative endpoint for the ppg dye - determined specimens.3 because both groups were found to be free of bacteria histologically , it was concluded that the ppg dye - determined endpoint would be preferable . however , since hardness generally decreases with increasing depth in normal dentin , the clinical interpretation of hardness differences is somewhat obscured . after this initial report , studies incorporating laser fluorescence comparisons pointed toward a similar conclusion , at least for permanent teeth . the rationale for using laser fluorescence values ( dd ) ( diagnodent , kavo , usa ) to assess differences in excavation endpoints was based upon a study of the spectral autofluorescence characteristics of carious lesions , as well as general guidelines for interpretation of dd values when detecting carious lesions in occlusal fissures.1315 in extracted carious teeth , it was shown that the mean mvh was significantly lower and dd values significantly higher in the ppg dye - determined group versus the pg dye - determined group.16 in another study , a similar result was found for the group mean dd value in permanent teeth but not in primary teeth.17 another study using extracted teeth containing acute or chronic carious lesions also found that the mean dd value was higher for the ppg dye - determined group versus the pg dye - determined group.13 in a clinical study , this same result regarding dd values was confirmed for permanent teeth but not for primary teeth.8 one of these studies also found that all specimens first excavated to an endpoint indicated with the ppg - based dye could subsequently be re - stained with the pg - based dye , once again suggesting that ppg - based dye solutions may indicate a more conservative endpoint for excavation.13 more direct confirmation of this apparently more conservative endpoint indicated by ppg - based dyes is necessary for several reasons . first , although these initial studies do demonstrate a statistically significant difference in mean mvh and dd value between sample groups , it is not clear whether a difference exists in all carious lesions or just certain ones . in addition , although microhardness does generally increase with increasing depth in a dentin carious lesion , the relationship between microhardness and depth is neither linear nor constant from tooth to tooth.18 similarly , although dd values do generally decrease with increasing depth in a dentin carious lesion , this inverse relationship is not linear and certainly not constant from tooth to tooth.19 this is true both at the unexcavated lesion surface and across the pg dye - guided excavation front.19 in light of these variables , and to assess clinical implications for cavity preparation , it is necessary to investigate the differences between the actual physical locations of surfaces created by ppg dye - guided excavation and those created by pg dye - guided excavation . the purpose of this study is to determine the difference in the location of the caries dye staining endpoint indicated by 1% acid red 52 dye in pg versus that indicated by 1% acid red 52 dye in ppg , in freshly extracted human permanent posterior teeth containing primary dentin carious lesions . dye solutions were made by completely dissolving 0.100 g acid red 52 ( sulforhodamine b , # s-9012 , sigma chemical co. , st . louis , mo ) in 10.00 ml propylene glycol ( sigma # p-1009 ) or in 10.00 ml polypropylene glycol , ( triol type , mw=300 ) ( # 160 - 17605 , wako chemicals usa , richmond , va ) at room temperature . solutions were stirred by hand for ten minutes and vortex - mixed for two minutes twenty - four hours later . freshly extracted , unrestored human permanent posterior teeth with primary occlusal carious lesions were collected under an irb - exempt protocol . teeth were stored in sterile distilled water at 4c for up to two weeks prior to processing . the outer surface of each specimen was cleaned with a soft - bristle toothbrush and sterile distilled water , sectioned horizontally at the dentino - enamel junction , the root portion discarded and the pulp tissue removed from the crown portion . two opposing axial surfaces were ground flat , parallel to each other and perpendicular to the previous horizontal section plane using an 8 240 grit carborundum disc mounted in a water - lubricated surface polisher ( model 900 , electron microscopy sciences , hatfield , pa ) . in preparation for splitting , a continuous fine groove was cut about 1 mm deep in the center of each ground axial surface running occlusogingivally and connecting across the occlusal surface approximately bisecting the external surface of the carious lesion . the groove was made with a 1 thin diamond disc mounted in a lowspeed handpiece . to provide identical reference marks on both split tooth halves , two to six orientation notches about 2 mm deep were made with a # 57 carbide bur across and perpendicular to the fine groove at various locations , but not in the region of the carious lesion . the crown specimens were fractured along the groove using a 3/8 steel chisel and mallet yielding two segments , each containing a split surface showing the carious lesion in cross - section . one of the two surfaces from each crown specimen , chosen at random , was stained with the ppg - based dye and the other with the pg - based dye . two drops of dye were applied for ten seconds , rinsed under running tap water for ten seconds , the surface blotted damp - dry with a cotton gauze square and then observed under 2.6x loupe magnification . specimen pairs were discarded if they had not fractured along the fine groove or were missing tooth structure , if no lesion was observed in dentin or if the lesion extended to the pulp chamber , if the lesion was too dark to permit differentiation of the red dye staining , if the lesion was less than 1 mm into dentin , or if a previously unobserved restoration was detected . of the 41 specimens originally collected , 18 were accepted for further analysis . as controls , three of the 18 fractured specimen pairs were stained on both surfaces with 1% sulforhodamine b in pg . color digital images were then made of each fracture surface . using a digital microscope and camera ( optem zoom-100 , qioptiq , rochester , ny ) ( dp-11 , olympus america , melville , ny ) at 10x magnification and with ring light illumination ( # eke , schott - fostec , auburn , ny ) , image files were created with the following settings : white balance 3000k , resolution set at hq 17121368 pixels , iso 100 , ring light brightness 70 , and 1/15 sec exposure . images were saved as.jpg files . to standardize the orientation of the fracture surface relative to the camera , both a machinist square was fastened to the stand base to fix the position of a removable aluminum block on which specimens were mounted using a thin layer of boxing wax . for linear calibration , a millimeter grid was fixed to the block . image pairs were analyzed using a digital image analysis software program ( image pro discovery 4.5 , media cybernetics , silver spring , md ) . for each specimen , one of the two image pairs was opened , flipped left - to - right , and magnified 3x . using a graphic tablet and digital pen ( intuos 3 , wacom , vancouver , wa ) the most pulpal extent of the red dye - staining the other image of the pair was then opened , magnified 3x , and the pulpal extent of the dye - staining marked with a one pixel - wide blue line . this was accomplished by selecting a rectangular region of interest on one image that included both the blue or yellow line as well as the millimeter reference grid , edge of the aluminum mounting block and reference notches in the specimen surface . the selected area was copied and pasted into the other image using a 50% translucency setting for the paste operation , providing a means to visually align the two image pairs on the reference notch edges and aluminum mounting block edge , while permitting both the blue and yellow marked lines to be clearly seen . the distance between the yellow and blue lines was then measured using the software s linear measurement tool at 2x magnification after calibration based on the millimeter grid image . distance was measured from line to line ( l - l distance ) at five locations beginning in the center of the lesion , with two additional measurements on either side , spaced 0.5 mm apart , perpendicular to the most occlusally located line and recorded in millimeters to two decimals . this measurement protocol was repeated once for all 15 experimental samples and for two of the three control samples , providing a total of 150 experimental ( ten per sample ) and 50 ( five or ten per sample ) control l - l distance measurements . for each of the control ( 6 ) and experimental ( 15 ) specimen image pairs , mean l - l distance values were calculated . using these means , a weighted average was calculated for the combined control group and for the combined experimental group . the weighted averages were based on adjustment of the six or fifteen mean l - l distance values from each specimen group by the variance of the individual l - l distance values within that group . a 95% confidence interval was calculated for the weighted averages . to evaluate the test method , a 3-factor anova ( specimen , measurement , replication ) on rank - transformed data was carried out on the control and experimental data from the individual specimens ( control 6 , experimental 15 ) , using repeated measurements of each test pair ( 5 ) , and replication of the measurement protocol ( 2 ) . prior to the anova , the data in both the control and experimental groups were analyzed for normality using the shapiro - wilk test . all statistical analysis used sas v9.1 software ( sas institute , cary , nc ) . for 12 of the 15 experimental specimen image pairs , the line corresponding to ppg dye staining was located more occlusally ( shallower ) throughout its length than the line corresponding to pg dye staining . for two image pairs , the ppg dye staining line was predominately located more occlusally , but there were areas where the two lines were coincident or where the pg dye staining line was shallower . for these two specimen image pairs , this was true for both iterations of the image analysis protocol . in the specimen # 4 image pair , the pg dye staining line was shallower for 12% ( first iteration ) and 51% ( second iteration ) of the line length , and coincident for 11% ( first iteration only ) . in the specimen # 8 image pair , the pg dye staining line was shallower for 14% and 19% of the line length and coincident for 5% and 13% , respectively . for one specimen image pair ( # 1 ) , the dye staining lines were coincident for 2% of the line distance in one iteration only , and elsewhere the ppg dye staining line was shallower . mean l - l distances were small , ranging from 0.0377 mm to 0.0952 mm . mean l - l distances were larger than for the controls , ranging from 0.153 mm to 0.506 mm , while individual distances ranged from ( ) 0.12 mm to ( + ) 0.66 mm . table 3 presents the data for the weighted averages of the means for the control and experimental specimen image pairs . for the control specimen image pairs , the weighted average l - l distance was 0.70 mm , with a 95% confidence interval of 0.51 mm to 0.89 mm , versus a 0.298 mm l - l distance and 95% confidence interval of 0.2140 mm to 0.357 mm for the experimental group . the weighted average l - l distance for the experimental group was about four times that of the control group , with no overlap and 0.151 mm between the two confidence intervals . the shapiro - wilk test for normality indicated that the control data was normally distributed ( p=.1226 ) but that the experimental data was not normally distributed ( p=.0003 ) . therefore , anova on ranks was used to detect effects by groups . at a significance level of p=.05 , the anova on ranks detected a significant effect by specimen and measurement , but not by replication in the control data . table 4 summarizes the anova on ranks results by effects for control and experimental groups . the 0.298 mm weighted average l - l distance for all experimental specimens is clinically relevant since it is possible to remove dentin in increments of this magnitude , potentially resulting in more conservative cavity preparations and even preventing unnecessary pulp exposures in some instances . this advantage is somewhat limited , however , because 0.3 mm represents perhaps one or two careful applications of a hand excavator or round bur , and because the l - l distance ranged considerably : from 0.12 mm to 0.66 mm within the specimens . with an aggressive excavation technique exceeding 0.3 mm or even less per increment , any advantage from a more conservative ppg - based caries dye endpoint would often be negated . however , in some cases , careful excavation using this ppg - based dye could actually prevent exposure in deep lesions approaching the pulp . because carious lesions differ in type and amount of bacterial load , nutrient availability , and morphology and because dentin itself varies according location , age and reaction pattern , considerable variation would be expected in l - l distances among other specimen sets such as primary teeth , more chronic lesions , very active lesions , root lesions , and lesions associated with restorations . the results of this study should be interpreted with caution , especially for clinical application . since no difference was found in dd values for excavation surfaces created using pg - based versus ppg - based dyes in primary teeth in two previous studies , it may be that no l - l distance difference exists in primary teeth . for this reason , the present study needs to be repeated for primary teeth.8,17 other solvents or solvent mixtures as well as dyes other than sulforhodamine b may produce different results , and would also need to be tested . the fractured dentin surface used in the present study does not include a smear layer as would sometimes be produced clinically by burs or hand excavators , and may , therefore , indicate a more conservative endpoint since a smear layer might stain with dye , having originated from elsewhere in the preparation . therefore , the present study may represent a more idealized staining result compared to some clinical situations . the differences in the weighted averages between the control and experimental groups as well as the results on the anova on ranks analysis indicate that the present method is useful for differentiating staining endpoints between caries dyes . the method was able to detect a relatively small l - l distance , approximately four times the average error seen in the control group which itself was very small . in both groups , a specimen effect was detected by anova as would be expected for clinical specimens varying in lesion location , activity , size , etc . effect was detected in the control group and almost in the experimental group ( p=0.0510 ) , also expected due to lesser variations in measurement orientation versus dentin tubule orientation , for example . effect was not detected in either group , indicating an acceptable degree of consistency between runs . for future studies , errors might be reduced by more precise machining of the splitting groove and orientation notches , and by color - corrected thresholding of the stained specimen surface . in the present study , any light pink staining encountered on the dye - stained fracture surface was treated as non - stained , and therefore the dye - stain demarcation line was drawn shallow to the light pink staining , at the border of red and light pink staining . in previous studies using dd or mvh to detect endpoint differences in pg - based versus ppg - based caries dyes , the light pink staining in the pg group was sometimes kept in place and sometimes removed prior to surface testing.8,13,16,17 in the present study , had the dye - stain demarcation line been drawn at the border of non - stained and light pink - stained dentin , l - l distances would have been greater in some instances . further study is indicated to determine the tendency of ppg - based dyes to stain dentin light pink , and then to characterize those areas according to hardness , bacterial load , etc . there are no long - term clinical trials showing improved clinical outcomes for any dye - based excavation endpoints versus conventionally - determined endpoints , let alone for any one type of dye solution . in fact , clinical studies comparing outcomes for excavation methods in general are quite limited . in one clinical study of restorations in primary teeth , no differences were found at one year regarding marginal adaptation and secondary caries in the chemo - mechanical excavation group compared to the conventional hand excavation group.20 in another study of restorations in primary teeth followed for six months , no difference was detected in the survival rate of restorations in the chemo - mechanical excavation group compared to the conventional bur excavation group.21 factors such as restoration longevity , margin integrity , tooth structure integrity , pulpal health , and secondary caries are all relevant considerations . in this regard , ppg - based dye excavation should also be compared to other excavation methods such as chemo - mechanical , polymer bur , and fluorescence - aided excavation , in vitro and clinically.2224 until such studies are completed , the optimal endpoint for excavation of carious dentin will remain a matter of debate , based primarily on indirect evidence . under the experimental conditions and compared to pg - based sulforhodamine b caries dye solution , ppg - based dye solution provides a significantly shallower excavation endpoint by 0.298 mm ( 95% confidence interval 0.240 mm

objectivesthis study determined the difference in the location of the caries dye staining endpoint of 1% acid red dye in propylene glycol versus that of 1% acid red dye in polypropylene glycol.methodsfreshly extracted permanent molar crowns with primary occlusal carious lesions were chisel - split axially to expose the lesion in cross - section on both halves . one half was stained with propylene glycol - based dye and the other with polypropylene glycol - based dye . for the control group , both halves were stained with propylene glycol - based dye . the dye staining front was marked on digital images of the stained split surfaces , and the images were aligned using reference notches . the distance between the marked staining front lines was measured in five locations , and the measurement protocol was repeated . weighted averages and a 95% confidence interval for the distance between marked staining front lines were calculated for the control and experimental groups.resultsthe weighted average distance for the experimental group ( 0.298 mm , 95% confidence interval 0.240 mm 0.357 mm ) was about four times that of the control group ( 0.070 mm , 95% confidence interval 0.051 mm 0.089 mm ) . generally , the marked staining line for the polypropylene glycol - based dye specimens was located shallow ( occlusal ) to the propylene glycol - based staining line ( range 0.12 mm to 0.66 mm).conclusionsthe staining endpoint of 1% acid red dye in polypropylene glycol is shallower than that of 1% acid red dye in propylene glycol . the method is useful for comparing staining endpoints of caries dye formulations . ( eur j dent 2008;2:2936 )

INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION CONCLUSIONS

PMC4095931

weak acid ionization plays a central role in many chemical , biological , and industrial processes . measuring and predicting the free energy of this process ( i.e. , pka values ) have become important experimental and theoretical tools , enabling control over and insight into acid / base chemistry and ph - dependent biomolecular transformations . although a large number of theoretical methods have been developed to predict pka values ( see recent reviews ( 1 ) and ( 2 ) and references therein ) , less attention has been given to understanding the molecular - scale mechanism of acid dissociation . this is largely due to the complexity and cost of analyzing the full free energy surface , which involves not only a chemical reaction but also significant solvent and solute reorganization . instead , most pka methods rely on the use of thermodynamic cycles that break the complex process of deprotonation into computationally tractable steps . for small molecules , this cycle typically combines the gas phase dissociation energy , calculated with high - level quantum mechanical ( qm ) calculations , with de / solvation free energies of the reactant and product species , calculated with continuum solvent approaches . while the gas phase energies are quite accurate , the simple continuum description of solvation free energies often requires parameter adjustment to reproduce all of the entropic and enthalpic complexities that are inherent in molecular solvation . they have been improved by hybrid approaches that include some number of explicit water molecules in the solvation free energy analysis . in conjunction with methodological refinements , these qm - continuum solvent models have enabled pka calculations of small acids to within a few units of the experimentally determined values . in contrast , the suite of methods that have been developed to predict biological pka values have typically used a thermodynamic cycle in which the solute remains in a solvated environment . each has advantages and drawbacks as well , discussed in ref ( 2 ) , however none has yet demonstrated the ability to predict pka values within a few pka units of the experimental value for all test cases . it has been suggested that challenging moieties ( e.g. , buried residues that have large pka shifts or those with strong coupling to conformational changes or other titration sites ) will require methods that better capture the underlying physics . these conclusions highlight how interesting and nuanced a biomolecular system can be . while it is clear that protonation states influence everything from stability to binding and reactivity , the details of their influence is still sometimes poorly understood . few methods to date have simulated the actual process of interest , the exchange of an excess positive charge from an acid to bulk water . to do so involves calculating the free energy surface for proton dissociation in the bulk phase environment , from which one learns about the molecular mechanism and rate . this requires three things : ( 1 ) a method that describes the underlying physics of bond formation and cleavage in the bulk phase environment , ( 2 ) a method that is efficient enough that when combined with enhanced sampling approaches can capture the distribution of phase space that defines a free energy in the condensed phase ( where entropy and energy are often a similar magnitude ) , and ( 3 ) a reaction coordinate that is flexible enough to track the transferring excess charge defect . the first of these requirements is most obviously filled by qm approaches , which have been used in a handful of helpful studies to probe acid dissociation . parrinello molecular dynamics ( cpmd ) to calculate the free energy profile of histidine dissociation . although the chosen reaction coordinate limited their analysis to stopping just beyond the transition state , they were able to calculate the correct relative pka value by subtracting the equivalent profile for water autodissociation . similarly , park et al . used cpmd in combination with metadynamics to sample the configurational space of acetic acid in bulk water . while their trajectories were too short to sufficiently converge the free energy surface , they were able to observe and characterize multiple protonation and deprotonation events . these reactions occurred along a well - characterized pathway where the excess proton is briefly shared between the acid and solvating water . they also noted the existence of a shallow minimum in the free energy surface corresponding to the existence of a contact ion pair ( cip ) that is separated from the protonated state by a small energy barrier . in an alternative approach that still describes the bond dissociation at the ab initio level , uddin et al . recently used qm / mm to calculate the free energy surfaces for several small molecules . although they obtained quite accurate pka values , their method can not describe the mechanism of dissociation since they include only one water molecule and the acid in the qm region . hence , this method changes the physical process from the dissociation of a delocalized charge defect to proton transfer followed by separation of a localized hydronium cation and acid anion in a solvating mm environment . just as for thermodynamic cycles , their results show that sampling an alternative pathway between reactant and product states can yield accurate pka values for small molecules . another approach that describes the bond dissociation process is reactive md ( rmd ) . the efficiency of these models allows them to sample reactive dynamics on much longer length and time scales than ab initio md . since they are parametrized to work with mm force fields , they also avoid the boundary issues suffered by qm / mm calculations . both of these factors make rmd models ideal for simulating reactions in large , complex systems with slow dynamics . proteins and proton exchange membranes are two important examples of such systems . without sufficient sampling in these types of systems , the final result can be strongly influenced by the initial conditions . a common criticism of rmd models is that they are only approximations to the true quantum mechanical behavior of the system . while this is certainly true , if the functional form is both flexible enough and parametrized correctly , then the reactive model will retain the ability to accurately reproduce the potential and free energy surfaces from which it was parametrized . the multistate empirical valence bond ( ms - evb ) method is a rmd force field that has been used to characterize proton transport in many condensed phase and biological environments . it is especially well suited to the challenge of acid ionization since it inherently defines a center of excess charge that can be used to track reactions involving proton transport , thereby avoiding issues with geometric reaction coordinates . although ms - evb has been used to study weak acids and amino acid dissociation , these efforts involved a larger degree of empiricism since the pka value was needed to fit the msevb potential . it has been a long sought goal to find a procedure that would minimize the empiricism in rmd models , such that the bulk property of interest was derived entirely from quantum data in combination with extensive sampling . this work reports the achievement of that goal , a multiscale approach to calculate the free energy profile for acid ionization that is based entirely on qm data and yields an accurate absolute pka value . an iterative procedure , in the spirit of adaptive force matching , is used to sample the reactive phase space , obtain reference ab initio data ( qm / mm forces ) , and fit a rmd potential . care has been taken to modify the functional form such that it is sufficiently flexible to reproduce the qm / mm reference data and , in principle , capture the essential physics . our approach is applied to aspartic acid ( asp ) and to glutamic acid ( glu ) . both of these amino acids play crucial roles in proton and ion transport in biological channels and pumps and are also commonly involved in salt bridges that influence protein dynamics , structure , and binding . we show that accurate estimates of the pka values of both asp and glu are obtained from the resulting reactive models , which is the first time a reactive model has been able to accurately predict the correct pka without being explicitly parametrized to do so . finally , we discuss the mechanistic description our models provide of acid deprotonation in water . to emphasize that these models were fit entirely to qm / mm data and without adjustments to match the experimental pka , we will hereafter refer to them as multiscale reactive molecular dynamics ( ms - rmd ) models . it should be noted , however , that the ms - rmd asp and glu models are parametrized to work with a refined version of the ms - evb3 hydronium model that accurately describes a proton solvation and transport in water . ms - rmd is similar to the ms - evb framework that has been successfully used to model proton solvation and transport in many aqueous systems . the power in this approach lies in its ability to describe electronic delocalization as a linear combination of topologically distinct states . for a given configuration , for example , state |i could be a protonated amino acid in a box of water ( figure 1a ) . state |j would have the same coordinates but have a topology describing a cip between a solvated hydronium ion and a deprotonated amino acid ( figure 1b ) . at each step in the simulation , a state search algorithm first determines all the possible states based on geometric criteria and then calculates the energy of each state . the lowest energy state is termed the pivot state and is the start of the state search algorithm at the next step . since the number of waters , and therefore the number of possible states , grows exponentially with distance from the pivot state , only states in the first three solvation shells several different bonding topologies are shown for a given set of nuclear coordinates , r. dashed lines surround the protonated molecule , as defined by the bonding topology . the reactive system is described by the following hamiltonian:1where r is the vector describing the nuclear coordinates , hij is the sum of mm potential terms for state i , and hij is the coupling between states |i and |j. the details of these terms will be provided in the force field section . with the hamiltonian defined this way , the relative weight of each state is described by the components of the eigenvector , ci:2finally , forces are calculated using the hellmann feynman theorem . these forces are then passed to a standard md integrator such as velocity verlet . free energy calculations require a continuously varying reaction coordinate ( rc ) to describe the process of interest . the evb formalism provides a convenient reference for the rc ; the center of the excess charge ( cec):3 in this equation , ri is the geometric center - of - charge for the protonated molecule in state i , and ci is the relative weight of that state . we then use the distance between the cec and the center of mass of the asp or glu carboxyl group to describe the progress of the deprotonation reaction . the diagonal elements of the ms - rmd hamiltonian matrix are derived from the standard charmm mm force field . the protonated form uses all of the standard parameters with the exception of the acidic o h bond . this bond is replaced with a morse potential to allow dissociation:4where r is the bond length and d , , and r0 are parameters fit to reproduce the bond length and frequency of the harmonic potential it replaces while still allowing for a reasonable bond dissociation energy . the deprotonated form of amino acid uses all of the standard charmm bonded and nonbonded terms and parameters . since the charmm force field was not originally intended for use in reactive simulations , additional repulsive terms are used between the carboxyl oxygens of the deprotonated model and the hydronium oxygen and hydrogens . these terms help to correct for the overattraction at close distances due to the use of point charges . the functional forms for the repulsions are the same as those used in the ms - evb3 hydronium model:56where b , b , b , c , and c are fitted parameters . following the logic in previous work , and to avoid parameter redundancy , doo and doh were fixed the same values used in ms - evb3 . the sum of gaussians term in eq 5 is included to help the fitted potential to reproduce the correct asymmetric solvation structure around the hydronium , and the same switching function is used as given in eq 9 of ref ( 28 ) . the asp and glu models are designed to work with a refined version of the ms - evb3 force field , herein referred to as msevb 3.1 . this refinement uses the same functional forms for the hamiltonian but revised parameters . using a genetic algorithm , the fitting parameters were optimized using the original ab initio data sets as well as potential energy surface scans for the eigen ion at the same level of the original ab initio calculations . furthermore , the oxygen partial charge of the hydronium is an adjustable parameter ( the charge for the hydrogens is automatically determined to maintain the hydronium + 1 total charge ) . parameters for this force field are presented in the supporting information . in this study , the limiting species are the de / protonated asp or glu models and the ms - evb 3.1 solvated proton in spc - fw water . the ms - rmd force field is parametrized to smoothly switch from one protonated species to another . the asymmetry of the reaction necessitates several modifications to the original ms - evb equations , which were designed with water in mind . the off diagonal coupling term , hij , is designed to reproduce the correct transition state geometry . previous ms - evb models used a complex off - diagonal term to describe a symmetric reaction pathway between two waters . however , the asymmetry of the asp - water system was better fit by a simple gaussian potential:7where roh is the distance between the deprotonated asp oxygen and the excess proton . the other parameters determine the shape and size of the gaussian and are fit to the qm / mm data . in practice , protonation reactions occurring between different species require a constant energy term ( vii ) to be added to the deprotonated state . this term accounts for the difference in energy resulting from different mm force fields . without it , the protonated and deprotonated asp potential energy surfaces would be offset by hundreds of kilocalories per mole , and no reaction would ever take place . this difference is due primarily to electrostatics and can be estimated by subtracting the coulomb energy of the most favorable hydronium state ( containing the favorable electrostatic interactions between the hydronium cation and amino acid anion ) from the coulomb energy of the protonated ( and neutral ) amino acid state . figure 2 shows a plot of the average value of this term as a function of rc . since vii controls the relative stability of the protonated and deprotonated states , it was used in past work to tune the behavior of the model to reproduce experimental quantities such as pka . in the current work , an iterative fitting approach is used to rigorously determine the value of vii along with all other ms - rmd parameters . plot of the difference in coulomb energy between the protonated asp state and the lowest energy non - asp state . at short distances , it is similar in some ways to that used in previous work in which ms - rmd models were force matched from aimd data . there are , however , a few important differences , including the use of qm / mm instead of aimd , the use of empirical functional forms instead of tabulated potentials , and the use of an iterative scheme for sampling configuration space starting from a guessed hamiltonian . these choices were partially motivated by the success that has been demonstrated with the adaptive force matching method by wang and co - workers . reactive hamiltonian in order to generate a set of configurations along the reactive pathway . next , high - level qm / mm calculations are performed to collect the atomic forces for those configurations . the new reactive hamiltonian is then used to generate new configurations via umbrella sampling , and the process is repeated until the parameters reach the desired convergence . details of each step are discussed in the text . due to the nonlinearity of several of the reactive force field parameters , the reactive model is fit to the qm / mm reference data using a genetic algorithm to minimize the residual:8here , nc and na are the number of configurations and the number of atoms in each configuration , respectively . w(rij ) is the weight for each atom that , unless specified otherwise , is set to 1 . fij is the atomic force from the current ms - rmd parameter set and fijqm / mm is the reference force from the qm / mm calculation . the fitting calculations were run in parallel and used 4000 genomes ( parameter sets ) per generation . to lessen the danger of overfitting the first step followed the uniformly distributed mutation scheme outlined in section 3.1 of ref ( 40 ) . the range of parameters was chosen to be as broad as possible without allowing unreasonable values . for example , c3 in the off - diagonal term would be unreasonable if it were greater than the aspo once a converged parameter set was reached with the uniform distribution , the mutation scheme was switched to the normally distributed scheme described in section 3.2 of ref ( 40 ) . this scheme is very good at quickly finding a local minimum and was therefore used to find the best genome in the vicinity of the result from the first step . since the second scheme is easily trapped in local minima , it was not ideal for use on its own . the combination described here was found to quickly and reliably converge on the optimum solution . the discrete recombination scheme described in section 2.2 of ref ( 40 ) is used with both mutation schemes . the nature of the reactive model introduces additional complexity into this otherwise simple scheme . vii , which directly controls the depth of the protonated well relative to the deprotonated cip , is a constant that is only included for states in which the amino acid is protonated . the off - diagonal term acts over a broader range spanning the protonated amino acid and cip configurations but also has a negligible effect once the cip dissociates . in contrast , the repulsive terms , which are only applied to the deprotonated amino acid , are significant at longer distances and negligible at distances below the transition state . furthermore , since both vii and the repulsive terms are added to the diagonal matrix elements , they tend to have correlated behavior if fit simultaneously . thus , the value of vii for the first iteration after generating new qm / mm data is chosen to be the average value described in figure 2 . this value has been found to be within a few kilocalories per mole of the final value of vii and is therefore a good initial approximation . holding the value of vii fixed , the off - diagonal and repulsive terms can be fit to the full set of qm / mm reference forces . once the off - diagonal and repulsive terms reach their optimum value for the current value of vii , umbrella sampling is used to generate a pmf with the model . since vii s effect is most important at and around the transition state , a range of rc values immediately surrounding the transition state is chosen from the pmf , and configurations from that range are then used to fit a new value of vii . using this new value of vii , the off - diagonal and repulsive terms are refit while vii is again held constant . this procedure fits an empirical model from solely qm / mm data and results in models that correctly predict the bulk phase pka values for both asp and glu . solution simulations of asp and glu include one solute molecule solvated by 486 and 467 waters , respectively . to reduce interactions with the charged backbone protonatable sites , the n - termini were capped with an acetyl group and the c - termini were capped with methylamine . the systems were equilibrated in the npt ensemble at 1 atm and 310 k for 200 ps before changing to the nvt ensemble with a cubic box of 24.55486 on a side for asp and 24.24938 for glu . all reactive simulations were run with a modified version of the lammps simulation package . the rc was chosen to be the distance between the cec and the center - of - mass of the amino acid s side chain carboxylic acid . umbrella sampling was used to evenly sample the rc . for the asp system , 25 windows were spaced every 0.36 starting at a rc value of 1.0 . the glu system used 36 windows spaced every 0.25 with 20.0 kcal / mol restraints . each production window was further equilibrated for 100 ps , and then statistics were collected for 1.7 ns . the pka is calculated from the resulting pmf using the following equation:9where w(r ) is the free energy from the pmf and is the product of the simulation temperature and the boltzmann constant . the integral is calculated from zero to the transition state , as denoted by . c is the standard state concentration whose value is 1660 / molecule and results from the entropic freedom that is gained by the proton when it dissociates from the acid . atomistic configurations for the qm / mm calculations were selected from the umbrella sampling trajectories . in order to ensure a uniform distribution along the rc , individual configurations were sorted by their rc value into 60 0.067 wide bins . five configurations were then selected at random from each bin , giving a total of 300 configurations for each iteration . qm / mm was performed in cp2k using b3lyp with the double - zeta basis set . unrestricted dft was used to allow the most accurate calculation of forces near the dissociation barrier . b3lyp was chosen over mp2 because recent studies have shown comparable accuracy with a reduced computational cost for water and the solvated excess proton . calculations were run on 256 intel sandy bridge cores and on average completed within 10 min . the qm region included the entire amino acid residue and all of the waters found by the ms - rmd state search . because proximity to classical point charges reduces the accuracy of forces calculated on qm atoms , an additional 3 buffer layer of qm water was added around the qm atoms . all together , this results in a qm region containing an average of 208 atoms , or one asp / glu and 61 waters . in total , four iterations were needed for asp parameters to converge , while glu parameters converged in three iterations . parameters for the new asp and glu models are presented in table 1 . these parameters were fit to qm / mm reference forces using the previously described iterative scheme to ensure convergence . it must be noted that the asp and glu models were parametrized using the same method , but entirely independent data sets . the fact that the final parameters for each model are so similar is not surprising , however , given the molecular similarity and small difference in experimental pka values . as the next section discusses , the pka predicted by each model is a very good estimate of the experimental value . the fact that the models are able to capture such subtle differences is evidence that the methodology works well . the potential of mean force ( pmf ) of deprotonation describes the free energy of the process as a function of the rc . to obtain a free energy change between any two points on the pmf , one simply integrates the pmf . figure 4a shows the pmf for deprotonation of asp , and figure 4b shows the pmf for glu ( black lines ) . as depicted in figure 5 , the rc gives the distance between the center - of - mass of the carboxylic moiety and the cec . rc values around 1.3 correspond to the protonated amino acid , while values between 2.1 and 5 correspond to the stable cip . values above 5.5 represent an excess proton separated from the anionic acid by bulk solvent . pmfs and cmax distributions from the final ( a ) asp and ( b ) glu models . the colormap in the background gives the cmax probability distribution normalized for each rc value . this distribution describes the extent of charge delocalization and , by extension , the solvation structure . snapshots from umbrella sampling trajectories illustrating the types of structures suggested by the cmax distributions and the 2d - rdfs . arrows indicate the region of the pmf where the windows were run , while the distances in the box are the center of the harmonic restraint . the position of the cec is shown as a yellow sphere . in eigen structures , the cec is nearly aligned with the central water s oxygen . in zundel structures , the protonated forms of asp and glu are much more stable than the deprotonated forms , which is consistent with their status as weak acids . evaluating the integral in eq 9 estimates the pka values for asp and glu to be 3.82 0.17 and 4.56 0.18 , respectively . these are both in very good agreement with the experimental ranges of 3.71 to 3.90 for asp and 4.15 to 4.31 for glu . the barrier that prevents protonation is due to the cost of forming a zundel - like arrangement between the acid and hydronium . the depth and extent of the cip varies with the system ; however its existence has been predicted in a variety of weak acid systems simulated with different methods . when preparing a simulation to calculate a pmf of deprotonation and a pka , care must be taken to ensure that the rc is sampled far enough beyond the cip to ensure bulk - like properties . if this is not done , then the pmf from which the pka is calculated will be shifted and the resulting pka will neither be accurate nor reflect the quality of the model . fortunately , sampling well beyond the cip is not a problem with ms - rmd models due to their efficiency . however , care needs to be taken when running qm / mm simulations to ensure that a large enough qm box and enough solvating waters are used to not only sample beyond the cip but also to avoid boundary issues . with the pmf in hand , one the ms - rmd methodology conveniently provides a measure of the structure of the solvated complex . it has been shown that the square of the largest component of the ground state eigenvector ( cmax , from c in eq 3 ) describes the solvated structure . a value of 1 indicates the limiting case of an entirely localized excess charge , while values less than that quantify the degree of charge delocalization . eigen structures , where the excess charge is shared among a central hydronium and three h - bound water molecules , have a cmax value around 0.65 . zundel structures , which share the excess charge more equally between two water molecules , have a cmax value closer to 0.5 . it should be emphasized that there is always additional delocalization to other surrounding water molecules , even for these limiting eigen- and zundel - like cations . by plotting the cmax probability density as a function of the rc , we gain insight into the structural changes that accompany deprotonation . this probability density is plotted as a colormap in figure 4 . at low rc values , both asp and glu have an average cmax greater than 0.9 , which indicates that the structure and dynamics mostly resemble the limiting case of a protonated acid in bulk water with little charge transfer to the surrounding water molecules . this is notably different than the protonated water molecule , which always involves a significant amount of charge delocalization . as the proton begins to dissociate , the cmax decreases as the proton goes through a clear zundel - like transition between the acid and solvating water . beyond the transition state , the system begins to resemble an eigen cation where one of the solvating waters is replaced with the acid anion . however , the eigen structure seen in the cip is distinctly different from that seen in bulk water , as evidenced by a cmax of 0.73 . the close proximity of the anionic acid helps to stabilize the hydronium , leading to a more localized charge . further evidence of the uniqueness of the cip is that there is a well - defined zundel transition around 4 linking the cip to the bulk - like structure at longer distances . eigen transitions in bulk , the water around the anionic amino acid is more structured , as evident in the distinct zundel - like transition at a rc value around 4 . figure 5 shows snapshots of the typical structures found at different rc values and characteristic of significant regions in the pmf . the bonding topology reflects o h distances less than or equal to 1.6 , which is commonly considered to be the length of a hydrogen bond . it is also interesting to look at the structural changes that occur directly around the cec . to do so , the two - dimensional radial distribution functions ( 2d - rdfs ) between the cec and surrounding water oxygens ( ow ) and water hydrogens ( hw ) are shown in figure 6 . a slice along the first dimension of the 2d - rdfs gives a traditional 1d - rdf , which describes the probability of finding the indicated pair a given distance apart . scanning the second dimension shows how the solvation structure changes as the reaction progresses according to the rc . in combination with the cmax analysis , the 2d - rdfs show that the solvent has well - defined rearrangements as the proton dissociates from asp and travels to bulk . figure 6a shows the 2d - rdf for asp s cec ow distance . once asp is deprotonated , the first peak is near 2.5 , which is characteristic of the eigen structure . when the rc reaches 4 , the peak distance drops to around 1.5 , which is characteristic of a slightly asymmetric zundel cation where the cec resides close to the midpoint of the o o vector . the 2d - rdf showing asp s cec 2d - rdfs for ( a ) cec ow and ( b ) cec hw with asp . these plots show how the water structure changes around the cec as deprotonation occurs . 2d - rdfs for ( a ) cec ow and ( b ) cec hw with glu . we have presented a procedure for fitting the parameters of a ms - rmd model to reproduce the forces from qm / mm calculations . due to the efficiency of ms - rmd , we are able to collect and analyze data from large time and length scales that can reveal intricate behavior and is essential for converged bulk phase thermodynamic properties . this new methodology was used to parametrize new models of both asp and glu that correctly predict the correct experimental pka values . this is the first time that a ms - rmd model has been able to reproduce the experimental pka values without any fitting to experimental data . multi - nanosecond trajectories were analyzed to extract important information about the mechanism underlying the deprotonation process . it is shown that the deprotonation process follows a well - defined series of zundel to eigen transitions as the excess proton travels from asp to bulk solution . this work is considered continued progress toward the goal of having flexible and systematic algorithms to reliably make a multiscale connection between accurate electronic structure calculations and efficient empirical models to describe complex reactive processes . as more accurate ab initio methodologies ( e.g. , those explicitly accounting for electronic correlation ) become computationally tractable for qm / mm of condensed phase systems , the procedure presented herein and related force matching algorithms will be invaluable tools for mapping high level data into efficient rmd models that can significantly extend the time and length scales of reactive simulations to explore complex phenomena . while the results presented herein are important , the true test of this procedure will be to apply it in biological systems where the pka of individual residues can be shifted by several pka units . proton transport in proteins is very sensitive to the underlying protonatable residue models , and it is therefore crucial to have a procedure to ensure that those models are physically accurate . furthermore , biological systems are orders of magnitude larger and have much slower dynamics than the systems presented here . while it is conceivable that qm / mm md simulations could reach the same sort of time scales as the solution simulations presented here , they would be prohibitively expensive to run the length - and time - scales needed to account for the slow dynamics commonly found in biological processes . the ms - rmd methodology has already been shown to scale well to hundreds of thousands of atoms and can realistically reach tens of nanosecond simulations with large explicit biomembrane systems . work is already underway to implement these reactive models in protein environments and to use the presented methodology to fine - tune these and other individual amino acid models to behave properly in their specific protein environments .

accurately calculating a weak acid s pka from simulations remains a challenging task . we report a multiscale theoretical approach to calculate the free energy profile for acid ionization , resulting in accurate absolute pka values in addition to insights into the underlying mechanism . importantly , our approach minimizes empiricism by mapping electronic structure data ( qm / mm forces ) into a reactive molecular dynamics model capable of extensive sampling . consequently , the bulk property of interest ( the absolute pka ) is the natural consequence of the model , not a parameter used to fit it . this approach is applied to create reactive models of aspartic and glutamic acids . we show that these models predict the correct pka values and provide ample statistics to probe the molecular mechanism of dissociation . this analysis shows changes in the solvation structure and zundel - dominated transitions between the protonated acid , contact ion pair , and bulk solvated excess proton .

Introduction Methodology Results and Discussion Conclusion

PMC5435650

surgery was performed on 12 patients from among 239 patients who were diagnosed with ps using our inclusion / exclusion criteria ( table 1 ) . of these surgery was indicated when pain ( buttock pain or mainly sciatica ) was not relieved by conservative measures , including education for habitual position or physical activity change , medication , physical therapy , local steroid injections on the piriformis muscle , or extracorporeal shock wave therapy ( eswt ) for at least 3 months . twelve patients underwent surgery for ps and the average age of the patients ( 4 males and 8 females ) who underwent surgery was 61 years ( range , 45 to 71 years ) . the average duration of the symptoms before surgery was 22.1 months ( range , 4 to 72 months ) , and the mean follow - up period was 22.7 months ( range , 12 to 43 months ) . of the 12 patients who had piriformis muscle resection with / without neurolysis , 8 had underlying pathologies including spinal stenosis ; 5 had been managed by spinal block and 3 had undergone lumbar spinal surgery , but their symptoms had not been relieved . three patients had a long - time , occupation - related , habitual sitting position , and 1 patient had a history of sacral fracture . we evaluated buttock pain with / without sciatica using a visual analog scale ( vas ; 0 , no pain ; 10 , maximum pain ) and recorded the responses preoperatively , and at 3 days and 12 months postoperatively . kruskal - wallis and mann - whitney u - tests were used for post hoc analysis to compare changes in vas for pain over time . the gluteus maximus was divided in the direction of its fibers by blunt dissection , and the fascia lata was incised in continuity where it overlaid the trochanter ; we then removed the trochanteric bursa . the piriformis muscle was inserted into the posterior aspect of the greater trochanter as tendinous nature and was located above the obturator internus tendon ( fig . the sciatic nerve was explored and found to pass anteriorly to the piriformis muscle in all cases . additionally , we divided the tight piriformis tendon at the insertion site at its tendinous portion . the proximal portion of the muscle was retracted when the leg was internally rotated after its division . neurolysis around the sciatic nerve into the sciatic notch was performed in two cases of a severely adherent sciatic nerve . severely dilated and engorged epineurial vessels were found in two cases with intractable sciatica ( fig . after surgery , patient activity with the assistance of a cane was encouraged to relieve pain from the gluteal muscle repair . the diagnostic procedure involved a detailed physical examination , including a palpation test for tenderness over the origin ( sacroiliac joint ) or insertion of the short external rotators behind the trochanter ( fig . the clinical examination also included several provocation tests for pain and weakness on resisted abduction and external rotation of the thigh in a sitting position ( pace test ) , pain on forced passive internal rotation of the extended thigh ( freiberg 's test ) , and buttock and leg pain during passive straight leg raising ( lasgue 's sign ) . in addition to electromyography , various imaging studies including ct , mri , and ultrasonography were performed , and a steroid injection into the piriformis muscle was carried out for diagnostic treatment . to exclude sciatica caused by spinal problems , repeated patients who had greater than 50% relief of symptoms of sciatica after caudal block were excluded from having a diagnosis of ps . asymmetry of the piriformis muscle on ct or mri was considered a positive finding of ps . an electromyographic finding of radiculopathy was attributed to spinal root compression , not to ps ( fig . the gluteus maximus was divided in the direction of its fibers by blunt dissection , and the fascia lata was incised in continuity where it overlaid the trochanter ; we then removed the trochanteric bursa . the piriformis muscle was inserted into the posterior aspect of the greater trochanter as tendinous nature and was located above the obturator internus tendon ( fig . the sciatic nerve was explored and found to pass anteriorly to the piriformis muscle in all cases . additionally , we divided the tight piriformis tendon at the insertion site at its tendinous portion . the proximal portion of the muscle was retracted when the leg was internally rotated after its division . neurolysis around the sciatic nerve into the sciatic notch was performed in two cases of a severely adherent sciatic nerve . severely dilated and engorged epineurial vessels were found in two cases with intractable sciatica ( fig . after surgery , patient activity with the assistance of a cane was encouraged to relieve pain from the gluteal muscle repair . the diagnostic procedure involved a detailed physical examination , including a palpation test for tenderness over the origin ( sacroiliac joint ) or insertion of the short external rotators behind the trochanter ( fig . the clinical examination also included several provocation tests for pain and weakness on resisted abduction and external rotation of the thigh in a sitting position ( pace test ) , pain on forced passive internal rotation of the extended thigh ( freiberg 's test ) , and buttock and leg pain during passive straight leg raising ( lasgue 's sign ) . in addition to electromyography , various imaging studies including ct , mri , and ultrasonography were performed , and a steroid injection into the piriformis muscle was carried out for diagnostic treatment . to exclude sciatica caused by spinal problems , repeated patients who had greater than 50% relief of symptoms of sciatica after caudal block were excluded from having a diagnosis of ps . asymmetry of the piriformis muscle on ct or mri was considered a positive finding of ps . an electromyographic finding of radiculopathy was attributed to spinal root compression , not to ps ( fig . for the diagnosis of ps , physical examinations , including several provocative tests , radiographic studies , such as plain x - ray , ct or mri , emg , or an injection were performed . when a diagnosis of ps was suspected , various conservative treatments were initially performed in all patients and generally provided good results ( table 2 ) . of the 239 patients , 12 patients who were refractory to conservative treatment underwent surgical treatment.table 3 summarizes the clinical features and the results of surgical treatment . on physical examination , tenderness in the gluteal area , particularly on the iliac side of the sacroiliac joint , was detected in 10 patients ( 83% ) . pain provocative tests such as the freiberg 's and pace tests were positive in 7 patients ( 58% ) . electrodiagnostic testing showed no specific findings ( delayed h - reflex at the flexion adduction internal rotation position ) suggesting ps as opposed to other pathologies , such as lumbosacral radiculopathy , sciatic nerve palsy , or posterior cutaneous neuropathy of the thigh . asymmetry of the piriformis muscle or hyperintensity around the sciatic nerve on ct and mri was detected in only 5 patients ( 42% ) ( fig . three patients had occupations that involved sitting for a long duration , such as sewing or driving . of the 12 patients undergoing surgical resection of the piriformis muscle , neurolysis was performed in 2 patients due to a severely adherent or scarred sciatic nerve . engorged epineurial vessels around the sciatic nerve shrank spontaneously after resection of the piriformis muscle . the average length of the skin incision was 9.5 cm , and the average amount of postoperative bleeding was 24.5 ml . there were no postoperative complications including hematoma , infection , delayed wound healing , scar formation , and myositis ossificans . the average duration of hospitalization was 5.3 days ( range , 3 to 9 days ) . compared with preoperatively ( mean vas score , 9 ) , the vas scores significantly decreased both immediately after surgery ( mean vas score , 4 ) and at the 12-month follow - up ( mean vas score , 3.1 ) ( table 4 ) . persistent buttock pain after surgery was present in 3 patients . among them , 1 patient had symptom relief after 12 months . the diagnosis of ps is mostly elusive and remains controversial due to the lack of consistent objective diagnostic criteria . the differential diagnoses should include herniation of the nucleus pulposus ( hnp ) , myofascial pain , sacroiliitis , trochanteric bursitis , or any other sciatic nerve - impinging conditions . in this study , the diagnosis of ps could be established with the patient 's history , a careful physical examination , and a local injection of the piriformis muscle when no other etiological findings were identified on emg or imaging studies , including ct and mri ( fig . because lumbosacral hnp or spinal stenosis commonly occurs at the l4 - 5 or l5-s1 intervertebral space , it is important to determine whether the pain originates from the root or peripheral nerve.10 ) in patients with ps , symptoms of neurological claudication are rare , while pain aggravation by a position change or prolonged sitting is frequently observed in them . specific sensory changes in dermatomes or muscle weakness can help to exclude ps . based on our cases , we suggest that the three cardinal symptoms of ps are buttock pain , radiating pain to the posterior thigh above the knee , and pain aggravated by position changes or prolonged sitting . the piriformis muscle can be firm and hard to palpation from the greater sciatic notch to the posterior aspect of the greater trochanter . in physical examination , tenderness of the piriformis muscle ( 83% ) is the most consistent finding . although emg is often normal in patients with ps , continuous compression may result in abnormal spontaneous activity of the muscles innervated by the sciatic nerve , including a delay in the h - reflex with the affected leg in a flexed , adducted , and internally rotated position.11 ) in our study , electrodiagnostic testing was not helpful for the diagnosis of ps but useful in ruling out other causes with similar symptoms , such as lumbosacral radiculopathy . diagnostic imaging modalities , including ct , mri , and mrn , have been used in many studies to diagnose ps.12131415 ) however , these studies are limited to cases showing atypical anatomy , including asymmetry of the piriformis muscle or hyperintensity of the sciatic nerve ; these conditions accounted for only 5 of the 12 surgical patients ( 42% ) in our study . sayson et al.16 ) and barton17 ) found that preoperative mri failed to identify atypical anatomy that was found intraoperatively . mrn is a relatively new technique that was developed specifically to enhance the imaging of nerves . filler et al.1 ) used mrn to prospectively investigate 87 patients with sciatica - like pain in whom either standard testing had failed to yield a diagnosis or who had failed lumbar disc surgery ; 67% of this group was diagnosed with ps . however , tiel18 ) pointed out methodological and technical problems of mrn . some reports have suggested diagnostic criteria for ps.1920 ) recently , michel et al.21 ) proposed to use a clinical scoring system : ps can be considered probable with a score of 8 or more out of 12 points . however , it includes negative findings for spinal disease , such as no lower back pain , painless axial spinal palpation , negative lasgue 's maneuver , or absence of perineal irritation ( 4 points ) . a scoring system including negative findings for spinal problems can result in overdiagnosis of ps . in addition , the scoring system involves obscure physical tests that provoke buttock pain or sciatica by stretching or resisted contraction , and it does not include some diagnostic tests , such as local steroid injection , which is a widely used tool for establishing the diagnosis . they are comprised of 5 items : buttock pain with / without sciatica during prolonged sitting ; tenderness of the piriformis muscle ; positive provocative tests ; positive findings on ct or mri ; and pain relief with a local injection . additionally , caudal or epidural block was tried at least once before surgery in our study . we suggest to exclude a diagnosis of ps with any of the following findings : symptoms of neurologic claudication ; positive lasgue 's or straight leg raise test ; sensory changes on nerve root innervation ; radiculopathy on emg ; or an effective caudal or epidural block . the sciatic nerve compression by the piriformis muscle or surrounding fibrous bands is different from the nerve root compression of spinal origin . absent clinical findings due to nerve root compression is important in the diagnosis of ps . initial nonoperative treatment of ps includes medications ( nonsteroidal anti - inflammatory drugs , muscle relaxants , and other medications effective in neuropathic pain , such as pregabalin or gabapentin ) , physiotherapy , eswt , injections of local anesthetics and corticosteroids , and the more recently investigated option of botulinum neurotoxin injections.8 ) in our study , eswt was applied in patients with buttock pain more than twice with an interval of 1 week until pain subsides significantly . eswt was undertaken with 2,000 pulses each time at 1 week interval totaling 4,000 to 6,000 pulses . our clinical results demonstrated that the most effective modality in treatment of ps for reducing buttock pain was eswt . we had satisfactory clinical results after release of the piriformis muscle and neurolysis of sciatic nerve in patients with refractory sciatica that fail to respond successfully to conservative treatments . intraoperatively , identification of the piriformis muscle among short external rotator muscles and posterior retraction after complete resection of the muscle are important . careful dissection of fibrous tissues around the sciatic nerve is also essential to avoid damaging the nerve proper or the dilated vaso nervorum . deep gluteal syndrome ( dgs ) is a disease entity that is characterized by pain or dysesthesia in the buttock area , hip , or posterior thigh and/or radicular pain due to a nondiscogenic sciatic nerve entrapment in the subgluteal space.22 ) its main pathology is fibrous bands around the sciatic nerve formed by various pathological conditions , such as piriformis syndrome , obturator internus / gemellus syndrome , or ischiofemoral impingement . the causes of dgs include traumatic , iatrogenic , inflammatory / infectious , vascular , and gynecological processes , and tumors / pseudotumors . therefore , the treatment of dgs is decompression of the sciatic nerve via open or endoscopic surgery . it is not clear whether resection of the piriformis muscle has additional benefits over decompression of the sciatic nerve in ps . however , the recurrence of sciatic nerve adhesions can be avoided when the muscle is resected.1 ) endoscopic surgery for adhesiolysis of the sciatic nerve has several advantages over open methods , including less invasiveness and less postoperative pain.23 ) however , endoscopic sciatic nerve release is technically demanding and has limited efficacy for release of a severely adherent sciatic nerve . considering that no prospective , randomized trial has evaluated surgical treatment outcomes of ps , the important finding of our study was the significant decrease in symptoms after surgery . to achieve good results , the indications for surgery ( no response to physical therapy and at least one injection ) should be determined upon proper diagnosis ( based exclusively on clinical and spine evaluations ) . surgery is an important treatment option for unresolved ps because of its low morbidity and simplicity . to overcome the limitations of our work , a prospective study with a greater number of cases and a longer follow - up period should be performed to establish the gold standard methods for the diagnosis and treatment of ps ; furthermore , several modalities for diagnosis of ps should be developed . in conclusions , the diagnosis of ps is obscure and elusive , but a systematic approach is helpful . if a diagnosis is determined correctly , surgical treatment can be a good option in patients with refractory pain , particularly sciatica , despite application of appropriate conservative treatment modalities .

backgroundpiriformis syndrome ( ps ) is an uncommon disease characterized by symptoms resulting from compression / irritation of the sciatic nerve by the piriformis muscle . uncertainty and controversy remain regarding the proper diagnosis and most effective form of treatment for ps . this study analyzes the diagnostic methods and efficacy of conservative and surgical treatments for ps.methodsfrom march 2006 to february 2013 , we retrospectively reviewed 239 patients who were diagnosed with ps and screened them for eligibility according to our inclusion / exclusion criteria . all patients underwent various conservative treatments initially including activity modification , medications , physical therapy , local steroid injections into the piriformis muscle , and extracorporeal shock wave therapy for at least 3 months . we resected the piriformis muscle with / without neurolysis of the sciatic nerve in 12 patients who had intractable sciatica despite conservative treatment at least for 3 months . the average age of the patients ( 4 males and 8 females ) was 61 years ( range , 45 to 71 years ) . the average duration of symptoms before surgery was 22.1 months ( range , 4 to 72 months ) , and the mean follow - up period was 22.7 months ( range , 12 to 43 months ) . we evaluated the degree of pain and recorded the responses using a visual analog scale ( vas ) preoperatively and 3 days and 12 months postoperatively.resultsbuttock pain was more improved than sciatica with various conservative treatments . compared with preoperatively , the vas score was significantly decreased after the operation . overall , satisfactory results were obtained in 10 patients ( 83% ) after surgery.conclusionsps is thought to be an exclusively clinical diagnosis , and if the diagnosis is performed correctly , surgery can be a good treatment option in patients with refractory sciatica despite appropriate conservative treatments .

METHODS Surgical Approach Clinical Evaluation RESULTS DISCUSSION

PMC4622027

a two - day - old male with whole body cyanosis and tachypnea born at 38 + 2 weeks of gestation with a birth weight of 4,000 g was referred to samsung medical center . his percutaneous oxygen saturation was 60% to 70% , and there was no response to oxygen supply . a grade 3/6 systolic murmur was heard at the left sternal border , and the vital signs were a blood pressure of 70/40 , heart rate of 165 beats per minutes , respiratory rate of 42 breaths per minute , and temperature of 37.2c . echocardiographic findings demonstrated a complete transposition of the great arteries ( tga ) , large peri - membranous ventricular septal defect ( vsd ) , mild pulmonary stenosis ( ps ) with a peak pressure gradient of 23 to 32 mmhg , and a small patent ductus arteriosus ( pda ) . additionally , there was subpulmonic deviation of the outlet septum with a small asymmetric pulmonary valve ( pv ) with fusion . the pv size was 5.86.1 mm ( z - score < 2.5 ) ( fig . after the procedure , the respiration rate stabilized and the percutaneous oxygen saturation was 80% under ambient conditions . the patient was relatively well until five months of age when he started to become increasingly short of breath . eventually , he was admitted for operation , with a body weight of 7.4 kg , and underwent pulmonary root translocation with the lecompte maneuver . after median sternotomy , an inverted y - shaped pericardiostomy was performed . because in situ material was used for the right ventricular outflow tract ( rvot ) reconstruction , the pericardium was not harvested . after pda division , antegrade cold blood cardioplegia was infused through the aortic root cannulation . then , the pulmonary artery and its branches were extensively dissected , from the distal attachments into both pulmonary hila , to be mobilized anterior to right ventriculotomy . the coronary artery pattern was [ 1 ad ; 2 r , cx ] . because of the prominent left anterior descending ( lad ) coronary artery , we planned a lecompte maneuver . without this maneuver , after transection of the proximal ascending aorta , the pulmonary artery root was excised below the pv annulus from the left ventricle ( lv ) ( figs . 2a , 3a ) . the main pulmonary artery was moved anteriorly with the lecompte maneuver . 3b ) , the vsd position was confirmed via the right atrium and right ventriculotomy . a portion of the right ventricular muscle was resected at the conal septum to relieve the lv exit to the aorta . then , the defect in the pulmonary root was closed with a bovine pericardial patch and 6.0 polypropylene running suture . after an end - to - end anastomosis of the transected aorta , the vsd was closed with a bovine pericardial patch and 6.0 polypropylene running suture to create the lv - to - aorta tunnel ( fig . . formation of lv tunneling with this patch during the lv tunneling , we tried to make the patch straightened for the preservation of rv volume . the pv was a functional bicuspid valve with fusion , and the pv annulus size which was measured intraoperatively using hegar dilator was 9 mm . appropriate pv annulus size according to the patient s body surface area ( z - score ) was 10.5 mm , so we performed commissurotomy . the rvot was reconstructed with an excised pulmonary artery root and an in situ autologous pericardial patch that had growth potential on the anterior side ( figs . after the operation , the patient was extubated on the 3rd post - operative day and discharged with no early post - operative complications on the 8th postoperative day . echocardiographic findings 7 days after the operation showed minimal ps ( mean pg=13 mmhg ) with a pv size of 6.8 mm ( z - score < 2.5 ) , and those 6 months after the operation showed mild ps ( mean pg=22 mmhg ) with a mature pv size of 15.8 mm ( z - score=+1.70 ) ( fig . residual arterial septal defect , vsd , or insufficiency of the left ventricular outflow tract were not exhibited . at this time the patient is doing well 9 months postoperatively and has a new york heart association grade of class i. the rastelli procedure was first performed in 1968 and soon became a standard surgical technique for patients with tga associated with a vsd and ps . in addition to excellent relief of ps , the rastelli procedure allows for anatomic correction and achieves good anatomic and physiologic results in the short term . however , late results of this procedure have critical limitations : low long - term survival and an inevitable reoperation on the obstructed conduit . these problems come from the inability of the conduit to grow and from lvot stenosis [ 57 ] . to overcome the limitations of this procedure , pulmonary root translocation ( prt ) was introduced by da silva et al . . with the prt technique , the dissected pulmonary root is implanted in the right ventricle outflow tract to allow for growth of the pulmonary artery . additionally , a more natural lvot is constructed by avoiding making an incision or mobilizing the aorta . long - term follow - up data demonstrated high long - term survival and adequate pulmonary root growth . inspired by da silva , we performed a prt on a five - month - old patient with tga , vsd , and ps . during the operation , great care was taken to avoid injury to the pv and the mitral valve when removing the pulmonary root . unlike da silva et al . , we employed the lecompte maneuver . the translocated pulmonary trunk was close to the sternum , which resulted in an increased risk of bleeding during re - intervention . additionally , we used an in situ autologous pericardium patch during the rvot reconstruction because of the expected growth potential . however , a major drawback is the possible formation of aneurysmal dilatation of the pericardial hood . in this case , questions regarding adequate pv size for pulmonary root translocation have arisen . however , larger numbers of patients and longer follow - up data will be needed to address this point . pulmonary root translocation with the lecompte maneuver can be a candidate procedure with the aim of preserving the growth potential of the native pv .

a five - month - old boy who had undergone previously transcatheter balloon atrioseptostomy at 3 days of age for complete transposition of the great arteries with ventricular septal defect and pulmonary stenosis underwent pulmonary root translocation with the lecompte maneuver . this operation has the advantages of maintaining pulmonary valve function , preserving the capacity for growth , and avoiding problems inherent to the right ventricular to pulmonary artery conduit . this patient progressed well for 9 months postoperatively and we report this case of pulmonary root translocation with the lecompte maneuver .

CASE REPORT DISCUSSION

PMC3179891

in addition to a general decline in physical fitness , the aging process is accompanied by a progressive decline in perception , motor behavior , cognition , and memory functions [ 24 ] . therefore , the preservation of everyday life skills and the maintenance of independent living become increasingly important with advancing age . it is well established that physical fitness is intimately associated with cognitive performance in the elderly [ 59 ] . consequently , high levels of physical fitness have been assumed to be a major factor contributing to the maintenance of independent living and everyday competence . one of the basic accomplishments of gerontology is the recognition of the tremendous heterogeneity and interindividual variability in the elderly . thus , the emergence of age - related decline can be highly variable between individuals , and there are notable differences in the interindividual performance of general skills at advanced ages . it seems that , aged individuals can maintain high levels of proficiency in certain domains involving cognitive - motor functions such as golf or piano playing . this gave rise to an intriguing question : how is proficiency in one domain of expertise , like playing piano , associated with performance in general ? older experts show little or no age - related decline in tasks related to their area of expertise , but beyond that they show a general age - related decline similar to the nonexpert older adults . on the other hand , the maintenance of high levels of expertise in one domain can have a positive impact on related functions . for example , elderly professional pianists have higher finger - tapping rates than untrained aged - matched individuals . we recently showed that a regular schedule of amateur dancing over many years throughout old age not only promotes posture and balance , but also has a wide range of beneficial effects on reaction times ( rts ) , motor behavior , and tactile and cognitive performance by comparing such individuals with an aged - matched nondancer control group . we hypothesized that the generalization of superior performance associated with regular dancing develops as a result of physical exercise in combination with cognitive challenges , sensory stimulation , and social interaction , all of which contribute to neuroplasticity . here , we extended these studies by investigating the impact of dancing at a higher level of expertise . one of the rationales for this study was to obtain information about whether a more extensive schedule of dancing , including competitive tournaments , would further enhance the range or magnitude of beneficial effects . we compared a group of neurologically healthy older subjects with many years of expert and competitive experience of dancing ( ed ) to a gender- , age- , and education - matched nondancer control group ( cg ) . in this study , the term expert is defined as those who regularly attend dance competitions and dance contests and undergo training at intensities of more than 4 h / week . comparable to our previous study on amateur dancers , we measured posture and balance , cognitive , attentional , intellectual , perceptual , and sensorimotor performance . subjects were recruited by advertisements in newspapers , poster announcements , and word - of - mouth advertising . all subjects reported their medical history and current medication and underwent the mini - mental status examination ( mmse ) . the ed group ( n = 11 , 5 women , 71.18 1.13 years ) had an extended history of competitive dancing ( 22.09 3.39 years ) with an average workload of 4.55 0.15 h / week . subjects in the ed group reported a regular attendance in official dance contests and championships throughout germany . the cg group consisted of 38 sedentary subjects ( 71.66 1.11 years , 30 women , ecq score : 8.43 ) with no record of dancing or sporting activities ( see section 4 for details regarding the selection of appropriate controls ) . the age distribution ( p = 0.829 ) and education level ( number of school years , p = 0.926 ) of subjects across the groups was balanced . the study was approved by the local ethics committee of the ruhr - university of bochum . during dance competitions , all subjects in the ed group were assigned to a starting group referred to as seniors iv for the competition , 10 different dances had to be performed in a mandatory order , including the slow waltz , tango , viennese waltz , slowfox , quickstep , samba , cha - cha - cha , rumba , paso doble , and jive , each of which lasted for 1.52 min . on the basis of points given by adjudicators during the contests , the subjects of our ed group were assigned the highest german grade ( s ) within the corresponding starting group . therefore , subjects of the ed group had to be particularly fit with regard to mobility , muscle flexibility , and body composition . although literature reports indicate a lower cardio - respiratory performance ( i.e. , maximal oxygen uptake or vo2max ) for professional ballet dancers in comparison to other athletes performing physical activities like running or swimming , professional modern dancers were shown to have a significantly higher maximal oxygen uptake compared to professional ballet dancers ( for review , see ) . given the average workload of 4.5 h / week plus assumed 2.5 h / week for dancing competition adds up to 7 h a week , which totals 350 h per year , which sums up to 7500 h , which is the typical workload range required to qualify for becoming expert . lifestyle and general activity levels were assessed using the everyday competence questionnaire ( ecq ) that addresses the aspects of everyday life , such as independence in activities of daily living and mobility , social relations , general health status , and life contentment . the compilation of questions used in the ecq accounts for the changing living conditions of today 's seniors . the ecq consisted of 17 items , including housekeeping , daily routines , manual skills , mobility , sports , subjective well - being , linguistic abilities , and leisure - time activities , thereby addressing instrumental activities of daily living ( iadl ) and the individual engagement in other activities of everyday life as well . these activities are not necessary for fundamental functioning , but they let an individual live independently in a community . all subjects were asked to comment on the questions with as much detail as possible , thus allowing insight into their habits and living conditions . the scores were normalized to a scale from 0 to 1 by dividing the number of points achieved by the maximum possible scores per item . general intelligence was assessed using the raven 's standard progressive matrices ( rspm ) [ 19 , 20 ] . the test was administered according to standard instructions with a 30 min time constraint . in the control group , the rspm was conducted in a pre-/post - design to provide data for a separate study . therefore , for both groups in this study , we used odd - numbered items only , resulting in a maximum score of 30 . in addition , the nonverbal geriatric concentration test ( akt ) was used to assess selective attention and concentration . for this paper - and - pencil test , subjects had to mark 20 symbols of 55 similar - looking patterns within a maximum time limit of 30 s ( figure 1 ) . the time required for each subject to complete the test sessions was averaged to evaluate individual performance . we performed multiple - choice rt measurements in a finger - selection visuotactile task adapted from the study of alegria and bertelson . an image of each hand was displayed on the monitor and 1 finger of the 10 was selected by a visual marker . subjects had to press the key corresponding to the selected finger on a hand - shaped , 10-button keyboard as fast as possible . one session consisted of 4 blocks of 100 trials each , which were separated by a short break after each block . the maximum response - to - stimulus interval for each trial was 2000 ms . we applied the romberg test , the timed up and go test , and the standing - turn test to assess each subjects ' ability to control their posture and maintain balance and to evaluate their security of gait . the romberg test is a standard neurological test addressing joint position sense ( proprioception ) and was applied in a condition with eyes either open or closed [ 23 , 26 ] . the movements of the body in relation to a perpendicular object behind the subject were monitored . the time until a subject started to lose balance was recorded ( maximal testing time was limited to 1 min ) . in the timed up and go test , subjects were asked to stand up from a sitting position , walk 3 m , return to the chair , and sit down again . the time to fulfill the task was measured . in the standing - turn test , a standing subject was asked to perform a 360-degree turn . the time and number of steps hand - arm fine - motor performance was evaluated using a computer - based test battery for clinical neuropsychological research ( mls ; dr . the system consists of a work plate with 2 pencils for left and right hand use . we tested speed , accuracy , and maintenance of upper limb position during execution of fine motor movements of the left and right arms , hands , and fingers by using the following tests for : steadiness , which evaluates the ability to achieve a prescribed arm - hand position and maintain it for a defined time period ; aiming , which evaluates the ability to accomplish fast arm - hand movements for small targets ; pin plugging , which evaluates fine and gross motor dexterity and coordination ; tapping , which evaluates the ability to perform very fast , repetitive wrist - finger movements with little emphasis on the precision of movement . touch threshold was evaluated using a staircase procedure by probing the fingertips of the left and right index fingers with von frey filaments ranging from 0.25 to 294 mn on logarithmic scaling ( marstocknervtest , marburg , germany ) . spatial 2-point discrimination thresholds ( 2pd ) were assessed on the tips of the left ( lid ) and right ( rid ) index fingers by using the method of constant stimuli [ 2729 ] . needle separations of 1.5 , 2.3 , 3.1 , 3.9 , 4.7 , 5.6 , and 7 mm were used . test - retest reliability using this procedure was 0.90 for young subjects and 0.88 for older participants . the summed responses were plotted against the needle distances resulting in a psychometric function , which was fitted using a binary logistic regression ( spss , spss inc . the threshold was taken from the fit where 50% correct responses were reached . to pool the data obtained from the various tests , we defined 5 domains covering similar functional categories . cognitive performance comprised data from the akt and the rspm . posture and balance comprised data from the romberg test , the timed up and go test , and the standing - turn test . motor performance comprised steadiness , aiming , pin plugging , and tapping . a separate domain rt was introduced to include data from the multiple - choice rt task . to compare performances across all tests and all subjects , we calculated normalized performance indices ( ips ) for each subject , and each test as ( wp - ip)/(wp - bp ) , where wp is the worst performance of all subjects , ip is the individual performance , and bp is the best performance of all subjects . indices were subsequently averaged across tasks belonging to a particular domain as described above . in all cases , we reported averages and standard error of the mean ( sem ) . we used the mann - whitney u test to detect differences between the 2 groups . moreover , we computed effect sizes according to cohen 's d . to test for differences in the distribution of ips , we used chi - square statistics . a p value of < 0.05 was considered significant . we tested cognitive , posture , balance , and sensorimotor performance in the 2 groups of older participants , matched for gender , age , and education , who had an extended history of expert and competitive dancing ( ed ) , or no dancing experience ( control group ; cg ) . the ed group had a superior performance in most of the tests ( table 1 ) . the ed group showed significantly higher ecq scores than the cg group ( z = 2.996 , p = 0.003 ) . cognitive performance assessment showed significant differences between the ed and cg groups for the rspm ( figure 2(a ) ) ( z = 2.776 , p = 0.006 ) and akt ( z = 4.997 , p 0.001 ) . for both hands , the ed group had faster rts , which were averaged for the left ( z = 2.294 , p = 0.022 ) and right hands ( z = 2.195 , p = 0.028 ) . posture and balance assessment showed significant differences between the 2 groups for the romberg test with eyes open ( z = 3.951 , p 0.001 ) , but not with eyes closed ( z = 1.250 , p = 0.211 ) . subjects in the ed group needed less time for the completion of the standing - turn test ( z = 2.815 , p = 0.005 ) . moreover , the ed group showed significantly shorter up and go times ( figure 2(b ) ) ( z = 3.819 , p 0.001 ) . significant differences were found between the 2 groups in the motor domain for the aiming subtest ( figure 2(c ) ) , which showed that there were fewer errors in the ed group ( z = 2.808 , p = 0.005 ) , as well as a shorter pin - plugging time ( z = 2.343 , p = 0.019 ) , both of which were observed in the right hand only . in the tactile domain , the assessment of 2pd thresholds showed significant differences between the 2 groups ( figure 2(d ) ) for the right ( z = 2.434 , p = 0.015 ) and left ( z = 2.515 , p = 0.012 ) index fingers . the calculation of ip for each test and each subject allowed a direct comparison of performances across all tests and all subjects and facilitated grouping into functional domains covering cognition , rts , posture and balance , motor performance , and tactile performance . as shown in table 2 , the ed group showed significantly higher ips in 2 of the 5 domains , with the largest difference being for posture and balance ( z = 5.599 , p 0.001 ) followed by rts ( z = 3.462 , p = 0.001 ) . our findings indicated a general advantage for the ed group , which spans cognitive , perceptual , and motor performance . in order to obtain insight into possible differences in the overall distribution of ips within a given domain , we grouped the ip for each domain into > 0.5 and < 0.5 values and compared the percentage of occurrence of ips > 0.5 across groups , where 0 indicates the worst and 1indicates the best performance . in 3 of the 5 domains analyzed , the cg group had a significantly higher number of ips that was lower than 0.5 ( subjects with ip < 0.5 , cognition : ed = 9.09% , cg = 36.26% , = 6.12 , p = 0.013 ; rt : ed = 4.55% , cg = 44.74% , = 12.00 , p = 0.001 ; posture and balance : ed = 21.82% , cg = 70.37% , = 25.87 , p 0.001 ) . higher ips for motor performance that were lower than 0.5 were also found within the cg group , but they did not reach statistical significance ( ed = 17.61% , cg = 24.59% , = 3.75 , p = 0.053 ) . in agreement with the results shown in table 2 , increased ips lower than 0.5 were found for tactile performance in the ed group ( ed = 38.64% , cg = 21.26% , = 5.16 , p = 0.023 ) . accordingly , the superior performance of the ed group within some domains did not come from the fact that their best performers were better than those of the cg group , but it was instead due to the fact that the ed group lacked the poor performers that were frequently present in the cg group . we have recently shown that a regular schedule of many years of amateur dancing in old age has a wide range of beneficial effects not only on posture , but also on sensorimotor and cognitive performance . this observation raised the question of whether preservation of a high level of proficiency such as that which is present in elderly expert ballroom dancers has an even higher positive impact on physical and cognitive fitness in aged individuals as compared to those with only basic amateur dancing skills . we therefore studied the impact of extended participation in competitive dancing in a group of older subjects and compared them to an aged - matched , nondancer cg . in addition to posture and balance , which are closely related to dancing , we performed a broad assessment of cognitive , attentional , perceptual , and sensorimotor abilities . according to our hypothesis about the impact of multi - year dancing activities therefore , we needed to test many different domains from cognitive functions to basic sensory abilities . criteria for selecting a test included a brief time needed to complete the test , general acceptance , and a wide extension . in this sense , a particular test served as a surrogate for a given domain , implying that other tests for this field would have shown similar effects . floor or ceiling effects have been described when using the advanced ( ceiling ) or colored progressive matrices ( floor effects ) . in our study , we used a subset of odd - numbered items only , resulting in a maximum rspm score of 30 . the scores obtained for ed ( 19.59 0.75 ) and cg ( 15.39 0.83 ) indicate a lack of floor and ceiling effects . we included a cg that was characterized by having no record of dancing or sporting activities for at least 5 years . the ecq addresses specific aspects of so - called instrumental activities of daily living , such as housekeeping , daily routine , manual skills , mobility , sports , subjective well - being , linguistic abilities , and leisure - time activities . participants in the cg had lower ecq scores , indicating a more passive and sedentary lifestyle . these data imply a close association between a lack of sporting activities and lifestyle , the identification of which was not our primary goal when we selected subjects . it is well acknowledged that selecting an adequate control group for any type of expert subpopulation poses a major challenge . for example , instead of using a group of passive individuals , one could use a group that would also be considered expert , but in a different domain . by this , the particularities of the respective areas of expertise would have been compared . as dancing is coupled with physical exercise , our controls were selected to have neither experience with dance or sports . further studies are required to test other groups comprised of individuals performing some type of sport activity in order to disentangle the effects of physical exercise hidden in dance . subjects in the ed group performed better in most of the tasks investigated in this study . however , analysis of the individual ips , which allowed comparison across all tests and subjects for the 5 domains ( cognition , rt , posture and balance , motor performance , and tactile performance ) showed a significantly better performance in the ed group with regard to rt and posture and balance only . a similar argument can be made for the finding of faster rts in the ed group , which might be attributable to the requirements for both high attention and fast and well - coordinated motor responses . in contrast to the previously studied group of elderly amateur dancers , we found no differences between the ed and cg for performance measures related to the domains of cognition and hand - arm motor functions . on the other hand , this limited generalization is , to some extent , in agreement with recent studies that concluded that although high levels of expertise may have a positive impact on functions related specifically to that proficiency , other non - expert - related abilities of older experts were similar to those of nonexpert older adults . in the previous study performed in a group of amateur dancers , we showed that the best performers of each task were present in both the dancing and the cg with similar frequency , but that the amateur dancing group lacked the number of poor performers that were frequently found within the control group . here , we showed that for non expertise - related domains such as tactile abilities , poor performers were equally present in both the ed and cg . these data led us to speculate that amateur and expert competitive dancers differ in that the latter focus on their area of expertise at the expense of other skills . since dancing at a high maintained level of expertise requires extensive practice , competitive dancing requires substantial effort with regard to the traveling time and personal strain during competitions , which might counteract the positive impact of dancing that was observed in the amateur group . another line of argument for the limited positive impact of expertise at old age comes from functional imaging studies . it has been shown that learning piano playing in amateurs elicits stronger activation in a number of brain areas in comparison to the brain activation found in professional piano players , who practice playing to maintain high levels of expertise . on the basis of these types of studies , it has been suggested that fewer cognitive resources are required for expert performance once an it is therefore conceivable that the maintenance of high - level expertise has a lesser impact than the acquisition of new skills on the general fitness of older people . for many years , dance has been successfully established as a therapeutic tool in the elderly to improve cardiovascular parameters , muscle strength , and posture and balance [ 37 , 38 ] . our motivation for investigating the beneficial effects of dancing was triggered by the hypothesis that dancing can be regarded as an equivalent of enriched environmental conditions in human individuals , because of the unique combination of physical activity , rhythmic motor coordination , emotion , affection , balance , memory , social interaction , and acoustic stimulation . however , our data suggest that many of the features that play a crucial role in promoting positive effects in amateur dancing might be less relevant for expert dancers . this assumption is supported by the observation that the positive impact of expert competitive ballroom dancing was limited to expertise - related tasks such as posture and balance , or rts . thus , years spent developing high - level expertise helps to maintain remarkable levels of posture - related performance even at an advanced age , which is in accordance with the notion that brain plasticity is operational in old age [ 27 , 39 ] . compared to activities such as exercising , walking , or playing an instrument , dance has the advantage of combining many diverse features including physical activity , social and emotional interaction , and sensory stimulation , each of which is well documented to have beneficial effects . consequently , many studies in the elderly have shown that improving aerobic capacity through physical exercise programs has beneficial effects on cognitive performance [ 6 , 8 , 9 , 4043 ] . while cardiovascular fitness might directly affect blood pressure and circulation , animal research on the effects of physical exercise suggests a crucial involvement of neurotrophins and other nerve growth factors [ 44 , 45 ] . use - dependent plasticity , synaptic efficacy , and the maintenance of synaptic connections are controlled and modulated by neurotrophins such as brain - derived neurotrophic factor ( bdnf ) . bdnf levels increase by many factors such as physical activity and social interaction [ 4447 ] . housing animals under enriched environmental conditions , in particular , has been shown to increase neurotrophin gene expression , thus exerting neuroprotective functions [ 4850 ] . mild stress response in cells has been advocated as a major driving force for the upregulation of stress resistance genes and growth factors . interestingly , among the factors inducing mild stress are sensory stimulation , physical activity , and cognitive challenges , all of which are involved in dancing . it must be recognized that the present study , as well as our previous study with amateur dancers , can not resolve the query as to whether the superior performance of either the expert or amateur dancers is due to a group preselection of particularly fit subjects tending to engage in a regular schedule of year - long dancing or due to the dancing activity per se . it is therefore conceivable that intelligent people with better balance and faster rts are those who are more likely to select dancing as a life - long avocation . recent data from an intervention study in a pre-/post - design showed that after a 6-month dance course , elderly participants improved in all tested aspects , including perception and cognition , similar to those described here . these data show that irrespective of individual predispositions , dancing activities play a crucial role in mediating a wide range of beneficial effects , depending on the dose of exercise . our data showed that a regular , multiyear schedule of expert and competitive ballroom dancing in a cohort of older individuals preserves posture and balance parameters to a remarkable extent and has a positive impact on rt . however , our results provided no evidence for more widespread beneficial effects on related domains such as tactile and cognitive performance . these findings suggest that not all doses of exercise are helpful for alleviating age - relating deterioration but hint at a more inverted u - shape , dose - response function with optimal ranges of intervention intensity required to have maximal beneficial effects . accordingly , it might be important to adjust , depending on the individual level of activity and expertise , the challenges of intervention programs to maintain health and functional independence throughout life . given the dramatic demographic changes within industrialized countries characterized by an increasing probability of reaching old and very old age , there is an urgent need for measures permitting an independent lifestyle into old age . since there is a close association between physical fitness and cognitive performance , a number of studies investigated the impact of interventional programs on the basis of dancing for the treatment of age - related functional degradation [ 37 , 38 , 53 ] . our data showed that high levels of dancing expertise can be preserved up to a very old age , thereby maintaining remarkable levels of performance in expertise - related tasks . however , tasks outside these areas of expertise showed the age - related decline typically observed in aged - matched nonexperts .

physical fitness is considered a major factor contributing to the maintenance of independent living and everyday competence . in line with this notion , it has been shown that several years of amateur dancing experience can exert beneficial effects not only on balance and posture but also on tactile , motor , and cognitive functions in older people . this raises the question of whether an even more extensive schedule of dancing , including competitive tournaments , would further enhance these positive effects . we therefore assessed posture , balance , and reaction times , as well as motor , tactile , and cognitive performance in older expert ballroom dancers with several years of competitive experience . we found substantially better performance in the expert group than in the controls in terms of expertise - related domains like posture , balance , and reaction times . however , there was no generalization of positive effects to those domains that were found to be improved in amateur dancers , such as tactile and cognitive performance , suggesting that there might be an optimal range of intervention intensity to maintain health and independence throughout the human lifespan .

1. Background 2. Materials and Methods 3. Results 4. Discussion 5. Conclusion

PMC5260548

athletes either walk or run prior to executing specific skills ( panariello , 1991 ) . the gait is a complex movement which includes both the open and closed kinematic chain . therefore , the gait can be influenced by many factors such as age , the activity level , muscle activity ( bizovska et al . stastny et al . , 2014 , 2015 ) , injury ( bunton et al . , 1993 ) and disease ( krawczyk et al . , 2012 ; marchewka and chwala 2007 ) . in many studies , kinematic ( franz et al . , 2009 ) and kinetic ( bovi et al . , 2011 ; cigali et al . , 2004 ; jandaka et al . , 2013b ) variables during a gait cycle have been observed , but they were usually assessed independently in each joint . from a mechanical point of view , while walking a human body can be considered a system of segments and joints forming various types of chains depending on the phase of a gait cycle . the first works on kinematic ( kinetic ) chains in this field were published in the 1870s . the authors of that time described kinematic chains as a system of overlapping rigid bodies linked by pivots . upon external loading , force was transferred from one segment to an adjacent segment , thereby enabling cumulative response of the whole chain ( reuleaux , 1875 ) . in the 1950s , arthur steindler observed the possibilities of applying kinematic chains in the motor system ( steindler , 1977 ) . one of the reasons for his interest was the finding that muscle activity in the lower limb with the foot fixed to the ground ( a closed chain ) was different when the foot was in free motion ( an open chain ) , what also has implications in sports training . in an open kinematic chain ( okc ) , the joint angle can be adjusted without incurring any changes in other joints . in a closed kinematic chain ( ckc ) , however , both ends of the chain are fixed and any adjustment in the angle in one joint reciprocally results in altered angles in the other joint . a human gait , as other complex movements , typically consists of both the open and closed kinematic chains that frequently alternate during movement of the lower limbs . in the swing phase , the limbs adopt an open kinematic chain such that the distal segment movement velocity relates to the velocity of the proximal segment . additionally , inertia acceleration in the distal segments is associated with deceleration of the proximal segments ( mcmullen and uhl , 2000 ) . during the stance phase ( ckc ) , stability of the proximal segments depends on the stability afforded by the distal segments and foot instability influences the ability to stabilize the trunk along with proprioception from fixed parts of the body ( bunton et al . , 1993 ) . in the scientific literature we can find many studies which observe interdependence between the movements of different limb segments during various movement tasks both in sport ( jandaka et al . , 2013a ; sasaki et al . , 2015 ) and clinical cases ( bunton et al . , 1993 ; khamis et al . , 2015 ; wright et al . , 2008 ) . however , when focused on walking , the authors mainly observed the relationships between parts of the foot and shank or knee ( dubbeldam et al . , 2013 ; pohl et al . , 2007 ) . our study is more comprehensive and includes movements at the ankle , knee , hip and pelvis . with regard to sports training , a crucial question arises whether the ckc or okc alternation would lead to parallel changes in the whole movement pattern . the aims of the study were to describe the relationships between movements of the lower limb segments and the pelvis in open and closed kinematic chains while walking and to assess the effects of laterality on these relationships . the experimental group consisted of 32 males ( age 23.3 2.5 years , body mass 78.1 8.7 kg , body height 182 6 cm ) . only participants with good health and no history of serious injury the preferred limb was determined prior to measurements by asking which leg the participant would use to kick a ball . for 3d analysis , a vicon mx ( vicon motion systems ltd . , oxford , uk ) optoelectronic system with seven infrared cameras ( type t10 , resolution 1 megapixel , frequency 200 hz ) was used . the participants were asked to walk on an 8 m long walkway including two force plates ( type : 9286aa , kistler instrumente ag , winterthur , switzerland ) . the positions of the lower limb segments and the pelvis were determined using the plugingait model ( 16 markers ) with consideration of marker placement error ( szczerbik and kalinowska , 2011 ) . this velocity range was determined during a preliminary study as the natural speed of the walk in young male subjects . angles at the ankle , knee , hip and pelvis in the sagittal , frontal and transversal planes were evaluated at specific gait cycle phases , as determined by force plates and the kinematic system as follows : initial contact ( ic),opposite toe off ( oto),heel rise ( hr),opposite initial contact ( oic),toe off ( to),maximal knee flexion ( mkf),tibia in the vertical position ( tv ) . initial contact ( ic ) , opposite toe off ( oto ) , opposite initial contact ( oic ) , maximal knee flexion ( mkf ) , tibia in the vertical position ( tv ) . ankle movement in the frontal plane ( inversion / eversion ) was not assessed since applying the conventional gait model in the absence of any enhancement in the set of foot markers is not considered reliable for this variable . the kinematic data were processed using standard procedures by vicon nexus and vicon polygon software ( vicon motion systems ltd . , the relationships between angle variables of the lower limbs and the pelvis ( table 1 ) in specific gait cycle phases were determined using statistica software ( version 10.0 , statsoft , inc . the kolmogorov - smirnov test showed a non - normal data distribution , thus , the spearman correlation coefficient was used . a correlation was considered large for values greater than 0.5 and moderate for values between 0.3 and 0.5 ( cohen , 1988 ) . positive correlations meant that movement in the joints occurred in the same direction ( both for positive or negative ) . for example , a positive correlation between the ankle and the knee in the sagittal plane indicated that increased ankle dorsal flexion was associated with increased knee flexion . conversely , a negative correlation illustrated a contrary joint movement ; for example , in the transversal plane there was internal rotation at the ankle and external rotation at the knee . description of measured angle variables positive positive angle values , negative negative angle values for clarity , our study focused only on adjacent segments and the individual assessment of each plane . the experimental group consisted of 32 males ( age 23.3 2.5 years , body mass 78.1 8.7 kg , body height 182 6 cm ) . only participants with good health and no history of serious injury the preferred limb was determined prior to measurements by asking which leg the participant would use to kick a ball . for 3d analysis , a vicon mx ( vicon motion systems ltd . , oxford , uk ) optoelectronic system with seven infrared cameras ( type t10 , resolution 1 megapixel , frequency 200 hz ) was used . the participants were asked to walk on an 8 m long walkway including two force plates ( type : 9286aa , kistler instrumente ag , winterthur , switzerland ) . the positions of the lower limb segments and the pelvis were determined using the plugingait model ( 16 markers ) with consideration of marker placement error ( szczerbik and kalinowska , 2011 ) . this velocity range was determined during a preliminary study as the natural speed of the walk in young male subjects . angles at the ankle , knee , hip and pelvis in the sagittal , frontal and transversal planes were evaluated at specific gait cycle phases , as determined by force plates and the kinematic system as follows : initial contact ( ic),opposite toe off ( oto),heel rise ( hr),opposite initial contact ( oic),toe off ( to),maximal knee flexion ( mkf),tibia in the vertical position ( tv ) . initial contact ( ic ) , opposite toe off ( oto ) , opposite initial contact ( oic ) , maximal knee flexion ( mkf ) , tibia in the vertical position ( tv ) . ankle movement in the frontal plane ( inversion / eversion ) was not assessed since applying the conventional gait model in the absence of any enhancement in the set of foot markers is not considered reliable for this variable . the kinematic data were processed using standard procedures by vicon nexus and vicon polygon software ( vicon motion systems ltd . , oxford , uk ) . the relationships between angle variables of the lower limbs and the pelvis ( table 1 ) in specific gait cycle phases were determined using statistica software ( version 10.0 , statsoft , inc . , the kolmogorov - smirnov test showed a non - normal data distribution , thus , the spearman correlation coefficient was used . a correlation was considered large for values greater than 0.5 and moderate for values between 0.3 and 0.5 ( cohen , 1988 ) . positive correlations meant that movement in the joints occurred in the same direction ( both for positive or negative ) . for example , a positive correlation between the ankle and the knee in the sagittal plane indicated that increased ankle dorsal flexion was associated with increased knee flexion . conversely , a negative correlation illustrated a contrary joint movement ; for example , in the transversal plane there was internal rotation at the ankle and external rotation at the knee . description of measured angle variables positive positive angle values , negative negative angle values for clarity , our study focused only on adjacent segments and the individual assessment of each plane . all large and moderate ( greater than 0.3 ) correlations ( table 2 ) were statistically significant ( p < 0.05 ) . the highest number of moderate and large correlations was found for the following phases of a closed kinematic chain : heel rise ( 81% ) , opposite toe off and opposite initial contact ( 63% ) . with regard to an open kinematic chain ( maximal knee flexion 38% , 56% ) and borderline phases between closed and open kinematic chains ( initial contact , toe off 50% ) , the number of large and moderate correlations was smaller . the number of large and moderate correlations was slightly higher for the preferred limb ( 61% ) than for the non - preferred one ( 54% ) . in regard to the movement planes , the number of correlations was higher in the sagittal ( 67% ) and transversal planes ( 60% ) compared to the frontal plane ( 36% ) . correlations between joint movements in various gait cycle phases ic initial contact , oto opposite toe off , hr heel rise , oic opposite initial contact , to this combination appears in most of sports movement patterns such as running or throwing , which have to be trained and improved in terms of movement stability . kinematic chain segmental stability appears sequentially dependent , where the inferior segments are significantly correlated to the superior segments . therefore , controlling lower limb segment stability may allow for increased stability at the more proximal segments and , ultimately , the trunk ( graham et al . , 2011 ) . our results also show that segments coupling in relation to the okc and ckc on the example of the gait present relationships that might be generalized for other basic movement patterns used in sports . specifically , if the aim of the coach is to alternate the athletes movement pattern , it should be considered whether to alternate the ckc or okc part of the movement . the same situation also appears when considering the benefits of eliciting changes in the preferred or non - preferred limb . in the sagittal plane , our results showed significant correlations between adjacent segments during the entire stance phase ( a closed chain ) for the knee - hip and hip - pelvis pairs . for the ankle - knee pair , a significant correlation was found only for initial contact , opposite toe off and heel rise . these correlations are subject to changes at the knee joint , what is associated with braking of the body movement and reduced vertical displacement of the centre of mass ( rose and gamble , 2006 ) . during the swing phase ( an open chain ) , significant correlations between the movements of the adjacent segments in the sagittal plane occur as well , however , values of the correlations and the number of the significant ones are smaller . correlations were significant during mkf for the hip - pelvis pair and during tv for the ankle - knee and knee - hip pairs . a significant relationship between movement of the pelvis and the hip in the sagittal plane during a gait cycle was confirmed by franz et al . ( 2009 ) , who found a positive correlation between hip extension and the anterior pelvic tilt . in the frontal plane , the highest values were found during a preswing ( from oic to to ) when the weight was transferred to the contralateral limb and the pelvis tilted towards the ipsilateral limb with associated hip abduction . for the pelvis to return to a neutral position during a midswing ( between mkf and tv ) , simultaneous hip and knee flexion is necessary ( rose and gamble , 2006 ; whittle , 2007 ) . in the transversal plane , a significant correlation between the ankle - knee and knee - hip pairs was observed in almost all gait cycle phases . since rotation in the knee joint is limited , we considered this fact as a correlation between the foot and the hip . ( 2011 ) who revealed a correlation between transverse plane rotation at the foot and transverse plane rotation at the hip and the pelvis . the highest number of moderate and large correlations was found for opposite toe off , heel rise and opposite initial contact . during all of these phases , the lower limb and the pelvis were in a closed kinematic chain . 2012 ) showed significantly greater coupling during the stance phase compared to the swing phase between the movements of the knee joint in the sagittal and transversal planes . although coupling in this study means a movement of one joint in two planes , it suggests that different movements of the lower limbs correlate more in closed kinematic chains than in open ones . the obtained results brought forward some differences in the correlations between the preferred and non - preferred limb . the number of moderate and large correlations was higher for the preferred limb . between the knee and hip movements , the correlations were often larger in the preferred limb in the sagittal plane and larger in the non - preferred limb in the transversal plane . this suggests that functional differences between limbs depend on the contribution of each limb to performance of propulsion and control during able - bodied walking ( michalski et al . , 2011 ; sadeghi et al . , 2000 ) ; the preferred limb appears to be more important for propulsion . some authors have presented correlations between non - adjacent segments and various planes ( svoboda et al . , 2014 ) . however , their studies mostly observed the influence of a foot position on more proximal segments . segments coupling during complex movements depend on both ckc and okc movements , thus , alternation of each movement may change kinematics . despite that therefore , the instructions or interventions focusing on ckc alternation are more effective for movement pattern changes . moreover , the preferred limb initiates kinematics in the direction of propulsion , while the non - preferred limb in internal and external rotation .

abstractlots of athletic skills performed during practice or competition are initiated by the legs , where athletes either walk or run prior to executing specific skills . kinematic chains are used to describe the relationships between body segments and joints during movement . the aim of this study was to determine the relationships between movements of lower limb segments and the pelvis in open and closed kinematic chains while walking . the experimental group consisted of 32 males ( age 23.3 2.5 years , body mass 78.1 8.7 kg , body height 182 6 cm ) . for 3d analysis , an optoelectronic system vicon mx ( 7 cameras , frequency 200 hz ) was used . positioning of the segments was determined by the plugingait model . each participant executed five trials at speeds ranging from 1.38 to 1.52 ms-1 . the relationships between angle variables of the lower limbs and the pelvis in selected gait cycle phases were evaluated using statistica software ( version 10.0 ) and the spearman correlation . the highest numbers of moderate and large correlations were found at opposite toe off , heel rise and initial contact for the sagittal and transversal planes in comparison to the frontal plane . the closed kinematic chain had a stronger impact on determining the movement pattern . the instructions or interventions focusing on closed kinematic chain alternation are more effective for changes in a movement pattern . the preferred limb initiates kinematics in the direction of propulsion , while the non - preferred limb in internal and external rotation .

Introduction Material and Methods Participants Experimental procedures and measures Statistical analyses Results Discussion Conclusion

PMC2877205

a predominant question in neuroscience is how memory functions are supported by the central nervous system and what cellular processes are necessary . one focus of this research is on protein - dependent synaptic modifications that occur as a consequence of neuronal activity . signaling cascades activated at the time of learning can induce the transcription of particular genes , ultimately leading to de novo protein synthesis and subsequent structural changes to support long - term memories . immediate - early genes ( iegs ) are induced soon after neuronal activity , and they participate in diverse functions . some iegs are regulatory transcription factors ( e.g. , zif268/egr1 ) responsible for inducing transcription of late - response genes , while others are effector iegs ( e.g. , arc / arg3.1 ) that are directly involved in cellular changes at locations such as the cytoskeleton or receptors . however , the transcripts of some iegs , such as activity - regulated cytoskeleton - associated protein ( arc ) , are transported to the dendrites and protein synthesis occurs there , thus making arc a reasonable target for researchers investigating the underlying mechanisms of postsynaptic changes supporting memory formation . arc ( also called arg3.1 ) is a plasticity - related gene whose induction occurs soon after synaptic activation [ 24 ] , mrna transcription is independent of de novo protein synthesis , and expression is primarily in excitatory neurons following behavioral experience . arc contains a synaptic activity - responsive element ( sare ) in the promoter upstream of the initiation site , which is necessary for transcription and sufficient for the induction of activity - dependent arc . arc mrna is transported to the dendrites [ 3 , 4 , 6 ] perhaps via sumoylation ( reviewed in ) , where it is intradendritically localized to activated synapses by phosphorylated erk ( extracellular signal - regulated kinase ) signaling and actin polymerization [ 6 , 811 ] , translated into protein , and becomes a part of the postsynaptic junction . the recruitment of arc to the dendrites suggests its importance for synaptic plasticity that occurs after activation . arc expression has been strongly linked to long - term potentiation ( ltp ) and learning . high frequency stimulation ( hfs ) induces both ltp and arc expression , which are dependent upon nmda receptor activation [ 3 , 4 ] but not upon the activation of ampa receptors . additionally , intrahippocampal infusions of arc antisense in vivo disrupt multiple aspects of ltp , indicating that arc protein synthesis is required for the early expression , maintenance , and consolidation of enduring ltp ( [ 13 , 14 ] , reviewed in ) . in accordance with ltp as a molecular model for learning and memory , delivery of arc antisense to the dorsal hippocampus produces long - term memory deficits in spatial water maze performance and inhibitory avoidance in rats , indicating a necessary role for arc protein in memory consolidation . furthermore , arc - knockout mice show impaired spatial learning in the morris water maze task , disrupted fear memory to context and auditory stimuli , and deficits in conditioned taste aversion and object recognition . recent findings provide evidence for the role of arc in the regulation of ampa receptors through interactions with endocytic proteins in dendrites ( [ 17 , 18 ] , reviewed in [ 19 , 20 ] ) , as well as a function in the stabilization and the expansion of the f - actin cytoskeleton at activated synapses , strengthening the argument that arc is involved in modifications that affect synaptic efficacy ( reviewed in ) . the protein product of the immediate early gene zif268 ( also termed egr1 , or early growth response gene ) is a transcription factor of the zinc finger family . expression of zif268 is regulated by synaptic activity and dependent upon nmda receptor activation . induction of ltp produces increased expression of zif268 mrna , and knockout of the zif268 gene in mice results in absent late ltp in the hippocampus and deficits in long - term memory for spatial water maze , conditioned taste aversion , socially transmitted food preference , and object recognition . additionally , infusions of zif268 antisense into the amygdala prior to contextual fear conditioning disrupt fear memory consolidation . in the present set of experiments , we used pavlovian fear conditioning to investigate the time - dependent expression of arc and zif268 . in pavlovian fear conditioning , a neutral stimulus is paired with an aversive unconditional stimulus ( ucs ) . through this pairing , the once neutral stimulus becomes able to elicit a fear response ( termed the conditional response , or cr ) . the animal also acquires fear for the context in which fear conditioning occurred . when the animal is presented with the shock - associated auditory stimulus or is placed back in the training context , it will exhibit fear behaviors indicating memory for the training experience . the amygdala is crucial for the acquisition , consolidation , and expression of classically conditioned fear , as it receives information about both conditional and unconditional stimuli ( cs and ucs , respectively ) making it a site of associative convergence [ 25 , 26 ] . amygdala lesions and protein - synthesis inhibitors delivered to the amygdala disrupt fear conditioning [ 2729 ] . the hippocampus is not necessary for conditional fear to an auditory cs in a delay paradigm , but it is essential for contextual fear . post training hippocampal lesions abolish contextual fear in rodents , but they do not affect conditioning to an auditory stimulus and protein - synthesis inhibitors given into the hippocampus block the acquisition of contextual fear memory [ 26 , 31 ] . the present study examined the time course of arc protein expression in the hippocampus following pavlovian fear conditioning . in addition , the temporal profile of zif268 , another plasticity - related gene product , was measured and compared to the pattern of expression for arc protein . immunohistochemistry followed western blot studies to show the localization of arc and zif268 in hippocampal regions with elevated protein expression post training . additional control groups for shock stimulation and simple exposure to auditory and contextual stimuli were analyzed with western blots to better determine the specific contribution of arc and zif268 protein in the hippocampus . in all experiments , male long evans rats ( n = 148 ; harlan ; madison , wi ) weighing approximately 350 g were used . the animal colony was climate - controlled and maintained on a 14 hr : 10 hr light : dark cycle with lights on at 7:00 a.m. all experimental procedures were performed during the light cycle . all procedures were approved by the institutional animal care and use committee at the university of wisconsin - milwaukee . each chamber was constructed from clear plexiglas ( front and back walls , ceiling ) and stainless steel ( side walls ) and measured 28 20.5 21 cm ( length height depth ) . stainless steel rods spaced 12 mm apart served as the floor of the chamber and were used to deliver a mild footshock from a scrambled shock generator . conditioning chambers were housed in sound - attenuating boxes that were illuminated by a 7.5 w white light bulb . there was a constant background noise of 5660 db produced by ventilation fans inside the boxes . the chambers were cleaned with 5% ammonium hydroxide solution between each rat . in all behavioral testing , the dependent measure was freezing behavior , which is operationally defined as the lack of all movement , except movement necessary for respiration . the training procedure was recorded by video cameras installed inside the sound - attenuating chambers , and freezing behavior was scored by computer software ( freezescan 1.0 ; clever sys . , rats were adapted to handling and transportation procedures for 3 min each on 6 consecutive days . rats were trained in a single 15-min session of auditory - cued fear conditioning ( figure 1(a ) ) . after an initial 6-min baseline period , the rats received four presentations of white noise ( 72 db , 10 s ) that coterminated with a footshock ( 1.3 ma , 1 s ) . the rats remained in the chamber for an additional 4 min following the last footshock before being returned to their home cages . this training protocol has previously been shown to produce both contextual and auditory - cued fear memories [ 28 , 29 , 33 ] . additional groups of animals were created to control separately for auditory and contextual experience and shock stimulation . one group experienced the same training protocol but with no shock stimuli delivered ( wn - cxt ) , and another group received footshock immediately upon placement in the chamber and removed shortly afterward ( shk - only ) . after training , animals were returned to their home cages and later euthanized with an overdose intraperitoneal injection of a sodium pentobarbital solution at varying time points post training . animals were killed at 30 min , 60 min , 90 min , 4 hr , 8 hr , 12 hr , or 24 hr after training , and nave home cage ( hc ) rats served as a control group . in a separate experiment , wn - cxt and shk - only groups were euthanized 60 min after stimulus exposure and were compared to trained rats also killed 60-min post training as well as additional hc controls . it was not possible to control the animals ' behavior ( e.g. , sleeping ) during the survival interval , however , the occurrence of any such behaviors prior to euthanasia should be controlled for by the hc group . hc animals were killed at varying times during the day across the experiment to account for circadian patterns , unsystematic animal behavior , and any variation in the animal colony . thus , the protein expression measured in the trained groups beyond that observed in the hc animals should be specific to the learning experience and not the result of unsystematic variability . euthanized rats were decapitated and the brains were quickly removed , frozen on dry ice , and stored at 80c . tissue samples were microdissected from the dorsal hippocampus ( figure 1(b ) ) . in all dissections , a rat brain atlas and a rat brain matrix ( harvard apparatus , holliston , ma ) were used to maintain consistency in tissue collection . hippocampal samples were homogenized manually with a pestle and glass tissue grinder in a buffer solution ( all in 100 ml ddh2o : 0.605 g tris - hcl , 0.25 g sodium deoxycholate , 0.876 g nacl , 0.038 g edta , 0.0042 g naf , 1 g / ml pmsf , 1 g / ml leupeptin , 1 g / ml aprotinin , 10 ml 10% sds , 1 mm sodium orthovanadate ) until there were no visible traces of solid matter . homogenates were stored in centrifuge tubes and kept frozen at 80c until time for centrifugation ( 4000 rpm for 20 min ) . the supernatant was removed , placed into small centrifuge tubes , and stored at 80c . a bradford protein assay was performed to determine the total amount of protein in the samples ( bio - rad dc protein assay kit , hercules , ca ) . sample dilutions were pipetted into 96-well plates and compared to serial dilutions of the protein standard ( bio - rad bsa 1.35 mg / ml ) using a versamax plate reader and softmax pro 4.3 ls software . samples were discarded from further analysis if they did not meet a set criterion for variance , and this standard was applied to all groups equivalently . normalized protein samples were loaded onto 7.5% sds gels for arc blots or 9.0% sds gels for zif268 blots using a mini protean holder filled with electrophoresis running buffer and a bio - rad powerpac ( 200 v , 0.04 a constant , 90 min ) . each experimental condition was represented on each gel to counterbalance any slight variation in blot development . gels were washed in transfer buffer ( 3.03 g tris , 14.4 g glycine , 200 ml methanol , 5 ml 10% sds , ddh2o up to 1 l ) before the protein was transferred to pvdf membranes using a semidry transfer cell ( bio - rad ; powerpac settings : 15 v constant , 2.00 a , 75 min ) . after protein transfer , membranes were incubated for 2 hr in blocking buffer ( 500 ml tbs , 15 g nonfat dry milk ) and then exposed to primary antibody for 90120 min . a monoclonal antibody for arc protein ( dilution 1 : 100 in antibody buffer , santa cruz ) , a polyclonal antibody for zif268 protein ( dilution 1 : 1000 , cell signaling ) , and a polyclonal antibody for -actin ( dilution 1 : 1000 , cell signaling ) were used in these experiments . after exposure to the primary antibody , membranes were washed twice for 15 min in antibody buffer ( 100 ml blocking buffer , 50 l tween-20 ) before being incubated for 90120 min in secondary antibody ( goat anti - mouse for arc blots1 : 5000 dilution , santa cruz ; goat anti - rabbit for zif268 and -actin blots1 : 2000 dilution , upstate biotechnology ) . membranes were washed twice for 15 min in wash buffer ( 100 ml tbs , 50 l tween-20 ) before exposure to chemiluminescence solution ( santa cruz ) for 3 min . washes and incubations were generally done at room temperature , however , primary incubation was sometimes performed overnight at 4c and then for 1 hr at room temperature . developments were conducted in a dark room , where membranes with chemiluminescence were exposed to autoradiographic film in a cassette . any disruptions in the signal during development of the films caused the sample to be excluded from further analysis . the bands representing arc ( molecular weight ( mw ) : 55 kda ) , zif268 ( mw : 75 kda ) , and -actin ( mw : 45 kda ) were measured using densitometry software ( nih imagej ) . optical density measures were computed for each hippocampal sample as a percentage of the home - cage animals ' ( control group ) protein expression , and these results were statistically analyzed using one - way anovas and fisher 's least significant difference ( lsd ) post - hoc comparisons when appropriate . rats ( n = 6 ) were euthanized with an overdose of isofluorane either 30 or 90 min after a single session of fear conditioning ( 15-min session with signaled shocks , see figure 1(a ) ) . the 30-min and 90-min time points were selected based on the time course for zif268 and arc expression established by the western blot analysis . the rats were perfused transcardially with 0.1 m pbs followed by 10% buffered formaldehyde prior to decapitation . brains were removed and placed in 10% buffered formaldehyde overnight , and then transferred to 30% sucrose formalin for cryoprotection for another 24 hr . prior to slice collection , brains were rinsed 3 times in 0.1 m pbs for 10 min each . using a freezing microtome , coronal slices ( 50-micron thick ) were collected throughout the rostral - caudal extent of the dorsal hippocampus and placed into 24-well plates with 500 l of 0.1 m pbs . the slices were incubated on a titer plate in 1% sodium borohydride for 15 min , 0.1 m pbs twice for 10 min each , 10% normal goat serum for 30 min , and primary antibody for 30 min . arc ( 1 : 100 dilution ) , zif268 ( 1 : 500 dilution ) , and neun ( 1 : 200 dilution ) primary antibodies were used to determine the regional localization and neuronal colocalization of arc and zif268 proteins . neun antibody ( chemicon - millipore ) binds to neuron - specific nuclear protein and is commonly used to identify neurons . slices from each treatment condition were dual - labeled for arc and zif268 protein to determine colocalization within individual neurons . , all slices were incubated with two washes of 0.1 m pbs for 10 min each before incubation in antibody solution containing anti - mouse alexa 488 and anti - rabbit alexa 594 antibodies ( 1 : 500 dilution each , invitrogen ) for 2 hr in the dark . slices were rinsed in two washes of 0.1 m pbs for 5 min each . after incubation the slices were mounted onto unsubbed slides using ultra cruz mounting medium ( santa cruz ) . finally , the slides were coverslipped and sealed with a thin coat of nail polish around the edges . photomicrographs were taken using a fluorescence microscope ( olympus ) . to determine coexpression of arc and zif268 in the same neurons , separate images were taken of the same field for each protein and then merged using the dp manager ( olympus ) . arc - expressing neurons appear green in color ( alexa 488 ) and zif268-expressing neurons fluoresce red ( alexa 594 ) , thus overlaying the images resulted in coexpressing neurons to appear yellow in color . the exposure time was the same for all the images collected , and any adjustments to the contrast or the brightness of the images were conducted exactly the same for relevant images . protein expression values obtained from western blots were found to be normally distributed , thus the results were analyzed using parametric tests : one - way analysis of variance ( anova ) followed by fisher 's lsd post - hoc comparisons when appropriate . in some cases , pearson correlations were conducted on the normalized optical density values from western blots to investigate the relationship of protein expression in the dorsal hippocampus . significance levels were set at = 0.05 , and data are presented as mean sem . seventy - six male long evans rats were trained in a single 15-min session of pavlovian fear conditioning and later killed at varying time points post training ( 30 min , 60 min , 90 min , 4 hr , 8 hr , 12 hr , and 24 hr ) . all trained groups exhibited equivalent levels of freezing averaged across the 5-min period of cs - ucs presentations ( f(6,69 ) = 1.989 , p > .05 , data not shown ) . protein levels for each experimental condition were expressed as a percentage of the untrained hc animals ' protein expression [ % optical density ( od ) of hc control ] . any animal with a % od score more than 4 standard deviations from the mean was removed from further data analysis ( arc : no outliers ; zif268 : n = 1 from 24 hr group ) . we found that induction of arc protein expression for trained rats was monophasic in the dorsal hippocampus , with a significant increase detected between 30 min and 90 min post training before returning to near basal levels at 4 hr ( figure 2(a ) ) . a one - way anova revealed that the level of arc protein expression was time - dependent following fear conditioning ( f(7,79 ) = 4.265 , p < .001 ) . lsd post hoc comparisons showed that when compared to untrained hc animals , arc protein was significantly increased in trained rats at 30 min ( md = 34.4587 , p < .01 ) , 60 min ( md = 58.0035 , p < .001 ) , and 90 min ( md = 50.8044 , p < .01 ) . in order to determine the localization of arc protein in the dorsal hippocampus , coronal brain slices were collected from rats killed at 90 min after training and prepared for immunohistochemistry . increased arc protein expression was observed in the granule cell layer of the dentate gyrus in the trained animals , whereas only sparse expression of arc protein was detected in this same region in the unstimulated hc control rats ( figures 2(b)2(f ) ) . arc - positive neurons were not evident in other regions of the dorsal hippocampus , such as the ca1 . although we did not quantify the arc - positive neurons in the photomicrographs , the images suggest that the upregulation in arc protein expression is primarily localized in the dentate gyrus . a different temporal pattern was seen in the protein expression profile for zif268 , with a single peak evident at 60 min post training ( f(7,72 ) = 3.228 , p < .01 , see figure 3(a ) ) . lsd post - hoc comparisons revealed that zif268 protein is significantly increased at 60 min when compared to hc animals ( md = 55.2942 , p < .01 ) . in fact , the protein level for zif268 measured at 60 min is significantly higher than all other time points ( 90 min : md = 60.6474 , p < .01 ; 4 hr : md = 71.1209 , p < .01 ; 8 hr : md = 86.4159 , p < .01 ; 12 hr : md = 86.9798 , p < .01 ; 24 hr : md = 69.0759 , p < .01 ) with the exception of 30 min ( md = 32.7638 , p > .05 ) . to establish the localization of zif268 protein in the dorsal hippocampus , coronal brain slices from additional rats killed 30 min post training were collected and incubated with zif268 antibody . in agreement with findings from western blot analysis , conditioned rats showed qualitatively more expression of zif268 protein in the ca1 region of the dorsal hippocampus at 30 min after training , compared to hc controls ( figures 3(b)3(f ) ) . similar increases were evident in the dentate gyrus but not in the ca3 region of the hippocampus ( data not shown ) . some transcription factors ( such as zif268 ) have relatively high basal levels of expression , and this was observed in the unstimulated hc controls ( figures 3(c ) and 3(e ) ) . however , this basal level of zif268 expression was less than the level of zif268 protein induced behaviorally , as measured by western blots ( figure 3(a ) ) and captured visually in photomicrographs ( figures 3(d ) and 3(f ) ) . these images suggest that the increase in zif268 protein measured in western blot analysis is the result of upregulation of zif268 primarily in ca1 and the dentate gyrus ( see figure 4 ) . to validate the temporal changes observed for arc and zif268 protein expression , the same hippocampal samples were assayed for -actin , a constitutively expressed protein , using western blot analysis . the levels of -actin protein in the trained groups did not show significant changes in expression compared to hc controls ( f(7,81 ) = 1.328 , p > .05 ; data not shown ) , indicating that the upregulation in arc and zif268 protein is unique and specific to the behavioral training experience . in summary , the expression profile for these proteins demonstrates an early increase in zif268 expression at 3060 min post training , followed by a gradual monophasic wave in arc induction lasting through 90 min ( figures 2 and 3 ) . the temporal dynamics of these proteins are distinctive and reflect the difference in the functions for arc and zif268 ( i.e. , synapse - specific changes and transcriptional regulation , respectively ) . the delay between the peaks for zif268 and arc proteins corroborates previous research showing that arc is a transcriptional target of zif268 and that multiple genomic responses are activated as a consequence of fear acquisition . using pearson correlation on the western blot optical density values , we investigated the relationship between expression of arc and zif268 proteins in the dorsal hippocampus . correlational analysis indicated a direct moderate relationship between the levels of these proteins in the dorsal hippocampus after fear conditioning ( r(79 ) = 0.244 , p < .05 ) . upon closer inspection , we discovered that this relationship was driven by the positive correlation between arc and zif268 proteins in the animals killed 30 min after training ( r(15 ) = 0.510 , p < .05 ) , as significant correlations between these proteins were not found for the other experimental conditions . other researchers have found arc and zif268 mrna expression in the hippocampus to be correlated following training in hippocampus - dependent tasks , such as the spatial water maze [ 36 , 37 ] . to investigate the colocalization between arc and zif268 proteins in the hippocampus , brain slices collected from trained rats ( sampled 30 and 90 min post training ) and from nave hc rats were dual labeled for these proteins and viewed using epifluorescence microscopy . in the unstimulated hc animals , only a few neurons in the dentate gyrus expressed arc protein ( figure 4(a ) ) ; however , many of these neurons were zif268-positive ( figure 4(b ) ) . the merged image revealed that the arc - positive neurons in the dentate gyrus also expressed zif268 ( figure 4(c ) ) . in the trained rats , more neurons expressed arc protein , with maximal number of arc - positive neurons reached at 90 min ( figures 4(d ) and 4(g ) ) . further , many more neurons in the dentate gyrus expressed zif268 , with qualitatively more zif268-positive neurons shown at 30 min ( figure 4(e ) ) compared to slices collected from nave and 90-min animals ( figures 4(b ) and 4(h ) ) . as was seen in the nave hc animals , arc and zif268 proteins expressed in trained animals are co - localized in the same neurons as depicted in the merged images ( figures 4(f ) and 4(i ) ) . these findings qualitatively replicate the western blot analysis results showing increased arc at 90 min and zif268 around 30 min post training in the dorsal hippocampus . they also extend those findings to suggest that after fear conditioning co - expression of zif268 and arc protein increases . to determine if the time - dependent changes in hippocampal arc and zif268 protein expression were specific to associative learning , rats were assigned to one of four conditions : trained ( t ; n = 14 ) , white noise and context exposure ( wn - cxt ; n = 9 ) , immediate shock ( shk - only ; n = 8) , or unstimulated home cage control ( hc ; trained animals received the same fear conditioning protocol used previously ( figure 1(a ) ) . wn - cxt animals experienced the same training paradigm but with the shock generator turned off , and shk - only rats received shock upon placement in the chamber and then were immediately removed . all rats were killed 60 min post - experience and dorsal hippocampal tissue was processed for western blots . protein levels for each experimental condition were expressed as a percentage of the untrained hc animals ' protein expression [ % optical density ( od ) of hc control ] . arc protein levels did change significantly due to behavioral experience in the training context ( figure 5(a ) ; ( f(3,33 ) = 3.007 , p < both the trained and wn - cxt groups had increased levels of arc protein compared to unstimulated hc controls ( trained : md = 66.3183 , p < .05 ; wn - cxt : md = 71.6449 , p < .05 ) , which was not observed in the shk - only condition ( md = 46.0808 , p > .05 ) . the expression of arc protein in the trained group was similar to arc protein levels observed in the 1-hr group measured in the original time course ( ~60% increase ; figures 2(a ) and 5(a ) ) . a different pattern of protein expression was measured for zif268 , where marked increases were seen only in the trained condition ( figure 5(b ) ) . the overall anova between hc , shk - only , wn - cxt , and trained groups did not meet our statistical criterion ( f(3,33 ) = 1.593 , p > .05 ) . however , the level of zif268 in the trained group was similar to that observed in the 1-hr time group of the original time course ( ~65% ; figures 3(a ) and 5(b ) ) . therefore , we conducted a linear planned comparison between the trained and hc groups which did indicate a significant upregulation of zif268 protein in the trained group ( f(1,33 ) = 4.693 , p < .05 ) . in contrast to both arc and zif268 protein expression , there were no significant changes in protein levels in the loading control -actin across the conditions ( f(3,37 ) = 0.112 , p > .05 ; data not shown ) . the effector ieg arc has been implicated in synaptic plasticity underlying learning and memory . our aim was to extend these earlier findings by investigating the time - dependent expression of arc protein induced by pavlovian fear conditioning and compare it to the expression profile of another ieg , zif268 . we found arc protein to be expressed soon after fear conditioning in the dorsal hippocampus . gradual increases in arc protein were detected by 30 min , and the single peak in the expression profile emerged at 1 - 2 hr post training before returning to baseline levels at 4 hr . arc protein was primarily localized in the granule cell layer of the dentate gyrus . these data indicate that arc protein expression induced in the dorsal hippocampus by fear conditioning is time - dependent and monophasic . arc protein is likely involved in the consolidation of contextual fear memories supported by the hippocampus , since auditory delay fear conditioning is not reliant on the hippocampus [ 26 , 30 ] . the levels of arc protein expression in the dorsal hippocampus were positively correlated with the regulatory transcription factor ieg zif268 . the expression profile for zif268 in the dorsal hippocampus was also monophasic ; however , maximal protein levels were measured at 60 min after fear conditioning , with increased expression seemingly localized to the dentate gyrus and ca1 . in a separate experiment , we investigated if the induction of these proteins was specific to associative learning or was the result of behavioral experience more generally . arc protein expression increased in rats that were trained as well as in those animals exposed to the context and auditory stimuli . delivery of immediate shock did not produce a significant increase in arc , so arc protein expression is not linked to ucs exposure per se . further , we would not predict a significant learning - related increase for the immediate shock condition as this procedure does not result in normal learning . since both training and exposure to the training chamber induced similar levels of arc expression , this effect likely relates to contextual processing . similar alterations in arc mrna in the hippocampus have been observed using catfish analysis for contextual fear conditioned and context - exposed animals . this selective increase in hippocampal zif268 protein only in the trained group and not in shk - only and wn - cxt conditions is similar to the upregulation of zif268 observed during retrieval of a context fear memory relative to cued - fear retrieval or reexposure to a context not paired with shock . the significance of this difference from the pattern seen with arc protein is not yet clear , but perhaps zif268 expression in the hippocampus is more specifically related to the formation of aversive memories . the single phase of arc protein upregulation we observed is similar to forskolin- and ecs- ( electroconvulsive shock ) induced expression of arc mrna [ 1 , 3 , 4 , 40 ] and protein [ 1 , 41 ] , with increased expression measured 30 min to 4 hr post activation and a return to basal levels by 8 or 24 hr . our data are also in accordance with recent ltp in vivo investigations , in which arc antisense oligodeoxynucleotide applied 2 hr , but not 4 hr , post - ltp induction resulted in the reversal of ltp , suggesting that the role of arc protein is time - limited . furthermore , our hippocampal data complement findings from other behavioral paradigms . for example , arc mrna expression in the hippocampus following spatial water maze training peaks at 30 min post training and returns to baseline at 6 hr . we do detect elevated levels of arc protein at 30 min , which may be the product of existing or newly transcribed mrna , a possibility we have not yet investigated or found answered in the literature . however , arc protein at 1 - 2 hr is likely translated from new transcripts synthesized as a consequence of the training experience . this hypothesis is congruent with data suggesting a very rapid turnover of arc , on the scale of minutes to a few hours [ 42 , 43 ] . although spatial water maze and contextual fear conditioning are two different hippocampus - dependent tasks , the mrna and protein time courses for these two studies produce a logical sequence when combined , such that a peak increase for arc mrna at 30 min is followed by maximal arc protein levels at 90 min . multiple waves of increased protein levels may follow a training experience , and the number of phases depends upon the training parameters used [ 44 , 45 ] . for instance , biphasic expression has been measured for other proteins in response to fear conditioning ; however , our data suggest that the expression of arc and zif268 protein in the hippocampus is monophasic following acquisition of conditioned fear . monophasic expression of arc is not necessarily true for all behavioral paradigms , as ramirez - amaya et al . found arc protein to be expressed in two phases in ca1 and ca3 of the hippocampus first phase at 30 min to 2 hr and the second phase at 8 and 24 hr following a single exploration session . in the same study , they found a single wave of arc protein in the dentate gyrus that lasted up to 8 hr post exploration , which is similar to the primarily monophasic expression of arc protein in the dentate gyrus reported here . although the increase was not significant , arc protein did seem to show a moderate increase 24 hr after training . since these animals were killed at varying times during the day , we can conclude that this increase is not due to set circadian patterns in ieg expression . however , memory does seem to have a time - of - day dependence , such that testing at a similar time of day as when training occurred produces better recall . recently , some attention has been given to exploring clock - genes in structures such as the hippocampus that may influence the expression of other proteins and may in effect create time - of - day dependence in memory . circadian fluctuation in protein phosphorylation has been previously observed in the hippocampus for mapk , and this signaling pathway has been implicated in arc translation . whether arc or any ieg is regulated in such a manner is purely speculation at this point , but certainly it is an important consideration for understanding time - dependent changes in protein translation . the post training expression of arc and zif268 proteins in the dorsal hippocampus corresponds to the time window for protein synthesis - dependent memory consolidation . the transient nature of arc expression after training may be related to evidence indicating that arc mrna is targeted for nonsense - mediated mrna decay ( nmd ) as this gene contains two conserved 3-utr introns ( , reviewed in [ 7 , 19 ] ) . nmd is a translation - dependent decay mechanism that likely halts protein expression to produce finite protein levels that are temporally specific to the learning event . along with other degradation pathways , such as ubiquitin - dependent degradation by proteasomes , nmd probably restricts the protein composition to local activated synapses . the notion that the burst of arc protein expression is temporally linked to the learning event is further supported by studies reporting that the level of training - induced arc expression in the hippocampus is coupled with learning performance . for example , guzowski and colleagues demonstrated that the amount of hippocampal arc mrna was positively correlated with an animal 's performance in hippocampus - dependent water maze learning . furthermore , the same study revealed hippocampal arc mrna expression to be correlated with the spatial water maze task ( hippocampus - dependent ) but not with the nonspatial water maze task ( hippocampus - independent ) , indicating that arc expression is associated specifically with learning experiences . presumably , the increased induction of arc and zif268 proteins measured in the present study is the result of contextual processing and associative fear learning , respectively , as the dorsal hippocampus is important for the acquisition and initial consolidation of contextual fear memory . recent investigations on the molecular pathways leading to the induction of arc have focused on brain - derived neurotrophic factor ( bdnf ) , erk , and camp - pka activation . converging evidence indicates that arc is a downstream effector of bdnf activation [ 14 , 43 ] , and pka - dependent arc protein expression can be stimulated either through the activation of nmda receptors or gs - coupled dopamine or -adrenergic receptors [ 41 , 51 ] . recent work by bramham and colleagues suggests that the initiation of arc translation is the result of erk - mnk ( extracellular signal - regulated kinase - mitogen - activated protein kinase - interacting kinase ) signaling in the dentate gyrus , a structure where we observed increases in arc protein . pharmacological blockade of erk with the mek inhibitor u0126 abolishes ltp and arc protein expression ; however , similar results are not observed when mtorc1 ( mammalian target of rapamycin complex 1 ) signaling is inhibited by the application of the protein - synthesis inhibitor rapamycin . comparatively , less is known about the interaction of zif268 and arc following synaptic activation . zif268 is a transcriptional regulator , and it is noteworthy that in our study the peak in zif268 expression at 60 min occurs just prior to the peak in arc at 90 min . the time course for these proteins presented here corroborates earlier evidence that arc is a transcriptional target of zif268 , as the arc promoter has a functional ere ( egr response element ) . additionally , we showed that the levels of hippocampal arc and zif268 were correlated with one another following fear conditioning , which further supports the functional relationship between these two ieg products . work by others similarly found arc and zif268 mrna to be upregulated following spatial exploration , and these iegs are often detected in the same nucleus . these mrnas are correspondingly increased in the hippocampus following spatial water maze training , and their expression profiles are positively correlated within this brain structure . however , the relationship between arc and zif268 is not perfect , as arc protein increases we measured at 30 min are likely not the result of zif268 regulation and are believed to be induced by one of the other pathways implicated in arc expression . further research is needed to determine what role zif268 has in the induction of arc that contributes to synaptic modifications underlying long - term memory . our data suggest that these two proteins interact soon after a learning experience , most likely orchestrating postsynaptic changes to increase synaptic efficacy and support memory formation . in summary , arc and zif268 proteins are transiently increased in the dorsal hippocampus in a manner that suggests that these two proteins work together to support contextual learning in fear conditioning . although we did not establish a causal relationship between associative learning and arc and zif268 protein expression , we have shown that these iegs are consistently upregulated in the hippocampus during the period when memory for context is being consolidated . the time frame of behaviorally - induced arc and zif268 protein in the dorsal hippocampus corresponds to a critical time window in which protein synthesis is required for memory consolidation . further , immunostaining revealed an increase in expression of arc and zif268 protein in the same hippocampal neurons after fear conditioning , suggesting a relationship between arc and zif268 colocalization in consolidation of a contextual fear memory .

memory consolidation requires transcription and translation of new protein . arc , an effector immediate early gene , and zif268 , a regulatory transcription factor , have been implicated in synaptic plasticity underlying learning and memory . this study explored the temporal expression profiles of these proteins in the rat hippocampus following fear conditioning . we observed a time - dependent increase of arc protein in the dorsal hippocampus 30-to-90-minute post training , returning to basal levels at 4 h. zif268 protein levels , however , gradually increased at 30-minute post training before peaking in expression at 60 minute . the timing of hippocampal arc and zif268 expression coincides with the critical period for protein synthesis - dependent memory consolidation following fear conditioning . however , the expression of arc protein appears to be driven by context exploration , whereas , zif268 expression may be more specifically related to associative learning . these findings suggest that altered arc and zif268 expression are related to neural plasticity during the formation of fear memory .

1. Introduction 2. Materials and Methods 3. Results 4. Discussion 5. Conclusions

PMC5133719

neurofibromatosis type 1 ( nf1 ) is an autosomal dominant genetic disorder that affects approximately 1 in 3000 births . individuals with nf1 are predisposed to developing abnormalities in a number of body systems ; individually and cumulatively they can have a significant impact on quality of life . for example , skeletal deformities such as scoliosis and pseudarthroses , are uncommon but can be associated with considerable morbidity . benign , malignant , and disfiguring tumors ( termed neurofibromas ) are characteristic of the condition and can be challenging to manage . neuropsychological impairments in nf1 , such as executive dysfunction , inattention , specific learning disorder and reduced social competency , can result in reduced social participation and social isolation . the clinical diagnosis of nf1 relies on fulfilling at least two of the seven diagnostic criteria ; caf au lait macules , skinfold freckling , neurofibromas , lisch nodules , optic pathway tumors , bone dysplasia or a family history . notably , some of these features are congenital in origin , while some manifest over time at characteristic developmental stages . skeletal muscle and motor deficits , such as reduced muscle size , muscle weakness , and poor co - ordination however , recent preclinical and clinical studies have indicated a primary role for the nf1 gene product , neurofibromin , in muscle growth and metabolism . neurofibromin has been characterized as a gtpase activating protein that is a negative regulator of the ras gtpase . loss of functional neurofibromin leads to a dose - dependent increase in ras signaling , which can profoundly affect cell proliferation , differentiation , and function [ reviewed in . in this review we will discuss the evidence for neurological and cognitive deficits contributing to the motor / muscle phenotype . this review also refocuses discussion on previous studies that describe a vital role for nf1 in skeletal muscle development , as well as the emerging pre - clinical models that suggest a novel regulatory role for nf1 in muscle metabolism . children with nf1 have been shown to have a generalized decrease in intellectual function ( mean iq in the low 90 s ) as well as a higher rate of specific cognitive deficits ( i.e. attention , visuoperceptual skills , language and executive function ) . neurocognitive studies have also frequently reported impairment in motor abilities in individuals with nf1 ( table 1 ) , including mild impairment in gross and fine motor tasks[14 - 16 ] and impairment on the beery test of visuomotor integration , which requires subjects to draw increasingly difficult shapes and figures[17 - 19 ] . individuals with nf1 also present with deficits in a range of functional tasks that likely have significant impact on quality of life . for example , significant impairment in balance , muscle strength , and upper limb co - ordination in nf1 has been observed using the bot-2 test of motor proficiency . mild to moderate deficits in manual dexterity , balance , and ball handling skills , deficient motor timing and reaction time , reduced fine motor speed , and impaired handwriting in nf1 children has also been reported . gait assessment was performed in 46 children and adolescents with nf1 ( ages 7 - 17yrs ) using the gaitrite electronic walkway , and results were compared with a battery of cognitive tests , including the wechsler intelligence scale for children and sub - tests from the cambridge automated neuropsychological test battery . the largest correlations were found between deficits in gait width and spatial working memory ( r=0.594 , p<0.01 ) , and deficits in running speed and agility with impaired strategy generation ( r=0.549 , p<0.01 ) , supporting speculation of a link between nf1 motor deficits and abnormal central nervous system ( cns ) function . while the mechanisms of interaction between the cns and peripheral nervous system ( pns ) and motor dysfunction are unclear , structural and functional brain abnormalities are a feature of the condition that may contribute to motor impairments . neurofibromin plays a significant role in the developing brain , with loss of expression resulting in increased cell proliferation and differentiation , ultimately impacting morphology . a recurrent finding has been an increase in total brain volume , involving both grey and white matter . diffusion weighted magnetic resonance imaging ( mri ) in individuals with nf1 indicates reduced white matter integrity in a number of regions closely linked to motor function . these include the : ( 1 ) corpus callosum , ( 2 ) caudate nucleus ; a sub - region of the basal ganglia involved in goal - direct behavior and voluntary movement , and ( 3 ) thalamus ; a sub - cortical nuclear complex that receives and relays cortical and sub - cortical inputs that sub - serve sensory and motor mechanisms , as well as cognitive abilities . volumetric studies report these structures as abnormally large in nf1 cohorts , suggesting a reduced signal - to - noise ratio . moore et al have further shown significant associations between increased corpus callosum size and reduced motor performance in children with nf1 . there is also mounting evidence for functional abnormalities within the thalamus and caudate in individuals with nf1 . both adult and pediatric positron emission tomography studies report thalamic hypometabolism , suggesting reduced thalamic signal processing , and a recent event - related functional mri study identified abnormal right caudate activation during a spatial working memory task ; a cognitive ability significantly associated with impaired gait in nf1 . individuals with nf1 also commonly show focal areas of high t2 signal intensity on mri , which have been associated with reduced fine motor skill . mechanistically , one clinical study has examined sensory and motor neuropathy in nf1 as possibly contributory . electrophysiological measures in 39 individuals with nf1 aged 10 - 56 revealed motor polyneuropathy was a rare manifestation , and while abnormalities in multimodal evoked potentials ( visual , auditory and sensory ) were seen commonly , many were associated with tumors or lesions . further clinical studies correlating neurological assessments with strength and other motor outcomes are needed to define the influence of the cns and pns in the nf1 motor phenotype . while preclinical mouse models have been used to investigate mechanisms underlying some neurocognitive deficits , a relationship between cognition and motor performance has not yet been defined in these systems . abnormalities such as the learning and attention deficits have been extensively examined in the nf1 mouse[38 - 43 ] . for example , increased gaba release in the hippocampus has been shown to underlie learning deficits , and can be rescued by inhibition of erk signaling , while lovastatin treatment has been shown to rescue deficits in learning and attention . however , interactions between these deficits and motor function remain unknown . the most significant motor deficit seen in this mouse line was impaired grip strength using a hanging wire test , and there was no demonstration of a neurocognitive basis for this result . furthermore , this line failed to show any deficiencies in motor performance tests linked to cerebellar function . decreased dopamine levels in the striatum have also been identified in a further nf1 mouse model with bi - allelic nf1 inactivation in glia . these mice exhibited reduced exploratory behaviors as well as selective and non - selective attention abnormalities , which were rescued by pharmacologic intervention to restore dopamine levels . while speculative , abnormal dopamine levels may underlie some of the motor impairments observed in individuals with nf1 . indeed some gait characteristics identified in a pediatric nf1 cohort , including a shorter step length and longer step time , resemble those seen in early parkinson disease ; a disorder associated with reduced dorsal striatal dopamine levels . further insight into the interactions between neurocognitive development and motor deficits may come from more advanced mouse models of conditional double inactivation of nf1 in neurons . in 2005 , stevenson et al . published data from an analysis of 40 individuals with nf1 using peripheral quantitative computed tomography ( pqct ) scanning . individuals with nf1 presented with a significant reduction in muscle cross - sectional area compared to age matched controls . comparative findings were seen in a pediatric nf1 cohort where lean tissue was measured using dual - energy x - ray absorptiometry ( dexa ) . children with nf1 had a significantly reduced lean tissue mass . while reduced muscle size may imply a reduction in strength , muscle functional outcomes were not assessed in these primarily radiographic studies . however , in a seminal 2009 study , souza et al performed hand grip dynamometry testing of 21 subjects ( age 7 - 60 yrs ) with nf1 compared to gender , aged , and physical activity matched controls , and demonstrated a significant reduction in grip strength in the nf1 cohort . findings of muscle functional impairment in nf1 have been subsequently reported in clinical studies ( table 2 ) . reduced strength of the hip extensor muscles has been described using hand held dynamometry . likewise , a 2013 trial investigating lower body muscle function in nf1 children , found that jumping force ( n / kg ) and jumping power ( w / kg ) were both significantly reduced . a cohort of 17 individuals with nf1 , along with gender , age , and bodyweight matched control subjects , underwent maximal oxygen consumption ( vo2 max ) testing , a measure of maximal aerobic exercise capacity . individuals with nf1 had a reduced vo2 max as well as a reduced maximal systolic blood pressure . while the authors acknowledged that there was some difficulty in recruiting activity matched controls , it remains to be thoroughly investigated whether reduced physical activity accounts for reduced exercise capacity in nf1 . given the mounting evidence for motor and muscular deficits in nf1 , continued exercise studies of this kind are warranted , particularly those assessing quality of life outcome measures . muscle size and muscle function in nf1 . insight gained from research into nf1 muscle function may be applicable to other related genetic diseases . nf1 belongs to the rasopathy family of diseases , which includes costello syndrome , cardiofaciocutaneous syndrome , and noonan syndrome . in a 2012 clinical study , reduced grip strength and muscle weakness was identified as a common feature of them all . it is unclear whether these conditions share a common mechanism for muscle weakness downstream of altered ras signaling . however , if this is the case , any successful pathway - targeted interventions that improve nf1 muscle performance , may have broad clinical applicability to other rasopathies . early evidence suggesting a critical role for nf1 in skeletal muscle development came from in vitro experiments assessing gene expression during myoblast differentiation . levels of nf1 mrna , and neurofibromin were elevated during differentiation , and a concomitant decrease in activated p21-ras was observed . double inactivation of nf1 was found to be embryonically lethal , and nf1 null embryos showed underdeveloped cardiac and skeletal muscle . however , it remained unclear whether these effects on muscle were secondary to some other failure in the developmental program , and it was nt until recently that a key role for nf1 in muscle was demonstrated in an animal model . developed a limb - specific nf1 knockout mouse ( nf1prx1 ) using a prx1-cre transgene to drive deletion of nf1 in cells of the mesenchymal lineage . furthermore , consistent with in vitro data , analysis of mutant embryos revealed hyperactive ras / mapk signaling , and impaired myoblast differentiation in the developing limbs . while the nf1prx1-/- mouse model demonstrated the requirement of nf1 for normal limb muscle development , prx1-cre driven recombination is not restricted to the muscle lineage . thus , the inactivation of nf1 in other mesenchymal tissues including adipocytes , connective tissue , and bone , were potential confounders to interpretation . to overcome this , a skeletal muscle specific nf1 knockout mouse ( nf1myod ) was subsequently generated , by crossing the myod - cre transgenic mouse with the nf1-flox line . homozygous nf1 inactivation in muscle was lethal in the first week of life , and while pups were born at normal bodyweight , they had stunted growth and a high rate of maternal infanticide was observed . electron microscopy ( em ) imaging of nf1myod muscle specimens showed no evidence of cytoarchitectural abnormalities , including protein aggregates , myofibrillar disruption , or z - line streaming . while nf1prx1-/- muscle has been described as dystrophic , this may be a misnomer , as neither mouse model nor patient muscle biopsies have been characterized as having progressive loss of cytoskeletal or membrane protein integrity . em of 3-day old nf1myod muscle samples unexpectedly revealed excessive accumulations of intramyocellular lipid , which was subsequently confirmed by oil red o staining . this led to speculation that nf1 may have a key role in the regulation of muscle lipid metabolism . analysis of adult nf1prx1-/- muscle samples revealed similarly elevated triglyceride levels , 10-fold that of controls . increased fatty acid synthesis may underlie these accumulations in the nf1prx1-/- mice , as a substantive increase in the expression of fatty acid synthase was observed . metabolic dysregulation was also seen for a range of mitochondrial enzymes , including succinate dehydrogenase ( sdh ) , -hydroxyacyl - coa dehydrogenase ( bhad ) , and medium - chain acyl - coa dehydrogenase ( mcad ) . the expression of mitochondrial fatty acid transport protein carnitine palmitoyl transferase-1 ( cpt-1 ) , and membrane transport proteins , cd36 , and fatty acid transport protein 4 ( fatp4 ) were also reduced . for example , it is difficult to separate any primary deficits responsible , from any downstream or compensatory metabolic changes in the mature nf1prx1-/- muscle . interestingly , analysis of neonatal nf1myod muscle showed only the intramyocellular lipid phenotype , suggesting that lipid accumulation may be the initiating factor , and that subsequent molecular and metabolic dysregulation is temporal in nature . although the precise mechanisms remain unknown , these mouse data demonstrate a novel metabolic regulatory role for neurofibromin in muscle . one possibility is that nf1 muscle has commonalities with the lipid storage myopathies ( lsms ) , which also present with progressive muscle weakness and muscle lipid accumulation . if parallels are found to exist with the lsms , this may provide insight into potential interventions for nf1 . for example , primary carnitine deficiency ( pcd ) leads to an impairment of lipid transport into the mitochondria , a resultant accumulation of lipid droplets , and muscle weakness . pcd patients have been successfully treated with high dose l - carnitine supplementation . while such speculation is attractive to entertain , evidence for lipid accumulation in human nf1 samples has not been firmly established . identifying lipid accumulation in human nf1 muscle biopsies will be an important goal for researchers in order to demonstrate the relevance of these murine models . a number of historical and recent studies raise important questions regarding the role of the nf1 gene in muscle development and function . in the 1990s , gutmann et al identified cardiac and skeletal muscle isoforms of nf1 . to date , the functional importance of these isoforms remains unclear . it is possible that they have a unique role in the regulation of muscle development and/or metabolism . isoform - specific knockout models may be able to provide insight into the role of alternatively spliced variants of neurofibromin in muscle . furthermore , the genetics of nf1 in muscle are yet to be elucidated . some manifestations of nf1 are associated with heterozygosity ( haploinsufficiency ) and others with double inactivation . for example , local double inactivation has been observed in nf1 tumors as well as in tibial pseudarthrosis tissue . to date , no studies have addressed the potential double inactivation of nf1 in muscle . myofibers are multinucleated cells where sporadic double inactivation in individual nuclei could have unpredictable effects . analyzing double inactivation in myofibers may be challenging , but fluorescent in situ hybridization for nf1 on human muscle biopsies could be a feasible approach . one confounding factor in interpretation of clinical data is that the cognitive , motor control and psycho - social effects of nf1 may indirectly influence physical activity . recent data indicates that children with nf1 have reduced participation in formal and informal physical activities . finding ways to accommodate this into both studies of the underlying biological weakness and strategies for exercise - based intervention may have its own challenges . one intriguing possibility is that nf1 mutations and associated muscle weakness may increase the risk or severity of other related or unrelated conditions . for example , spinal complications such as scoliosis can be a major source of morbidity in nf1 . late onset scoliosis has been described in adolescents with nf1 with no underling bone abnormalities , and it is possible that weakness or hypotonia may be contributory . in addition , two recent case reports suggest the potential for interactions between nf1 and other muscle - related genetic conditions . one report describes an individual with digeny for mutations in nf1 and ryanodine receptor 1 , resulting in myopathy . the other shows a previously unreported mutation in an nf1 locus leading to mitochondrial complex i deficiency , hypotonia , and developmental delay . continued identification of clinical presentations of this kind may provide useful insight . from a therapeutic standpoint , it will be critical to ascertain the capacity of exercise regimes to modify the muscle and motor phenotypes in nf1 . the current literature is limited to a single case study that reports improved jumping and throwing performance in children with nf1 , following a plyometric training program . however , this study was small ( n=3 ) , the children were of variable ages and genders , and the study lacked a control cohort . larger randomized and controlled exercise intervention studies are greatly needed to answer questions regarding the effects of exercise training on motor control , muscle size and strength , fatigue , and quality of life outcomes in individuals with nf1 . while physical therapies are often favored if they can produce significant benefits , pathway - specific pharmacological interventions remain a potential treatment for those found unresponsive to exercise . the ras - mek - erk pathway is the canonical pathway in nf1 , but this signaling cascade is also recognized for its role in muscle . constitutively active mek has been shown to directly bind and repress myogenic transcription factors , inhibiting myogenic differentiation in vitro . furthermore , in a cancer setting , mek / erk inhibition has been shown to be anabolic for skeletal muscle in humans and mice . this pathway is likely to be of particular relevance for interventions aiming to improve muscle function in nf1 . souza et al . can be credited for initiating an explosion of activity in the field of nf1 muscle research in 2009 . since then , a range of clinical studies have confirmed reduced motor performance and/or muscle impairment in individuals with nf1 . while there are associations between neurological abnormalities and the nf1 muscle / motor phenotype , the mechanisms underlying these interactions are yet to be elucidated , and remain an area for further research . mechanistically , recent studies using genetically modified mouse models have provided strong evidence for a metabolic regulatory role for neurofibromin in muscle , likely contributing to the phenotype . this review has also reflected on a number of historically overlooked or potentially undervalued studies . the key roles for nf1 in muscle development are preceded by studies showing increases in nf1 gene and protein expression during myogenic differentiation . the findings of deficits in muscle strength are similarly preceded by radiographic studies showing decreases in muscle mass . however , it is the studies describing muscle - specific nf1 isoforms that are perhaps the most relevant to revisit , as these isoforms may have as yet undefined roles in the nf1-muscle phenotype . in summary , there have been significant advances in our understanding due to a co - ordination of basic and clinical research studies .

neurofibromatosis type 1 ( nf1 ) is a genetic neurocutaneous disorder with multisystem manifestations , including a predisposition to tumor formation and bone dysplasias . studies over the last decade have shown that nf1 can also be associated with significant motor deficits , such as poor coordination , low muscle tone , and easy fatigability . these have traditionally been ascribed to developmental central nervous system and cognitive deficits . however , recent preclinical studies have also illustrated a primary role for the nf1 gene product in muscle growth and metabolism ; these findings are consistent with clinical studies demonstrating reduced muscle size and muscle weakness in individuals with nf1 . currently there is no evidence - based intervention for nf1 muscle and motor deficiencies ; this review identifies key research areas where improved mechanistic understanding could unlock new therapeutic options .

Introduction Neurological and cognitive deficits may contribute to impaired motor skill Reduced muscle size and impaired muscle function in NF1 None None Key questions remain unanswered Conclusion

PMC4881392

rsv in and its mutant forms were overexpressed in escherichia coli bl21 ( de3 ) and purified as previously described . the proteins were stored in aliquots at 80c in 20 mm hepes - naoh ( ph 7.5 ) , 1.0 m nacl , 20m zncl2 , 5 mm 2-mercaptoethanol and 10% ( w / v ) glycerol . the branched dna substrate mimicking the product of the concerted integration reaction was obtained by annealing three synthetic oligonucleotides ( integrated dna technologies ) . a similar strategy had been used previously to prepare a pfv in - dna complex , which demonstrated that the in - dna complex assembled on the designed integration product has essentially an identical structure to the equivalent complex formed via the forward integration reaction . the viral dna branches carrying the high - affinity gain - of - function mutant rsv u3 long terminal repeat ( ltr ) sequence ( gu3 ) were attached to the target dna duplex with a palindromic 6 bp spacer to generate a fully symmetrized structure . to prepare the rsv in - dna complexes for crystallization , 30 m half - site dna substrate was mixed with 120 m rsv in in 20 mm hepes - naoh ( ph 7.5 ) , 500 mm nacl , 20% ( w / v ) glycerol , and 1 mm tris-(2-carboxyethyl)phosphine ( tcep ) . the mixture was dialyzed against low salt buffer ( 20 mm hepes - naoh ph 7.5 , 125 mm nacl , 20% ( w / v ) glycerol , 1 mm tcep ) at 25c for overnight . at the end of this first dialysis , the mixture was subsequently dialyzed against high salt buffer ( 20 mm mes - naoh ph 6.0 , 1.2 m nacl , 20% ( v / v ) dimethyl sulfoxide ( dmso ) , 5% ( w / v ) glycerol , 1 mm tcep ) at 25c for 24 hours . at the end of this second dialysis , the solubilized rsv in - dna complex ( intasome ) was purified through size - exclusion chromatography ( superdex 200 10/300 gl , ge healthcare ) running with 20 mm mes - naoh ph 6.0 , 1.2 m nacl , 20% ( v / v ) dmso , 5% ( w / v ) glycerol , and 1 mm tcep . the isolated intasome remains stable in the high - salt condition containing 1.2 m nacl that precludes complex formation , suggesting that once the intasome forms , it is kinetically trapped . the solubility - enhancing rsv in mutation f199k completely abolished intasome formation . for the sec - mals analysis , a modified condition was used for the intasome re - solubilization and isolation for better baseline stability ( extended data fig . the rsv intasome assembled through dialysis and purified by size - exclusion chromatography was concentrated to 46 mg / ml using centrifugal concentrator ( amicon ) . various combinations of the lengths of the viral dna ( ranging from 16 bp to 25 bp ) and flanking target dna ( ranging from 14 bp to 22 bp , corresponding to the full target dna lengths of 34 bp to 50 bp ) were screened in crystallization trials . the extensive screening yielded only one crystal form with a specific combination of 22-base ( length of the non - transferred strand ) viral dna branches and 16 base - pair ( bp ) target dna flanks on either side of the central six bp spacer ( fig . dna substrates with two slightly different target sequences were used ( 5-aatgttgtcttatgcaatactc-3/5-gagtattgcataagacaacagtgcacgaatcttgaagacact-3/5-agtgtcttcaagattc-3 , or 5-aatgttgtcttatgcaatactc-3/5-gagtattgcataagacaacagtcgaccaaccttcaacttagc-3/5-gctaagttgaaggttg-3 ) , and they produced essentially the same crystals . the rsv intasome crystals were grown through reverse vapor diffusion in hanging drops at 22c , by mixing 1.5 l in - dna complex solution with 1.5 l reservoir solution ( 3.2 m sodium formate ) . crystals appeared within 35 days and reached a size of ~150300 m in 3~5 days . even though the rsv intasome crystals initially diffracted x - ray poorly ( ~ 10 ) , soaking the crystals with a metatungstate cluster compound dramatically improved the resolution ( extended data fig . the tungsten cluster was later found to bind between in dimers from separate intasome complexes to mitigate crystal lattice disorder . the crystals were soaked overnight with 0.15 mm metatungstate cluster na6[h2w12o40 ] in a stabilization buffer consisting of 3.2 m sodium formate , 16 mm mes - naoh ph 6.0 , 0.8 m nacl , 16% ( v / v ) dmso , 4% ( w / v ) glycerol , and 1 mm tcep . after soaking , the crystals were cryo - protected in 3.2 m sodium formate , 16 mm mes ph 6.0 , 0.8 m nacl , 16% ( v / v ) dmso , 12% ( w / v ) glycerol , and 1 mm tcep , and were frozen by rapid immersion in liquid nitrogen . the full - length wild - type rsv in(1286 ) , the c - terminally truncated rsv in(1270 ) , and its various mutant forms tested produced essentially the same crystals with indistinguishable x - ray diffraction properties . x - ray diffraction data were collected at the advanced photon source northeastern collaborative access team beamlines ( 24-id - c / e ) and the advanced light source molecular biology consortium ( 4.2.2 ) beamline and processed using hkl2000 or xds . the rsv intasome crystals showed varied degrees of pseudo - merohedral twinning with twin operator [ l , k , h ] , owing to the very similar a and c unit cell dimensions of the primitive monoclinic lattice . thus , we screened a large number of crystals to identify ones that diffract to higher resolution and have smaller twin fractions . the structure of rsv intasome was determined by molecular replacement with phaser , using the rsv in ccd , ctd ( pdb i d : 4fw1 ) , and a 16 bp b - form dna as search models . 8 copies of ccd , one copy of ctd and three copies of dna molecules were located . refinement of the partial model revealed electron density for two copies of the metatungstate clusters . subsequent iterative model building using coot and refinement with phenix suite allowed placement of the remaining 7 copies of ctd , 8 copies of ntd generated using modeller based on hiv-1 ntd ( pdb i d : 1k6y ) , and building of the inter - domain linkers as well as the remaining parts of the dna molecule guided by the difference electron density maps . a third metatungstate cluster , which is more weakly bound compared to the first two , was positioned manually into residual density . the dna base - pairs and base - stacking restraints were used throughout the refinement . the geometry restraints for protein included the reference - model restraints for ccd and ctd based on the higher resolution rsv in structure ( 4fw1 ) , and the secondary structure and zinc - coordination restraints for ntd . atomic displacement parameters were refined with grouped b - factors per residue for protein and dna , and a total of 53 tls groups assigned by phenix . the asymmetric unit of the crystal contains one complete rsv intasome , which includes eight in molecules and two viral dna branches emanating from a strongly bent 38 bp target dna . the dataset used for the final refinement was from an rsv intasome crystal grown using selenomethionine - labeled rsv in ( 1270 ) with the following amino acid substitutions ; c23s , l112 m , l135 m , l162 m , l163 m , l188 m , and l189 m , which we confirmed to be active in concerted integration and inhibited by insti similarly to the wild - type rsv in , and a dna substrate carrying a nick at the middle of each target dna branch ( the 16-base dna strand shown in olive in fig . the nick occasionally facilitated crystal growth , but it was not necessary for crystallization and did not change the space group or the unit cell parameters compared to crystals grown without the nick . because this nick in the target dna is not biologically relevant , it is not shown in figs . twin refinement protocol was not used as the dataset used for the final refinement had a low ( less than 10% ) twin fraction . the summary of data collection and refinement statistics is shown in extended data table 1 . the paired - refinement procedure was performed in steps of 0.1 to determine the high - resolution limit ( extended data fig . the register of amino acids in the final model was verified by the selenium anomalous difference fourier peaks ( extended data fig . ramachandran analysis shows that 96.0 , 3.9 , and 0.1 % of the protein residues are in the most favored , allowed , and disallowed region , respectively . the ntd - ccd linker in some of the non - catalytic in molecules and the last four bp at the distal end of one of the viral dna molecules were not built due to poor electron density . rsv in and its mutant forms were overexpressed in escherichia coli bl21 ( de3 ) and purified as previously described . the proteins were stored in aliquots at 80c in 20 mm hepes - naoh ( ph 7.5 ) , 1.0 m nacl , 20m zncl2 , 5 mm 2-mercaptoethanol and 10% ( w / v ) glycerol . the branched dna substrate mimicking the product of the concerted integration reaction was obtained by annealing three synthetic oligonucleotides ( integrated dna technologies ) . a similar strategy had been used previously to prepare a pfv in - dna complex , which demonstrated that the in - dna complex assembled on the designed integration product has essentially an identical structure to the equivalent complex formed via the forward integration reaction . the viral dna branches carrying the high - affinity gain - of - function mutant rsv u3 long terminal repeat ( ltr ) sequence ( gu3 ) were attached to the target dna duplex with a palindromic 6 bp spacer to generate a fully symmetrized structure . to prepare the rsv in - dna complexes for crystallization , 30 m half - site dna substrate was mixed with 120 m rsv in in 20 mm hepes - naoh ( ph 7.5 ) , 500 mm nacl , 20% ( w / v ) glycerol , and 1 mm tris-(2-carboxyethyl)phosphine ( tcep ) . the mixture was dialyzed against low salt buffer ( 20 mm hepes - naoh ph 7.5 , 125 mm nacl , 20% ( w / v ) glycerol , 1 mm tcep ) at 25c for overnight . at the end of this first dialysis , the mixture was subsequently dialyzed against high salt buffer ( 20 mm mes - naoh ph 6.0 , 1.2 m nacl , 20% ( v / v ) dimethyl sulfoxide ( dmso ) , 5% ( w / v ) glycerol , 1 mm tcep ) at 25c for 24 hours . at the end of this second dialysis , the solubilized rsv in - dna complex ( intasome ) was purified through size - exclusion chromatography ( superdex 200 10/300 gl , ge healthcare ) running with 20 mm mes - naoh ph 6.0 , 1.2 m nacl , 20% ( v / v ) dmso , 5% ( w / v ) glycerol , and 1 mm tcep . the isolated intasome remains stable in the high - salt condition containing 1.2 m nacl that precludes complex formation , suggesting that once the intasome forms , it is kinetically trapped . the solubility - enhancing rsv in mutation f199k completely abolished intasome formation . for the sec - mals analysis , a modified condition was used for the intasome re - solubilization and isolation for better baseline stability ( extended data fig . for crystallization , the rsv intasome assembled through dialysis and purified by size - exclusion chromatography was concentrated to 46 mg / ml using centrifugal concentrator ( amicon ) . various combinations of the lengths of the viral dna ( ranging from 16 bp to 25 bp ) and flanking target dna ( ranging from 14 bp to 22 bp , corresponding to the full target dna lengths of 34 bp to 50 bp ) were screened in crystallization trials . the extensive screening yielded only one crystal form with a specific combination of 22-base ( length of the non - transferred strand ) viral dna branches and 16 base - pair ( bp ) target dna flanks on either side of the central six bp spacer ( fig . dna substrates with two slightly different target sequences were used ( 5-aatgttgtcttatgcaatactc-3/5-gagtattgcataagacaacagtgcacgaatcttgaagacact-3/5-agtgtcttcaagattc-3 , or 5-aatgttgtcttatgcaatactc-3/5-gagtattgcataagacaacagtcgaccaaccttcaacttagc-3/5-gctaagttgaaggttg-3 ) , and they produced essentially the same crystals . the rsv intasome crystals were grown through reverse vapor diffusion in hanging drops at 22c , by mixing 1.5 l in - dna complex solution with 1.5 l reservoir solution ( 3.2 m sodium formate ) . crystals appeared within 35 days and reached a size of ~150300 m in 3~5 days . even though the rsv intasome crystals initially diffracted x - ray poorly ( ~ 10 ) , soaking the crystals with a metatungstate cluster compound dramatically improved the resolution ( extended data fig . the tungsten cluster was later found to bind between in dimers from separate intasome complexes to mitigate crystal lattice disorder . the crystals were soaked overnight with 0.15 mm metatungstate cluster na6[h2w12o40 ] in a stabilization buffer consisting of 3.2 m sodium formate , 16 mm mes - naoh ph 6.0 , 0.8 m nacl , 16% ( v / v ) dmso , 4% ( w / v ) glycerol , and 1 mm tcep . after soaking , the crystals were cryo - protected in 3.2 m sodium formate , 16 mm mes ph 6.0 , 0.8 m nacl , 16% ( v / v ) dmso , 12% ( w / v ) glycerol , and 1 mm tcep , and were frozen by rapid immersion in liquid nitrogen . the full - length wild - type rsv in(1286 ) , the c - terminally truncated rsv in(1270 ) , and its various mutant forms tested produced essentially the same crystals with indistinguishable x - ray diffraction properties . x - ray diffraction data were collected at the advanced photon source northeastern collaborative access team beamlines ( 24-id - c / e ) and the advanced light source molecular biology consortium ( 4.2.2 ) beamline and processed using hkl2000 or xds . the rsv intasome crystals showed varied degrees of pseudo - merohedral twinning with twin operator [ l , k , h ] , owing to the very similar a and c unit cell dimensions of the primitive monoclinic lattice . thus , we screened a large number of crystals to identify ones that diffract to higher resolution and have smaller twin fractions . the structure of rsv intasome was determined by molecular replacement with phaser , using the rsv in ccd , ctd ( pdb i d : 4fw1 ) , and a 16 bp b - form dna as search models . 8 copies of ccd , one copy of ctd and three copies of dna molecules were located . refinement of the partial model revealed electron density for two copies of the metatungstate clusters . subsequent iterative model building using coot and refinement with phenix suite allowed placement of the remaining 7 copies of ctd , 8 copies of ntd generated using modeller based on hiv-1 ntd ( pdb i d : 1k6y ) , and building of the inter - domain linkers as well as the remaining parts of the dna molecule guided by the difference electron density maps . a third metatungstate cluster , which is more weakly bound compared to the first two , was positioned manually into residual density . the dna base - pairs and base - stacking restraints were used throughout the refinement . the geometry restraints for protein included the reference - model restraints for ccd and ctd based on the higher resolution rsv in structure ( 4fw1 ) , and the secondary structure and zinc - coordination restraints for ntd . atomic displacement parameters were refined with grouped b - factors per residue for protein and dna , and a total of 53 tls groups assigned by phenix . the asymmetric unit of the crystal contains one complete rsv intasome , which includes eight in molecules and two viral dna branches emanating from a strongly bent 38 bp target dna . the dataset used for the final refinement was from an rsv intasome crystal grown using selenomethionine - labeled rsv in ( 1270 ) with the following amino acid substitutions ; c23s , l112 m , l135 m , l162 m , l163 m , l188 m , and l189 m , which we confirmed to be active in concerted integration and inhibited by insti similarly to the wild - type rsv in , and a dna substrate carrying a nick at the middle of each target dna branch ( the 16-base dna strand shown in olive in fig . the nick occasionally facilitated crystal growth , but it was not necessary for crystallization and did not change the space group or the unit cell parameters compared to crystals grown without the nick . because this nick in the target dna is not biologically relevant , it is not shown in figs . twin refinement protocol was not used as the dataset used for the final refinement had a low ( less than 10% ) twin fraction . the summary of data collection and refinement statistics is shown in extended data table 1 . the paired - refinement procedure was performed in steps of 0.1 to determine the high - resolution limit ( extended data fig . the register of amino acids in the final model was verified by the selenium anomalous difference fourier peaks ( extended data fig . ramachandran analysis shows that 96.0 , 3.9 , and 0.1 % of the protein residues are in the most favored , allowed , and disallowed region , respectively . the ntd - ccd linker in some of the non - catalytic in molecules and the last four bp at the distal end of one of the viral dna molecules were not built due to poor electron density . the secondary structure elements for rsv in are color - coded based on the three in domains similarly to fig . a , the half - site ( gaped duplex ) substrate prepared by annealing three oligonucleotides dimerizes via the self - complementary 6-base spacer sequence ( underlined ) to form a branched structure mimicking the product of the concerted integration reaction ( fig . viral dna nucleotides are numbered , and some of the structural elements of rsv in involved in the viral dna interactions are shown . c , x - ray diffraction pattern after the metatungstate - soaking ( see method for details ) . is perpendicular to the two - fold screw ( b ) axis of the monoclinic lattice , which lies horizontally . f , paired - refinement analysis to assess the resolution limit of the rsv intasome diffraction data . for each pairwise comparison , model refinements were run at two different resolution limits and the r - factors calculated for a common ( lower ) resolution cutoff were compared . a , a representative size - exclusion chromatography ( sec ) profile for rsv intasome , overlaid with that for a mixture of molecular weight markers . b , sec profiles for rsv intasomes formed with in of varying c - termini . c , sec - mals ( multi - angle light scattering ) analysis of rsv intasome . the intasome formed with rsv in ( 1269 aa ) was separated by sec in a modified condition containing 20 mm hepes ph 7.5 , 1.0 m nacl , 5 % glycerol , and 1.0 mm tcep . the absolute molecular mass was determined by light scattering using in - line detectors described previously . a similar sec - mals analysis of the intasome formed with wt full - length rsv in ( 1286 aa ) yielded a molecular mass of 268 kda ( n=2 , data not shown ) . the calculated mass of an intasome containing eight rsv in ( 1269 or 270 ) molecules is ~288 kda . d , chemical cross - linking analysis of rsv intasome . the rsv intasome and free in ( 1269 aa ) were purified by size - exclusion chromatography in the running buffer : 20 mm hepes ( ph 7.5 ) , 1.0 m nacl , 5 % glycerol , and 1.0 mm tcep . the peak fractions of the intasome and in were cross - linked with the indicated amount of ethylene glycol bis - succinimidylsuccinate ( egs ) as described previously and analyzed by sds - page . the majority of cross - linked species within the intasome were larger than a tetramer . the nupage 412% gradient gel with a mes - based sds - page running buffer was used . anomalous difference fourier maps calculated using the data collected on selemomethionine - labeled rsv intasome , contoured at 3.5 ( blue mesh ) or 5.0 ( orange mesh ) . b , c , close - up view of a proximal ( b ) and distal ( c ) in dimer , respectively . a , b , protein arrangement in the octameric rsv intasome . the inner and outer subunit of one proximal in dimer is colored in green and cyan , respectively , with the catalytic triad ( dde ) of the inner subunit shown in red . c , a close - up view around the active site of the inner in subunit in the rsv intasome . the dna strands are colored as in fig . 1 , and the catalytic triad residues ( dde ) the color scheme follows that used for the proximal in dimers of rsv in in ( a , b ) . f , a close - up view around the active site of the inner in subunit in the pfv intasome ( pdb i d : 3os0 ) . simulated annealing composite omit 2mfodfc density contoured at 1.0 , shown for area within 3.5 from any protein or dna atom in the final model . in a and b , electron densities around protein and dna are colored differently ( blue and green , respectively ) . a , b , dna structure in the rsv ( a ) or pfv ( b ) intasome , alternatively referred to as the strand - transfer complex ( stc ) . c , a comparison of dna structures between the rsv and pfv intasomes ( stcs ) . the integration product dnas ( rsv in cyan , pfv in red ) superimposed at a viral dna terminus are shown in three different view angles . note the significant deviation in overall trajectory of the target dna , and difference in the orientation of the second viral dna molecule . the region spanning the two integration sites on opposing target dna strands is 6 bp for rsv and 4 bp for pfv . the sigma a - weighted 2mfodfc map contoured at 1.5 ( a ) or 2.5 ( b ) , overlaid with the final model for the central 6 bp region between the two integration sites . data collection and refinement statistics statistics for the highest resolution shell are shown in parentheses . a video showing the overall structure of the rsv intasome and positioning of the three structural domains of in within the intasome .

integration of the reverse - transcribed viral dna into the host genome is an essential step in the lifecycle of retroviruses . retrovirus integrase ( in ) catalyzes insertions of both ends of the linear viral dna into a host chromosome 1 . in from hiv-1 and closely related retroviruses share the three - domain organization , consisting of a catalytic core domain flanked by n- and c - terminal domains essential for the concerted integration reaction . although structures of the tetrameric in - dna complexes have been reported for in from prototype foamy virus ( pfv ) featuring an additional dna - binding domain and longer interdomain linkers 25 , the architecture of a canonical three - domain in bound to dna remained elusive . here we report a crystal structure of the three - domain in from rous sarcoma virus ( rsv ) in complex with viral and target dnas . the structure shows an octameric assembly of in , in which a pair of in dimers engage viral dna ends for catalysis while another pair of non - catalytic in dimers bridge between the two viral dna molecules and help capture target dna . the individual domains of the eight in molecules play varying roles to hold the complex together , making an extensive network of protein - dna and protein - protein contacts that show both conserved and distinct features compared to those observed for pfv in . our work highlights diversity of retrovirus intasome assembly and provides insights into the mechanisms of integration by hiv-1 and related retroviruses .

METHODS RSV intasome preparation Crystallization Structure determination Extended Data Supplementary Material

PMC4215460

fibromyalgia is a chronic pain syndrome of unknown origin , estimated to affect 25% in all populations studied ( raspe , 1992 ; wolfe et al . , 1995 ; fibromyalgia is characterized by widespread pain , fatigue , poor sleep , and dyscognition ( wolfe et al . , 2010 ) and is often also associated with mood disorders such as depressive episodes and anxiety . although the underlying pathophysiology is not entirely understood , fibromyalgia has been associated with augmented central nervous system ( cns ) processing of nociceptive stimuli using both quantitative sensory testing ( qst ) and functional neuroimaging . ( gracely et al . , 2002 ; desmeules et al . , 2003 ; petzke et al . , 2003 ; smith et al . , context the notion of dysfunctional endogenous pain inhibition has been proposed to play a pivotal role in the genesis of chronic widespread pain . this is supported by studies demonstrating impaired or absent conditioned pain modulation ( cpm ) in these patients ( lautenbacher and rollman , 1997 ; vierck et al . , 2001 ; julien et al . , 2005 ; chalaye et al . , functional ( gracely et al . , 2002 ; giesecke et al . , 2004 ; jensen et al . , 2012 ) and structural ( kuchinad et al . , 2007 ; schmidt - wilcke et al . , 2007 ; 2013 ) brain imaging studies have shed some light on possible central mechanisms that might play a role in the genesis of chronic pain in fibromyalgia . one such approach is the investigation of fluctuations in blood oxygenation level dependent ( bold ) signals at rest , termed resting state functional connectivity ( rs - fc ) . only recently have changes in rs - fc been demonstrated in fibromyalgia , such as a hyper - connectivity between the default mode network ( dmn ) , a constellation of brain regions involved in self - referential thought , and the insular cortex ( ic ) , a brain region known to play a pivotal role in pain perception ( napadow et al . , 2010 ) . interestingly this hyper - connectivity may be a marker for chronic pain intensity as two independent trials have shown that decreases in connectivity between the dmn and ic following treatment were associated with reductions in clinical pain ( napadow et al . , 2012 ; harris et al . , 2013 ) . treatment of fibromyalgia in terms of a clinically relevant reduction in widespread pain is often challenging and both pharmacological and non - pharmacological approaches ( bernardy et al . , 2013 ) . food and drug administration for the treatment of pain in fibromyalgia : pregabalin , a compound that binds to the 2 subunit of a voltage dependent presynaptic calcium channel , and two selective serotonin ( 5-ht ) and norepinephrine ( ne ) reuptake inhibitors , milnacipran ( mln ) and duloxetine ( goldenberg et al . , 2010 ; schmidt - wilcke and clauw , 2010 ; schmidt - wilcke and clauw , 2011 ) . other drugs , such as tricyclic compounds ( tca , e.g. amitryptiline ) , viewed as non - selective 5-ht and ne reuptake inhibitors , have also repeatedly been shown to be efficacious in the treatment of fibromyalgia and are frequently used in pharmacological treatment regimens . the way 5-ht and ne reuptake inhibitors act to reduce pain is still a matter of debate as spinal , subcortical , and cortical mechanisms have all been proposed . however the overall effect of any of these individual treatments has been modest ( huser et al . , 2013 ) . moreover a key limitation in the treatment of fibromyalgia , and chronic pain in general , is that there are no reliable tools to guide treatment assignment for individual patients . as such recently our group has shown that chemical and functional imaging in fibromyalgia can be used to predict treatment response to pregabalin in fibromyalgia ( harris et al . , 2013 ) . here we sought to identify rs - fc patterns that might predict treatment response in fibromyalgia to the selective 5-ht and ne reuptake inhibitor mln . since preclinical studies have indicated that dual reuptake inhibitors are thought to have a favorable effect on endogenous pain inhibition which is believed to be dysfunctional in fibromyalgia ( lautenbacher and rollman , 1997 ; julien et al . , 2005 ) , we specifically focused on rs - fc to brain regions involved in antinociception and pain modulation such as : the periaqueductal gray ( pag ) , the rostral part of the anterior cingulate cortex ( acc ) , the dorsolateral prefrontal cortex ( dlpfc ) and the amygdala . inclusion criteria were : ( 1 ) meeting 1990 american college of rheumatology criteria for fm with chronic widespread pain for at least 6 months ; ( 2 ) 1870 years of age ; ( 3 ) non - lactating and non - pregnant ; ( 4 ) right handed ; ( 5 ) score between 40 and 90 mm ( inclusive ) on a 100 mm pain visual analogue scale ( vas ) ; ( 6 ) willing to withdraw from cns - active therapies marketed as antidepressants ( monoamine oxidase inhibitors , tricyclics , tetracyclics , selective serotonin reuptake inhibitors , norepinephrine reuptake inhibitors , and snris ) ; ( 7 ) willing to withdraw from stimulant medications such as those used to treat attention deficit disorder and attention deficit hyperactivity disorder ( e.g. mixed amphetamine salts , methylphenidate , dextroamphetamine ) or fatigue associated sleep apnea or shift work ( e.g. modafinil ) ; ( 8) willing to withdraw from anorectic agents such as diethylpropion , sibutramine , and phentermine ; and ( 9 ) if currently taking pregabalin and/or gabapentin , to remain on a stable dosage throughout the duration of the study . major exclusion criteria were : ( 1 ) significant risk of suicide ; ( 2 ) medical conditions including cardiac diseases , glaucoma , autoimmune disease , systemic infections ( e.g. human immunodeficiency virus , hepatitis ) , active cancer , pulmonary disease or dysfunction , unstable endocrine disease ( must be stable at least 3 months prior to study enrollment ) , unstable diabetes , unstable thyroid disease ; ( 3 ) pregnant or lactating ; ( 4 ) any other severe , acute , or chronic medical or psychiatric conditions that could increase risk or interfere with trial results ; ( 5 ) body mass index greater than 36 ; ( 6 ) treatment with any experimental agent , including mln , within 30 days before screening ; and ( 7 ) contraindications with mri procedures . all study participants gave written informed consent . the study protocol and informed consent documents were approved by the university of michigan institutional review board ( ann arbor , michigan ) and forest laboratories ( new york , ny ) . all imaging data were stored , validated , analyzed , and assessed for quality at the university of michigan independent of forest personnel . patient demographics , medications , and identification of inclusion for analysis are listed in table 1 . all patients were randomized in a double - blind , two - period crossover study of mln versus placebo ( fig . potential participants underwent an initial visit , prior to the first neuroimaging session , wherein they were evaluated for study criteria . after meeting inclusion / exclusion criteria , consenting patients were randomized to either mln first or placebo first for period 1 , and which followed 14 week washout period to withdraw from all excluded medications that could interfere with efficacy and neuroimaging measures . this washout period included a 1-week single - blind placebo run - in period to reduce the possibility of placebo effects during the first double - blind treatment period . following the placebo run - in period , all participants underwent their first neuroimaging scan ( pretreatment for period 1 ) which involved functional connectivity magnetic resonance imaging ( fcmri ) . following this initial scan , subjects randomized to receive mln in the first period , underwent dose escalation of mln up to 200 mg / day over the course of 2 weeks , with a maintained fixed dose for 4 weeks , at which time an identical post - treatment fcmri session was conducted . those subjects randomized to placebo for period 1 took matching placebo pills over the course of 6 weeks before undergoing an identical post - treatment fcmri session . all participants then entered a 1 week taper and 2 weeks of a placebo washout , during which time a placebo sugar pill was consumed daily . once the washout period was completed , all patients crossed over to the other study drug for period 2 ( i.e. those who had mln for period 1 received placebo for period 2 and vice versa . ) . placebo data included in all analyses came from either period 1 or period 2 ( depending on treatment order ) , and were included for all subjects regardless of treatment order . all subjects were informed that they would be dosed with mln or placebo at various times throughout the study , but were not told when they were transferred from one treatment to the other . we assessed treatment response for both clinical pain as well as evoked experimental pain in all participants prior to and following each study period . clinical pain was assessed with the short form of the brief pain inventory ( bpi ) which captures both pain severity ( bpi sev ) and interference due to pain ( bpi int ) ( cleeland and ryan , 1994 ) measured over the course of the previous week . changes in these components ( post minus pre ) were used as measures of treatment response for clinical pain . changes in pain both following mln and placebo were assessed in spss , version 20 , by performing paired t - tests . further , we specifically investigated whether changes following mln treatment differed significantly from changes following placebo treatment by performing paired samples t - tests of the change scores for all behavioral measures , also in spss , version 20 . when assessing for responders compared to non - responders to a treatment period , we defined a patient to be a responder if she had 30% improvement for a behavioral measure after a treatment period . patients with < 30% improvement after a treatment period were categorized as non - responders . evoked experimental pain data was also collected in and outside the mri scanner before and after each treatment period . pressure - pain was administered to the left thumbnail with three distinct conditions using the multi - modal automated sensory testing ( mast ) system ( harte et al . , 2013 ) : 1 ) an equal pressure condition of 1.5 kg / cm , 2 ) the amount of pressure required to elicit pain50 on the 0100 nrs , and 3 ) a faint touch rest condition . both behavioral and bold fmri response data will be analyzed and reported in a subsequent manuscript . in this investigation we were primarily interested in identifying baseline neuroimaging parameters that could predict changes in clinical and evoked pain specifically following treatment with mln . resting state fmri data were acquired using a t2 * -weighted spiral sequence ( tr = 2.0 s , te = 30 ms , fa = 90 , matrix size 64 64 with 43 slices , fov = 20 cm and 3.12 3.12 3 mm voxels ) , using a 3 tesla general electric , signa scanner 9.0 , vh3 with 16 rod birdcage transmit receive radio frequency coil . during the 6 min resting state fmri acquisition period ( 180 scans ) , subjects were asked to remain awake with their eyes open and to stare at a motionless cross presented on the screen . minimal cognitive tasks such as staring at a cross are thought not to disrupt resting state networks ( greicius et al . , 2003 ) . the first 6 images of the resting state scan were discarded from the data set and not analyzed in order to avoid equilibration effects . a t-1 weighted structural gradient echo data set ( tr 1400 ms , te 1.8 ms , flip angle 15 , fov 256 256 , yielding 124 sagittal slices with a defined voxel size of 1 1 1.2 mm ) was also acquired for each subject . data were pre - processed and analyzed using fsl ( http://www.fmrib.ox.ac.uk/fsl ) and statistical parametric mapping software packages ( spm , version 8 , functional imaging laboratories , london , uk ) , as well as the functional connectivity toolbox conn ( cognitive and affective neuroscience laboratory , massachusetts institute of technology , cambridge , usa ) running under matlab 7.5b ( mathworks , sherborn , ma , usa ) . upon collection of the functional data , cardiorespiratory artifacts were corrected for using the retroicor ( hu et al . pre - processing steps included motion correction ( realignment to the first image of the time series ) , normalization to the standard spm epi template ( generating 2 2 2 mm resolution images ) and smoothing ( convolution with an 8 mm fwhm gaussian kernel ) . subject head motion was assessed by evaluating three translations and three rotations for each scan . translational thresholds were set to 2 mm , while rotational thresholds were limited to 1. a subject was to be excluded from the analysis if head motion exceeded either of the thresholds in one of the six dimensions . as snris are thought to augment antinociceptive mechanisms , we were particularly interested in rs - fc to brain regions known to be involved in the descending antinociceptive / pain modulatory system . the following regions were chosen based on the current literature suggesting involvement in antinociception / pain modulation ( bingel , 2010 ) : three seeds covering the rostral acc , the ventral ( vacc ) , pre - genual ( pgacc ) and subgenual ( sgacc ) regions , and bilateral seeds in : the dorsolateral prefrontal cortex ( dlpfc ) , the amygdala , and the periaqueductal gray ( pag ) ; seed regions were created using the spm extension tool marsbar . all seed regions were created as spheres . for further information including size and location , , seed regions ' time - series were extracted ; white matter , cerebrospinal fluid , and realignment parameters were entered into the analysis as covariates of no interest . a band - pass filter ( frequency window : 0.010.1 hz ) first level analyses were performed correlating seed region signal with voxel signal throughout the whole brain , thereby creating seed region to voxel connectivity maps ( one map per seed per individual ) . for group analyses we focused on pre- mln rs - fc as a predictor of subsequent change in pain resulting from the drug . our primary approach was to enter pre - treatment connectivity maps in a multiple regression analysis with changes in pain ( post - mln minus pre - mln ) in spm . results were deemed significant using a family wise error ( fwe ) cluster corrected threshold of p < 0.05 . within a priori brain regions , including : the ic , posterior cingulate cortex ( pcc ) , precuneus , inferior parietal lobule ( ipl ) , and dlpfc , a small volume correction using a sphere with a radius of 5 mm was performed , and results were deemed significant at a ( fwe ) cluster level corrected threshold of p < 0.05 . these regions had been selected as a priori regions because we were specifically interested in rs - fc changes to regions known to be involved in pain processing , which allowed for small volume correction analysis based on previously published results . significant results were then extracted and entered into spss , version 20 , to assess for outliers . to determine if these results were specific to mln , identical analyses were performed for the placebo period , using the significant regions identified as predicting response to mln . in order to rule out chance differences by treatment period at baseline , we compared the mln and placebo correlations for the two cross - over periods separately ( i.e. those that had mln first and those that had placebo first ) . correlations were performed in spss , version 20 , and results were found to be significant at p < 0.05 . finally , we sought to incorporate multiple functional connectivity measures in a regression analysis to explore for collinearity amongst our rs - fc outcomes and to further improve prediction of treatment response , while simultaneously controlling for pre - treatment pain levels ( harris et al . , a multiple linear regression model was created with pre - treatment pain measures and rs - fc correlation values serving as independent variables and post - treatment pain as the dependent variable . a model was first constructed with each rs - fc measure individually and then in combination ( when multiple rs - fc values predicted the same pain outcome ) by way of forward selection . eight were excluded from the analysis for the following reasons : six withdrew prior to completing all neuroimaging sessions ( two prematurely stopped taking mln , two had side effects from the drug that prevented participation in the trial , and two terminated due to personal reasons ) , and two additional participants were excluded because they did not reach the pre - specified dose of mln before imaging . the drop - out rate due to adverse events of the medication was 9% ( 2 of 23 participants ) . thus fifteen subjects ( mean age : 40.7 10.2 ) were included in the present analysis . multiple dimensions of clinical pain were found to show significant decreases and trends towards decreased pain after treatment with mln but not placebo ( bpi sev change ; mln : mean = 0.88 1.8 , p = 0.076 ; pbo : mean = 0.17 2.3 , p = 0.78 ; bpi int change ; mln : mean = 1.1 1.7 , p = 0.03 ; pbo : mean = 0.56 2.1 , p = 0.31 ) . when comparing the effects of treatment periods to each other , no significant differences between mln and placebo treatment were observed ( bpi sev : p = 0.39 , bpi int : p = 0.50 ) . according to our a priori definition of responders : 5 of 15 patients ( 33% ) were responders to mln and 3 of 15 patients ( 20% ) were responders to placebo treatment for bpi sev , whereas 7 of 15 patients ( 47% ) were responders to mln treatment and 4 of 15 patients ( 27% ) were responders to placebo for bpi int scores ( table 2 ) . we found strong associations between baseline rs - fc values ( i.e. rs - fc correlation values between our pre - specified antinociceptive brain regions and other brain regions involved in pain processing / modulation ) and changes in clinical and experimental pain measures after treatment periods ( table 3 ) . a significant association was found between rs - fc of the right pag seed and the right mid - ic , and subsequent reduction in clinical pain severity ( bpi sev ; mln : r = 0.885 , p < 0.001 ; placebo : r = 0.216 , p = 0.440 ; table 3 and fig . less rs - fc activity was associated with greater reductions in clinical pain following mln treatment but not placebo . we also observed a significant association between connectivity of the right dlpfc and the left ipl , and changes in bpi sev during mln but not placebo ( mln : r = 0.873 , p < 0.001 ; placebo : r = 0.030 , p = 0.917 ; table 3 and fig . 3b ) . with respect to the limbic system , connectivity between the left amygdala and the precuneus / posterior cingulate cortex ( pcc ) was found to have a negative correlation with change in bpi sev in response to mln but not placebo ( mln : r = 0.916 , p < 0.001 ; placebo : r = 0.389 , p = 0.152 ; table 3 and fig . low levels of connectivity between the pgacc and the right posterior ic were found to be associated with a greater reduction in clinical pain interference ( bpi int ) following mln but not placebo ( mln : r = 0.900 , p < 0.001 ; placebo : r = 0.082 , p = 0.771 ; table 3 and fig . 4a ) . for placebo , lower levels of connectivity between the pgacc and the left dlpfc were associated with greater pain reduction , i.e. patients with less connectivity of these two structures at baseline would showed a greater response in clinical pain interference ( bpi int ) during placebo treatment ( placebo : r = 0.869 , p < 0.001 , mln : r = 0.050 , p = 0.859 ; table 3 , fig . 5 ) . when assessing each treatment period separately , it was found that order of treatment ( mln or placebo administered in the first period ) did not impact the results . two linear regression models predicting changes in bpi sev during the mln period were constructed . the first model for this measure included pre - mln bpi sev values ( adjusted r square = 0.34 , p = 0.014 ) , right pag to right mid - ic connectivity ( adjusted r square = 0.50 , p < 0.001 ) , and right dlpfc to left ipl connectivity ( adjusted r square = 0.10 , p = 0.001 ) as independent predictors and explained 94% of the variance of post - mln pain severity . a second model explained 95% of the variance of post - mln bpi sev scores which included pre - mln bpi sev values ( adjusted r square = 0.34 , p = 0.014 ) , right pag to right mid - ic connectivity ( adjusted r square = 0.51 , p < 0.001 ) , and left amygdala to right pcc / precuneus ( adjusted r square = 0.10 , p < 0.001 ) as independent predictors ( table 4 ) . independent predictors including pre - mln bpi int scores ( adjusted r square = 0.58 , p = 0.001 ) and pre - mln connectivity between the pgacc and right posterior ic ( adjusted r square = 0.32 , p < 0.001 ) explained 90% of the variance of post - mln pain interference ( table 4 ) . we investigated rs - fc of cortical and subcortical structures involved in pain modulation to determine parameters that would predict treatment response to treatment with mln in patients with fibromyalgia . importantly , we find that acc ic as well as pag ic connectivity at baseline were predictive of treatment response : patients that displayed lower pgacc ic connectivity or pag ic connectivity , respectively , showed greater reductions in clinical pain following mln treatment . other rs - fc measures were also predictive of clinical response to mln treatment , such as dlpfc ipl and amygdala precuneus / pcc connectivity , while less pgacc dlpfc connectivity was predictive of placebo response . we hypothesize that a subgroup of fibromyalgia patients with poor connectivity between pro- and antinociceptive brain regions , profits from snri treatment , and this pattern reflects a dysfunctional endogenous antinociceptive system or can be viewed as a biomarker thereof . a dysfunctional endogenous antinociceptive system has been suggested to be a contributor to the genesis of pain in fm ( lautenbacher and rollman , 1997 ; vierck et al . there is indeed evidence that cns levels of the two key neurotransmitters within the antinociceptive system , 5-ht and ne , are lowered in fm as indicated by decreased levels of the corresponding metabolites in the cerebrospinal fluid ( russell et al . , 1992 ; snris are thought to support the antinociceptive system by increasing synaptic 5-ht and ne levels that in turn reduce the nociceptive input to the brain . snris are well characterized with respect to their molecular mechanisms , targeting presynaptic transporter proteins ( e.g. sert ) , thereby raising synaptic 5-ht and ne levels . however , since 5-ht and ne can bind to different receptor subtypes with different effects and concentrations at different cns sites , the overall effect of 5-ht and ne reuptake inhibition is highly complex . in the context of pain and pain modulation however predominantly spinal mechanisms are discussed to account for the analgesic effects ( yoshimura and furue , 2006 ; burnham and dickenson , 2013 ) . for 5-ht this is via binding to 5-ht1a , 5-ht1b and 5-ht1d receptors that lead to pre- and post - synaptic hyperpolarization of pain transmitting neurons . furthermore 5-ht increases inhibitory transmitter release ( e.g. gaba ) from interneurons via 5-ht3 and possibly 5-ht2 . ne , on the other hand is thought to act via presynaptic 1 receptors leading to a suppression of glutamate release from both a and c afferent fibers , as well as via 2 receptors increasing inhibitory transmitter release from interneurons . importantly these mechanisms seem to play a beneficial role in a variety of chronic pain conditions , such as diabetic neuropathy ( boyle et al . , 2012 ) , osteoarthritis ( chappell et al . , 2009 ) as well as fibromyalgia ( goldenberg et al . , 2010 ; huser et al , 2012b ) and are not thought to be specific to one particular pain condition . interestingly for fibromyalgia a recently published study investigating spinal effects of mln via the assessment of the nociceptive flexion reflex ( r iii ) , came to the conclusion that mln must also have supraspinal effects , based on the observation that there was a dose dependent analgesic effect in the absence of an mln associated modulation of the nociceptive flexion reflex ( matthey et al . , 2013 ) . the only study to date that we are aware of to directly test whether diminished descending analgesic activity is predictive of treatment response with these classes of drugs is a study by yarnitsky and colleagues showing that those neuropathic pain patients with impaired descending activity at baseline on qst were more likely to respond to duloxetine ( yarnitsky et al . , 2012 ) . our choice of seed regions for the rs - fc connectivity analyses was based on the current literature highlighting the role of some key structures in pain inhibition and pain modulation , i.e. the pag , the rostral acc , the dlpfc and the amygdala ( petrovic et al . , 2002 ; wager et al . , 2004 ; bingel et al . , 2007 ) . our strongest findings , which are also well in line with our a priori hypotheses is , that acc ic connectivity and pag ic connectivity were predictive of treatment response . within the endogenous antinociceptive system the pag plays a central role coordinating via the rostroventromedial medulla ( rvm ) ( moreau and fields , 1986 ; heinricher et al . , 2009 ) activity in the descending 5-ht and ne pathways that project to the spinal cord to decrease nociceptive routing from the periphery . the pag itself receives input from both spinal nociceptive neurons a variety of cortical structures . it has been hypothesized that there are two cortical systems that mediate cortical top down modulation ; one pathway involves descending input from the rostral acc ( to the prefrontal cortex and then to the pag ) ; a second pathway arrives at the pag from the ic via the amygdala ( schweinhardt and bushnell , 2010 ) . that said , it needs to be acknowledged that most evidence stems from animal research ( fields , 2004 ) and that the precise mapping of these pathways in humans is currently unknown . however , the notion of the rostral acc pag connectivity ( hardy and leichnetz , 1981 ) , interacting in this regard , has recently been supported by both functional ( petrovic et al . , 2002 ; bingel , 2010 ; kong et al . , 2010 ) and structural ( stein et al . , 2012 ) imaging studies . the interaction of the rostral acc and ic in antinociception and pain modulation on the other hand remains to be further elucidated . both structures are part of a cortical opioidergic network ( petrovic et al . , 2002 ) , as such the rostral acc might exert direct antinociceptive activity on the ic cortex , or both structures modulate the pag either interactively or independently , and rs - fc reflects coordinated activity of the two systems . when looking at resting state networks the bilateral ic together with the dorsal acc , mcc and supplementary motor area make up the so called salience network and connectivity within this network influences perceptual decisions on pain . the vacc , pgacc and sgacc as such are not part of the salience network , but rather belong to the executive control network ( vacc ) and the dmn ( pgacc and sgacc ) ( beckmann et al . , as such one would not expect highly correlated bold activity between the rostral acc and ic even in healthy subjects ; intriguingly a negative correlation in resting state activity between these two regions is predictive of mln response . in a recently performed study we found an increased rostral acc ic rs - fc in young patients with temporomandibular disorder that we interpreted as an early compensatory mechanism in a group of young patients developing a chronic pain condition ( ichesco et al . , 2012 ) . effort , it is tempting to hypothesize that a break down in this mechanism is then associated with further pain chronification , based on an increasingly dysfunctional antinociceptive system . the other rs - fc patterns that predicted response to mln treatment were the right dlpfc and the left ipl as well as amygdala and the posterior cingulate cortex . the ipl as well as the posterior cingulate cortex are both part of the dmn . the role of the dmn in chronic pain is beginning to be investigated , as in our previous work in fibromyalgia suggesting that ic connectivity to the dmn is associated with increased pain ( napadow et al . , 2010 ) . interestingly in this present work , we show that lowered dmn connectivity to antinociceptive regions , such as the dlpfc , are predictive of response to mln . other dmn regions such as the pcc have also been highlighted as being involved in pain in other functional and structural imaging studies ( erpelding et al . , another interesting finding of our study is that pgacc left dlpfc connectivity predicted response to placebo treatment . fibromyalgia patients with a lower pgacc left dlpfc connectivity showed greater pain reductions while undergoing placebo treatment . the placebo effect in fibromyalgia patients has recently been investigated in meta - analyses based on randomized , placebo - controlled trials . in these studies , 1830% of patients have been shown to be placebo responders ; as such the magnitude of placebo responders in drug trials of fibromyalgia is similar to that seen in other chronic pain conditions ( huser et al . , 2011 the neural mechanisms underlying the clinical observation that cognitive factors such as beliefs and expectations can modulate pain perception have been investigated using various brain imaging methods ( petrovic et al . , 2002 ; bingel , 2010 ) , mostly using short term interventions . the role of the dlpfc cortex in placebo research has been underlined by both fmri studies ( wager et al . , 2004 ; wager et al . , 2011 ) as well as transcranial magnetic stimulation ( tms ) studies describing a significant impairment of placebo analgesia associated with tms induced functional lesions of the left dlpfc ( krummenacher et al . , 2010 ) . as such the dlpfc is viewed as key region for initiating placebo related changes in pain perception , the implementation of which then requires the interaction of other cortical and subcortical brain regions , such as the rostral acc and the pag . while increases in the rostral acc activity and acc pag connectivity during placebo analgesia are most likely to be mediated by opioidergic transmission ( petrovic et al . , 2002 ) dlpfc playing a key role in placebo analgesia , they also extend it to a clinical setting , where baseline rs - fc predicts placebo effects visible 6 weeks after treatment initiation . despite the significant progress that has been made in understanding the pathophysiology of fibromyalgia , these advances have not yet been translated into pharmacological treatment . it is generally thought that the underlying pathophysiology of fibromyalgia is heterogeneous leading to a similar phenotype of chronic widespread pain , with only a subgroup of patients with diminished synaptic 5-ht and ne levels responding to drugs that augment this activity . despite our small sample size the rates of both drug and placebo responders are well in line with larger , randomized studies . consistent with this idea , the effect of any one of the united states food and drug administration 's approved drugs examined in isolation is modest with a 30% improvement in pain occurring in only 3040% of patients ( huser et al . , 2012b ) , which is also the case in other chronic pain states ; nsaids and opioids for example have modest efficacy in conditions such as osteoarthritis or chronic low back pain ( clauw , 2010 ) . this stresses the need to develop tools that predict treatment response , in order to then design individually tailored therapies ( woolf , 2010 ) . only very recently have studies indicated that brain imaging might be suited to perform such predictions ( harris et al . , 2013 ; resting state fmri might be a particularly interesting tool , as it is easy and safe to perform with only little demands on patients ' cognition and cooperation . first of all our study is based on a rather small study sample , i.e. our findings might not be representative of the larger fibromyalgia population and may only apply to a subgroup of fibromyalgia patients . also while our drop - out rates , as well as treatment response to mln and placebo , were comparable to those seen in larger randomized , placebo - controlled trials , our results need to be reproduced in a larger study sample . as rs - fc analyses allow no assumptions on causality , or on the directedness of influence , it is conceivable that connectivity between two regions could be driven by a third region , not identified in the analysis . furthermore there is no necessity for a direct causal relationship between brain connectivity patterns identified in this study and clinical response . dual reuptake inhibitors are likely to act first and foremost on the spinal level ( in the context of pain inhibition ) , and the connectivity measures of forebrain structures might thus relate only indirectly to the site of action . in this scenario connectivity measures would need to be viewed as surrogate markers , however this would not detract from their potential clinical usefulness . finally , there are four snris used in clinical practice , including venlafaxine , desvenlafaxine , duloxetine and mln . mln blocks 5-ht and ne reuptake to an equal extent whereas greater selectivity at 5-ht sites has been described for venlafaxine and duloxetine . in this regard it is uncertain whether our results can be generalized to other snris or even tcas . besides confirmation by studies with larger sample sizes further research is needed to extent our findings to other snri and non - selective reuptake inhibitors ( e.g. tcas . ) . overall we were able to show that rs - fc patterns of brain structures involved in antinociception and pain modulation might be useful parameters for the prediction of treatment response to the snri mln in fibromyalgia patients . as in clinical practice only a subset of patients respond to pharmacological treatment , such approaches might turn out useful tools to identify subgroups of patients likely to respond to one or the other approach moving towards an individualized medicine .

fibromyalgia is a chronic pain syndrome characterized by widespread pain , fatigue , and memory and mood disturbances . despite advances in our understanding of the underlying pathophysiology , treatment is often challenging . new research indicates that changes in functional connectivity between brain regions , as can be measured by magnetic resonance imaging ( fcmri ) of the resting state , may underlie the pathogenesis of this and other chronic pain states . as such , this parameter may be able to be used to monitor changes in brain function associated with pharmacological treatment , and might also be able to predict treatment response.we performed a resting state fcmri trial using a randomized , placebo - controlled , cross - over design to investigate mechanisms of action of milnacipran ( mln ) , a selective serotonin and norepinephrine reuptake inhibitor ( snri ) , in fibromyalgia patients . our aim was to identify functional connectivity patterns at baseline that would differentially predict treatment response to mln as compared to placebo . since preclinical studies of mln suggest that this medication works by augmenting antinociceptive processes , we specifically investigated brain regions known to be involved in pain inhibition.15 fibromyalgia patients completed the study , consisting of 6 weeks of drug and placebo intake ( order counterbalanced ) with an interspersed 2 week wash out period . as a main finding we report that reductions in clinical pain scores during mln were associated with decreased functional connectivity between pro - nociceptive regions and antinociceptive pain regions at baseline , specifically between the rostral part of the anterior cingulate cortex ( acc ) and the insular cortex ( ic ) , as well as between the periaqueductal gray ( pag ) and the ic : patients with lower preexisting functional connectivity had the greatest reduction in clinical pain . this pattern was not observed for the placebo period . however a more robust placebo response was associated with lower baseline functional connectivity between the acc and the dorsolateral prefrontal cortex.this study indicates that acc ic connectivity might play a role in the mechanism of action of mln , and perhaps more importantly fcmri might be a useful tool to predict pharmacological treatment response .

Introduction Material and methods Results Discussion

PMC3389695

cerebral palsy is a nonprogressive central nervous system disorder that results in physical impairments and functional limitations that change as the children grow older . among a large number of instruments [ 24 ] , for measuring the physical ability of children with cp , the gross motor function classification system ( gmfcs ) introduced by palisano et al . in 1997 has been widely applied in clinical and research settings . the gmfcs is a five - level classification system that identifies abilities and functional limitations , based on the need of assistive devices of the cerebral palsy child , during self - initiated movements , such as walking and sitting . the system application is quick and easy and it gives a brief description of which level the child resembles based on his / her current gross motor function . the reliability and validity of the gmfcs in differentiating cerebral palsy children with different functional levels have been reported . similarly , the stability of the system over time proved to be very consistent , suggesting that the gmfcs could be used routinely in clinical practice to follow children with cerebral palsy . however , due to the heterogeneous nature of cerebral palsy , some overlap between levels i and ii has been observed and , indeed , anticipated by the authors [ 2 , 5 , 7 ] . gmfcs level i is associated with children with persistent neuromotor abnormalities not as severe as children from level ii . overlap between levels occurred more often when deciding if a child has limitations walking outdoors , going up stairs , jumping , or running . many studies aimed to determine which outcome tools could assist clinicians and researchers to improve the classification levels i and ii of the gmfcs [ 1 , 4 , 8 ] . correct classification at clinical settings has been corroborated by tests such as the gmfm-66 , gait velocity , and the weefim mobility [ 8 , 9 ] . child with cerebral palsy often develops changes in muscle length over time , more common at the hip and knee flexors and at the ankle dorsiflexors [ 10 , 11 ] . kilgour and colleagues ( 2005 ) using passive range of motion tests reported that diplegic children levels i and ii of the gmfcs had minimal loss of hip extension compared to a matched control group . since the gmfcs classification is based on functional activities , it would be more interesting to obtain measurements during dynamic activities . in addition , it is expected that muscle shortness is more advanced in diplegic children level ii than level i of the gmfcs . therefore , range of motion comparison between levels i and ii is also relevant . these muscles changes might affect the range and amplitude of the lower limb during dynamic activities such as gait . however , to date , none of the studies tried to discriminate gmfcs levels i and ii according to the angular displacement of the pelvis , hip , knee , and ankle / foot complex during gait . instrumented gait analysis is a complex procedure and a highly costly diagnostic tool ; however , the kinematic data obtained provides quantitative information on gait abnormalities that can not be detected during visual observation . raising the knowledge of the gait biomechanical differences between child with cerebral palsy level i and ii of the gmfcs can improve observational gait analysis skills and , at the same time , improve classification accuracy and more coherent physical therapy approaches based on the functional status of children with cerebral palsy . therefore , the research questions for this study were : ( 1 ) are there differences in the kinematics gait profiles of the pelvis and lower limb joints during gait between diplegic cerebral palsy children classified as gmfcs levels i and ii ? ( 2 ) if differences in the kinematics were found , which ones would be the most discriminatory between these groups ? a cross - sectional observational study was conducted with diplegic cerebral palsy children classified by a trained physical therapist , as gmfcs levels i and ii . the intra - rater reliability of the physical therapist in assessing the gmfcs levels was excellent ( icc = 0.941 ) . all children were community ambulates from outpatient clinics and , together with their parents or guardians , were invited to participate in the study . the temporal and spatial gait parameters and kinematics of the pelvis , hip , knee , and ankle / foot joints were collected on one day in a laboratory . the present study received approval from the ethics committee of the universidade federal de minas gerais , process number etic 088/04 . prior to participation , all procedures were explained to the child and his / her parent or guardian and an informed written consent was obtained . twenty - two ( 22 ) diplegic cerebral palsy children were included in the study , 15 male and 7 females between the ages of 7 and 12 , who could ambulate independently without assistive devices for a minimum of 6 meters without resting . patients were excluded if they had other neurological diseases , botulin injections , or history of orthopedic surgery in the past six months . characteristics of the participants , such as age ( years ) , height ( m ) , and body mass index ( bmi , kg / m ) , were obtained in order to describe the anthropometrics of the groups . three - dimensional kinematics of the right lower limb ( hip , knee , and ankle / foot joints ) and pelvis during the stance phase of the gait cycle were obtained with a six camera motion analysis system ( motion capture unit - qualisys medical ab 411 12 , gothenburg , sweden ) . the children walked barefoot over a 6-meter walkway , for an average of 9 ( sd = 3.1 ) trials at their natural speed . reflective markers and clusters of tracking markers were used to determine coordinate systems and motions of the pelvis , thigh , shank , and ankle / foot segments according to recommendations for minimizing soft tissue artifacts . a footswitch synchronized to the motion system was fixed under the children 's foot to determine contact to and loss of contact from the walking surface , and consequently , delimiting stance and swing phases during gait cycle . the resulting data were processed through the visual 3d motion analysis software ( c - motion , inc , rockville , maryland ) where the rigid segments corresponding to the pelvis , shank , thigh , and ankle / foot segments were first created . the position of the reflective anatomical markers were used for attributing coordinate systems for each segment and were located at left and right iliac crest , left and right greater trochanter , medial and lateral epicondyle of the femur , medial and lateral malleoli , 1st and 5th head of the metatarsus , and calcaneal tuberosity . one rigid cluster with 4 noncollinear markers was placed at the base of the sacrum and two nonrigid clusters with 3 noncollinear markers were placed at the medial side of the thigh and shank . data were smoothed using a zero - lag fourth - order butterworth low pass filter with a cut - off frequency of 6 hz . three - dimensional angular motion was calculated using the cardan sequence , defined as the orientation coordinate system of one segment in relation to the orientation of the coordinate system of the adjacent segment . the hip , knee , and ankle / foot joint angles were obtained using as reference the pelvis , thigh , and the shank segments , respectively . the sign convention used in defining the clinical rotation angles were as follows : ( 1 ) flexion of the hip and knee , anterior tilt of the pelvis , and ankle dorsiflexion , all of which occur about the lateral - medial or x - axis and were positive angles ; ( 2 ) adduction of the hip and knee , pelvic obliquity ( meaning the height of the iliac crest of the stance foot higher in relation to the height of the iliac crest of the opposite foot ) and internal rotation of the ankle / foot complex , all of which occur about the anterior - posterior or y - axis and were considered positive angles ; ( 3 ) internal rotation of the pelvis , hip and knee joints and adduction of the ankle / foot complex occurs about the distal - proximal or z - axis and all were positive angles . gait velocity ( m / s ) , stride length ( m ) , and cycle time ( s ) for the entire gait cycle , and swing and stance time ( s ) , were also obtained . baseline characteristics of participants are presented as values , means , and standard deviations ( sd ) . the mean difference between the groups with a 95% ci of the subject 's characteristics and temporal and spatial gait parameters were also obtained . a principal component analysis ( pca ) was applied to the stance phase of the gait waveforms to reduce the data and explore the profiles characterizing typical functions between levels i and ii of the gmfcs [ 15 , 16 ] . in pca , this technique determines a linear combination of the original variables that are used to summarize a new set of variables called principal components , which are uncorrelated and ordered so that the first component retains most of the variation present in the original data . therefore , each principal component represents a specific feature of the waveform data . the criteria to choose the number of principal components was 90% of the total sample variance . for each pc extracted , a score is calculated for each subject that aids in describing the meaning of the variation component according to the characteristics of each group . the higher the score , the more correlated the subject 's waveform is with a specific pc . to interpret the components , two waveforms were created based on the mean waveform one standard deviation of the pc scores times the loading vector for each pc . the principal component scores were analyzed using student 's t - test with bonferroni correction for difference between groups . the pcs retained after the discriminant analysis were described according to the discriminant function coefficient to determine its relative importance in separating the groups . group gmfcs level i had 11 children with an average age of 9.1 years ( sd : 2.3 ) , average height of 1.3 m ( sd : 0.1 ) and bmi of 16.7 kg / m ( sd : 0.2 ) . group level ii , also with 11 children , had average age of 9.8 years ( sd : 2.1 ) , height of 1.3 m ( sd : 0.1 ) , and bmi of 17.2 kg / m ( sd : 3.8 , table 1 ) . table 2 describes the temporal and spatial parameters between groups with the 95% confidence interval showing no significant difference between groups . principal component analyses were carried out for three - dimensional angular displacement of the pelvis , hip , knee , and ankle / foot complex . the pc scores generated for each subject in each component were tested for differences between groups . the results showed that only the scores from the first component ( pc1 ) of the pelvis and hip joint in the frontal plane were statistically different between the groups ( table 3 , p < .05 ) . no difference was found in the curve profiles of the knee joint and ankle / foot complex . at the pelvis , figure 1(a ) shows the angular displacement of the pelvis during the stance phase ( normalized to 100% ) between level i and ii groups of the gmfcs . the coefficient of pc1 has all positive values ( figure 1(b ) ) ; therefore , it captures the magnitude of the pelvic obliquity angle in the frontal plane during the stance . figure 1(c ) shows the mean waveform and the high and low curves created based on the mean waveform one standard deviation of the pc1 score times the loading vector for each pc1 . the results confirm that , on average , diplegic pc children level ii , during the stance phase of the gait , walked with reduced pelvic obliquity in comparison with children from group level i. the average range of pelvic obliquity during the stance phase of the gait cycle for group level i was 6.2 and for level ii was 3.3. figure 1(d ) shows the average angular displacement of the hip joint in the frontal plane between groups during the stance phase of the gait cycle . at the hip joint , two pcs were extracted with pc1 explaining 86.1% and pc2 8.5% , a total of 94.6% of variance explained . pc1 , with all positive values , measured the magnitude of the adduction angle of the hip ( figure 1(e ) ) . the mean waveform and the high and low waveforms are shown on figure 1(f ) and confirm that children in gmfcs level ii presented reduced hip adduction during the stance phase when compared to cerebral palsy children in level i. the average range of hip adduction / abduction during the stance phase of the gait cycle for group level i was 11.3 and for level ii was 8.9. a stepwise discriminant analysis was conducted with the pc1s of the pelvis and hip in the frontal plane . wilk 's lambda score was significant ( = .217 , ( 2 , n = 22 ) = 29.002 , p = .000 ) and showed that both pelvic obliquity and hip abduction angle are stronger discriminant variables , with 95.5% cross - validation . the magnitude of the coefficients of the pcs in the standardized canonical discriminant function showed that pelvic obliquity has higher impact on separating the groups ( 0.711 ) followed by hip abduction angle ( 0.654 ) during the stance phase of gait . to our knowledge , this is the first study that compared the angular displacement of the pelvis and lower limb joints , between diplegic cerebral palsy children classified according to the gmfcs as levels i and ii . the results demonstrated that children with diplegia level ii of the gmfcs significantly reduce the amplitude of pelvic obliquity and hip adduction angles during the stance phase of the gait cycle . gait velocity , stride length , stance / swing and cycle time were similar in outcome for both groups . children classified as gmfcs level i of ages between 7 and 12 years , are expected to walk independently inside and outside their homes , to go up and down stairs , and to run and jump . however , their gait velocity , balance , and motor coordination may be reduced compared to a paired child with normal development . difference between children of gmfcs levels i and ii included limitations in walking outdoors and in the community , on uneven surfaces , and in crowded places . children of level ii may hold onto a rail to climb stairs , may require wheeled mobility when traveling long distances , and their ability to perform gross motor skills such as running and jumping are minimal compared to children in level i . studies showing disagreement between levels i and ii have been reported , suggesting difficulty in classifying if a child has functional limitation or can perform gross motor skills [ 5 , 7 ] . during normal gait strike , the hemipelvis of the stance limb is aligned with the contralateral hemipelvis . at the beginning of loading response and mid - stance , the contralateral hemipelvis drops in the frontal plane , and the stance hemipelvis is higher around 4 to 7 . the effect of pelvic drop is to adjust the length of the support lower limb , helped by some degree of knee flexion , avoiding excessive lower vertical displacement of the center of mass . the hip abduction / adduction displacement at this moment is dependent on the pelvis movement over the femur . while hemipelvis elevation favors adduction of the stance limb , hemipelvis drop favors , on the contralateral side , hip abduction movement . besides saving body energy by preventing greater inferior displacement of the center of mass , hip adduction of the stance limb , also shifts the body center of mass towards the center of rotation of the hip being loaded . the result would be a decrease in the external adductor moment of force , favoring the mechanical advantage of the hip abductor muscles during stance . the summation of these actions prevents excessive pelvic drop and the trendelenburg gait . as well , when the support limb begins terminal stance and preswing phases , the opposite will occur . the pelvis will begin to drop , favoring hip abduction which is important to assist the release of the foot from the ground , permitting the body to swing forward [ 22 , 24 ] . therefore , pelvic obliquity and hip adduction are two mechanisms that work synchronously to maintain stability and forward movement of the body . in diplegic children with cerebral palsy , reduced pelvic obliquity could be a result of abductor muscles weakness bilaterally and adductor muscles spasticity . another explanation could be that , by reducing pelvic elevation on the supported limb in the stance phase of the cycle , children with cerebral palsy are probably trying to decrease leg length to facilitate the next initial contact of the same foot . however , this strategy would increase inferior displacement of the center of mass cycle , resulting in a less efficient gait [ 25 , 27 ] . at the hip joint , reduced hip adduction in the stance phase increases the internal abductor moment of the support limb . since children with cerebral palsy normally show weakness of the hip abductor muscles , the gait pattern would be unstable , forcing them to increase base of support or to spend less time in the unipodal phase [ 14 , 22 ] . the decreased hip adduction could also be a response to alterations in pelvic obliquity , once the loaded hemipelvis is lower than normal , challenging the hip mechanics to generate hip adduction . the combination of reduced pelvic obliquity and hip adduction during the stance phase of the gait cycle , reinforce the evidence that children with cerebral palsy gmfcs level ii are more unstable during gait compared to children in level i. in threatening situations , such as walking on uneven or inclined surfaces , the greater instability of children in gmfcs level ii could justify their need for assistive devices . it also justifies their use a rail to walk up and down stairs , since reduced pelvic obliquity would decrease hip abduction that could also affect hip flexion . although the kinematic analysis was not a tool used to assist the development of gmfcs classification system , the findings of the present study support the differences between levels i and ii of the gmfcs , recently revised by the authors . the discriminant model revealed that pelvic obliquity has a higher impact in discriminating children gmfcs level i from those of level ii . clinically , this result shows that pelvic obliquity in the frontal plane explains better the mechanical difference between children in level i and ii . the importance of pelvic obliquity during gait was introduced in 1953 by saunders and coworkers as one of the most important gait marker that minimizes the vertical displacement of the center of mass . in 2001 , della croce and coworkers confirmed that pelvic obliquity and single support knee flexion are the second most important gait determinants in reducing center of mass dislocation and consequently improving gait efficiency . the present study demonstrated that gait velocity was similar between cp children in level i and ii . in a multicentre study conducted with 562 children with cerebral palsy , classified in levels i to iii of the gmfcs , determined that gait velocity is a discriminant factor between levels i and ii . similar results were reported by oeffinger et al . . in addition , damiano and abel reported that the temporal and spatial parameters were important indicators of the severity level of the cerebral palsy children . the classification in levels i and ii , proposed by palisano et al . , was based primarily in the limitation of the child to execute movements that involved velocity and stability , such as walking , jumping , and going up and down stairs . therefore , we would expect a significant difference between levels i and ii in the gait spatial and temporal markers . it is likely that the different instruments used to capture temporal and spatial gait markers and the fact that our sample was composed only of diplegic cerebral palsy children probably justify the different results found in the present study . gait alterations in children with cerebral palsy may also occur in other planes of motion . rodda and graham proposed a classification system for diplegic children based on the kinematic and kinetic analyses focused in the sagittal plane . however , the authors agreed that important alterations may also occur in the frontal and transverse planes . for example , excessive internal pelvic rotation during initial contact contributes to a higher range of hip abduction motion observed during gait strike . on the other hand , increased pelvic obliquity may be secondary to a decrease in the hip and knee sagittal motions . the lack of significant findings in the sagittal plane could be related to the nature of the movement . as in the sagittal plane , the range of motion is greater compared to the other planes , the variability is normally smaller when compared to movements with smaller range of motions [ 33 , 34 ] . one option would be to increase the sample size , in an attempt to identify the subtle variances that could occur in the sagittal plane . nevertheless , in the present study , even with a relatively small sample size the results could discriminate the groups , showing that , in fact , a difference between levels i and ii , although subtle , could be detected with the multivariate analysis technique applied . the present study offers new information on angular displacement in all three planes of gait stance of children with cerebral palsy classified as gmfcs levels i and ii . clinical observation of reduced pelvic obliquity and hip adduction during gait is a difficult task . the literature on observational gait analysis has shown that training and experience are important for a more consistent observation of the pelvic and hip movements during gait . therefore , the kinematic idiosyncrasy of each gmfcs level could be added as one important clinical parameter to help the classification process of mild - to - moderate children with diplegia . in addition , prior knowledge of the biomechanical differences between gmfcs levels i and ii may guide further physical therapy strategies , focused on regaining pelvic obliquity and hip adduction range of motion of the support limb . such strategies may promote gait stability of cerebral palsy children level ii , with less energy expenditure and free from assistive devices .

objective . to determine if gait waveform could discriminate children with diplegic cerebral palsy of the gmfcs levels i and ii . patients . twenty - two children with diplegia , 11 classified as level i and 11 as level ii of the gmfcs , aged 7 to 12 years . methods . gait kinematics included angular displacement of the pelvis and lower limb joints during the stance phase . principal components ( pcs ) analyses followed by discriminant analysis were conducted . results . pc1s of the pelvis and hip in the frontal plane differ significantly between groups and captured 80.5% and 86.1% of the variance , respectively . pc1s captured the magnitude of the pelvic obliquity and hip adduction angle during the stance phase . children gmfcs level ii walked with reduced pelvic obliquity and hip adduction angles , and these variables could discriminate the groups with a cross - validation of 95.5% . conclusion . reduced pelvic obliquity and hip adduction were observed between children gmfcs level ii compared to level i. these results could help the classification process of mild - to - moderate children with diplegia . in addition , it highlights the importance of rehabilitation programs designed to improve pelvic and hip mobility in the frontal plane of diplegic cerebral palsy children level ii of the gmfcs .

1. Introduction 2. Method 3. Results 4. Discussion