Datasets:

Shushant

/

ContaminationQA

like 0

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What is the location of the event?

{'answer_start': [45], 'text': ['Denmark']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

How was the event first detected?

{'answer_start': [75], 'text': ['several complaints from citizens']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

How many people were ill?

{'answer_start': [3232], 'text': ['140 cases']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

How many people were hospitalized?

{'answer_start': [4086], 'text': ['Four patients ']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What are the pathogens?

{'answer_start': [1106], 'text': ['coliform counts and�Escherichia coli)']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What are the symptoms?

{'answer_start': [128], 'text': ['diarrhoea and vomiting ']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What are the initial steps of investigation?

{'answer_start': [706], 'text': ['water samples for microbiological and chemical analyses were systematically collected from the water distribution system']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What are the first steps of mitigation?

{'answer_start': [322], 'text': ['prohibited any use of the water - except for toilet flushing']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What type of samples were examined?

{'answer_start': [2673], 'text': ['Stool samples']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What did the authorities do to restore the system?

{'answer_start': [5959], 'text': ['the distribution system was subsequently disinfected by chlorination']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What steps were taken to restore the problem?

{'answer_start': [5750], 'text': ['Flushing of the area�s distribution system was initiated immediately and sustained for several weeks']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What did the authorities do to mitigate the event?

{'answer_start': [538], 'text': ['The citizens in the area were warned by the police and through radio broadcasts']}

Contamination Question Answering

On Monday 15 January 2007, a municipality in Denmark received the first of several complaints from citizens who reported severe diarrhoea and vomiting over the weekend. Over the same period, the drinking water in many houses was reported to be discoloured and of unusual smell and taste. The local authorities immediately prohibited any use of the water - except for toilet flushing - in the entire area supplied with untreated drinking water from the local waterworks, which involved 5,802 citizens and a number of companies (Figure 1). The citizens in the area were warned by the police and through radio broadcasts. To reveal the nature and the geographical spread of the suspected water contamination, water samples for microbiological and chemical analyses were systematically collected from the water distribution system across the whole area supplied from the local waterworks. The water samples were collected at the waterworks itself, from major water pipelines and wells, and from tap water in private houses and companies. High concentrations of faecal indicator bacteria (primarily presumptive coliform counts and�Escherichia coli) and endotoxins in the water samples indicated a massive faecal contamination of a part of the water distribution system, while other parts of the distribution system appeared not to be affected. On the basis of the geographical distribution of indicator bacteria, and the technical information about directions of the water flow in the different sections of the water distribution system, the area suspected to be contaminated was systematically reduced step by step during the next days. Based on the analyses of 530 water samples collected at 200 different sites, the area finally considered to be affected by the water contamination was defined on 26 January 2007 (indicated with a red line in Figure 1). This area comprised 177 households with 450 residents and several companies, among which six dealt with food. Restrictions on water use were maintained in this area, while the water was released for normal use in the area that was not considered to be contaminated. Gastrointestinal illness A line-list of patients with gastrointestinal illness associated with the water contamination was established on the basis of notifications from general practitioners, enquiries made to the medical health officer, patients seeking advice from the emergency medical service, and patients contacting an ad hoc telephone �hotline� established by the local authorities. Additional information was collected during a house-to-house questionnaire survey conducted on 16 January among 20 households in the most severely affected street. Stool samples were examined at the Department of Bacteriology, Mycology and Parasitology, and the Department of Virology, Statens Serum Institut, Copenhagen. A case of acute gastroenteritis was defined as a person with diarrhoea, vomiting and/or abdominal pain/cramps with fever. To verify whether reported cases met the case definition, and to confirm the geographical extent of gastrointestinal illness associated with the water contamination, patients on the line-list were contacted by telephone and/or postal questionnaires. By the end of February 2007, 140 cases had been registered: 110 were residents of the area that was judged to be contaminated on the basis of the environmental investigations, 12 were shoppers or employees at the food companies in the area, and 18 affected people came from outside the contaminated area. The epidemic curve for cases among residents in the contaminated area with known date of illness onset is shown in Figure 2. No new cases in the contaminated area were registered after 24 January. Cases were largely confined to the contaminated area. A total of 24% of the residents of the contaminated area were registered with gastrointestinal illness, compared with 0.3% in the other sections of the waterworks� supply area (relative risk 73; 95% CI 44-127). From the most severely affected street in the contaminated area, 43% of residents were reported to have fallen ill. Four patients were temporarily admitted to hospital. Microbiological results By the end of February 2007, stool samples from 139 patients affected by the outbreak (including 99 patients who met the case-definition criteria) had been examined with respect to gastrointestinal bacteria, viruses and parasites. Among these, 77 patients (43 cases) had one or more samples that tested positive, including 23 patients with 2-5 different pathogenic gastrointestinal organisms (Table). Not all samples were tested for the entire range of pathogens identified. Further microbiological testing and genotyping of the samples are being undertaken. Technical assessment and intervention Technical and microbiological investigations of the water indicated that the most probable cause of the contamination was the combination of a technical and a human error at a local sewage treatment facility, which allowed at least 27 m3�of partially filtered waste water to enter into the drinking water system in the period between 12 and 14 January 2007. The two pipelines were separated, and the exact circumstances of the incident that allowed the backflow of the sewage water remain to be revealed. The conclusion of the technical investigations was supported by the large variety of gastrointestinal pathogens found in the stool samples, which corroborated that the contamination was due to backflow of grossly contaminated sewage water rather than, for example, surface water or sewage from only a few households. The sewage treatment plant receives sewage from a population of approximately 40,000, as well as industrial enterprises, food production establishments and a hospital. Flushing of the area�s distribution system was initiated immediately and sustained for several weeks. As faecal indicator bacteria were still found in the drinking water after two weeks of sustained flushing, the distribution system was subsequently disinfected by chlorination on 10 and 11 February. After another two days of flushing, the drinking water was released for normal use, but recommended for drinking still only after boiling. By 12 March, the boiling restrictions were lifted for the majority of households, since by then the environmental water samples from the distribution system had fulfilled the quality criteria for untreated drinking water as defined by the Danish Ministry of Environment [3]. Commentary The handling of the outbreak called for interdisciplinary cooperation and the epidemiological investigations supported the technical and water-microbiological analyses. Geographical information systems were used to define the contaminated area, and the 18 episodes of illness reported outside of the contaminated area (Figure 1) probably represent sporadic illness or could be associated with the outbreak in a way that was not investigated, for example by secondary transmission. Although the drinking water supply in Denmark is primarily from untreated ground water, disease cases are rarely registered in connection with incidents of contamination [1,2]. The outbreak described was unusual, partly because of the high morbidity among the exposed citizens, and partly because of the extraordinary complexity of positive microbiological findings; a recent review of disease outbreaks caused by contaminated drinking water in the United States from 2003 to 2004 reported that in only two out of 25 outbreaks with known aetiology more than one microorganism was detected [4]. The consequences were considerable for the affected families, but also for the food companies, which were not allowed to resume production until the middle of February.

What was the alert of the event?

{'answer_start': [195], 'text': ['drinking water in many houses was reported to be discoloured and of unusual smell and taste.']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What type of samples were analyzed?

{'answer_start': [1761], 'text': ['aecal and drinking water samples']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What were the first steps of investigation?

{'answer_start': [2040], 'text': ['trawling questionnaire']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What is the date of the event?

{'answer_start': [3], 'text': ['October/November 2005']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What is the location of the event?

{'answer_start': [111], 'text': ['Ireland']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

How many people were ill?

{'answer_start': [129], 'text': ['Eighteen']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

How many people were hospitalized?

{'answer_start': [313], 'text': ['Two children']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What are the pathogens?

{'answer_start': [70], 'text': ['Escherichia coli (VTEC)']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What is the event?

{'answer_start': [38], 'text': ['outbreak of verotoxin-producing Escherichia coli (VTEC)']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What are the first steps of mitigation?

{'answer_start': [1376], 'text': ['voluntary closure of the cr�ches']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What did the authorities do to mitigate the event?

{'answer_start': [1534], 'text': ['boil water� advisory']}

Contamination Question Answering

In October/November 2005, the largest outbreak of verotoxin-producing Escherichia coli (VTEC) ever recorded in Ireland occurred. Eighteen E. coli O157 culture-positive cases, phage type 32, verotoxin 2 positive, were identified in a small rural area of mid-west Ireland. Half of these patients were asymptomatic. Two children were admitted to hospital with haemolytic uraemic syndrome, one of whom required peritoneal dialysis, and both recovered. All 18 culture-positive patients had indistinguishable or closely related pulsed field gel electrophoresis (PFGE) patterns. Nine of the VTEC O157 culture-positive individuals were in preschool children attending two local cr�ches. Several culture-positive individuals apparently had exposure to a vulnerable private group water scheme (GWS) in an agricultural area. No microbiological evidence of VTEC was found in food or water. One veterinary sample (an animal rectal swab) was positive for E. coli O157 and the PFGE strain was indistinguishable from the outbreak strain. A case control study showed analytical epidemiological evidence of risk related to potential exposure to the GWS but not related to reported consumption of that water. Selection of cases and controls proved challenging. Transmission occurred primarily in childcare and family settings, with significant person-to-person spread. Control measures included voluntary closure of the cr�ches, exclusion of culture-positive individuals in risk groups until microbiological clearance was achieved and the issuing of a �boil water� advisory for drinking water pending upgrading of disinfection facilities. In October 2005, the notification of a case of HUS-associated VTEC O157 led to the identification of a large outbreak in Ireland [16]. Both faecal and drinking water samples were analysed in the Biosafety Level 3 laboratory using the immunomagnetic separation method for the isolation of E. coli O157 and polymerase chain reaction for detection of VT1 and VT2 genes. Epidemiological investigations included the use of a trawling questionnaire on all culture-positive individuals. Twenty one water samples and one food sample were tested specifically for E. coli O157. Rainfall data supplied by Met �ireann (the Irish Meteorological Service) at a nearby station for the period around the outbreak was collated. A questionnaire was compiled and piloted. Two cases were hospitalised. A �boil water� advisory was issued to users of the GWS pending upgrading of disinfection facilities. A point source was initially suspected, possibly from environmental contamination of vulnerable drinking water, but this was not proven. Subsequent to the outbreak, an education initiative advising childcare facilities about VTEC was launched in 2006

What were the associated pathogens of concern?

{'answer_start': [1908], 'text': ['E. coli O157']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What symptoms did the people had?

{'answer_start': [2280], 'text': ['diarrhoea']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What caused the event?

{'answer_start': [14082], 'text': ['firefighting']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What symptoms did people report?

{'answer_start': [7763], 'text': ['Diarrhoea']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the initial cause of the event?

{'answer_start': [13181], 'text': ['incident during the firefighting']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the date of the event?

{'answer_start': [135], 'text': ['6 December 2010']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the location of the event?

{'answer_start': [216], 'text': ['Belgium']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What pathogen was connected to the outbreak?

{'answer_start': [12032], 'text': ['Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

How was the event first detected?

{'answer_start': [576], 'text': ['routinely taken tap water samples']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

How many people were ill?

{'answer_start': [6618], 'text': ['603 patients']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

How many people were hospitalized?

{'answer_start': [6886], 'text': ['Six patients']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the attack rate?

{'answer_start': [14170], 'text': ['18.7%']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

How many people died?

{'answer_start': [6918], 'text': ['One patient']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What are the pathogens?

{'answer_start': [0], 'text': ['Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the concentration of the contaminant after analysis?

{'answer_start': [12602], 'text': ['>200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. ']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What are the symptoms?

{'answer_start': [2000], 'text': ['gastroenteritis']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the event?

{'answer_start': [225], 'text': ['Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What are the initial steps of investigation?

{'answer_start': [1317], 'text': ['We conducted an epidemiological study to describe the size and identify the source of the outbreak.']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What are the first steps of mitigation?

{'answer_start': [805], 'text': ['advised not to consume or use tap water']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What did the local authorities advise?

{'answer_start': [12985], 'text': ['Bottled potable water was distributed to the population']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What type of samples were examined?

{'answer_start': [116], 'text': [' stool samples']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What steps were taken to restore the problem?

{'answer_start': [13042], 'text': ['Sanitation of water pipes']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What measures were taken to prevent the event?

{'answer_start': [13533], 'text': ['a warning was sent to other re brigades ']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What was the age of the affected people?

{'answer_start': [6672], 'text': ['The age ranged from 1 to 91 years with a median age of 36 years']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What is the source of contamination?

{'answer_start': [13707], 'text': ['consumption of water contaminated by river water']}

Contamination Question Answering

Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.

What was the alert of the event?

{'answer_start': [664], 'text': [' Local general practitioners (GPs) reported an increase in consultations for gastroenteritis']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What symptoms did the people had?

{'answer_start': [2584], 'text': ['diarrhoea (o3 loose stools/day) or vomiting']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What symptoms were developed?

{'answer_start': [3758], 'text': ['diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What type of samples were analyzed?

{'answer_start': [3615], 'text': ['Stool specimens']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the initial cause of the event?

{'answer_start': [1909], 'text': ['A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. ']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the date of the event?

{'answer_start': [1452], 'text': ['30 November']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the location of the event?

{'answer_start': [106], 'text': ['Finnish town']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What pathogen was connected to the outbreak?

{'answer_start': [4073], 'text': ['norovirus']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the source that started the event?

{'answer_start': [4422], 'text': ['Drinking-water contamination']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

How was the event first detected?

{'answer_start': [1207], 'text': ['customers complained of a bad smell and taste in their tap water.']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

How many people were ill?

{'answer_start': [709], 'text': ['8453 residents']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the attack rate?

{'answer_start': [815], 'text': ['53%']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What are the pathogens?

{'answer_start': [2206], 'text': ['adenoviruses and noroviruses ']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What are the symptoms?

{'answer_start': [1550], 'text': ['diarrhoea and vomiting']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the event?

{'answer_start': [0], 'text': ['An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the duration of the event?

{'answer_start': [2501], 'text': ['almost 3 months']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What are the first steps of mitigation?

{'answer_start': [1709], 'text': ['Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. ']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What measures were taken to prevent the event?

{'answer_start': [4324], 'text': ['waterworks across the country ']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What is the source of contamination?

{'answer_start': [2115], 'text': ['drinking-water network became contaminated with sewage effluent']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What was the alert of the event?

{'answer_start': [1511], 'text': ['officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre.']}

Contamination Question Answering

An inappropriate cross-connection between sewage and drinking-water pipelines contaminated tap water in a Finnish town, resulting in an extensive waterborne gastroenteritis outbreak in this developed country. According to a database and a line-list, altogether 1222 subjects sought medical care as a result of this exposure. Seven pathogens were found in patient samples of those who sought treatment. To establish the true disease burden from this exposure, we undertook a population-based questionnaire investigation with a control population, infrequently used to study waterborne outbreaks. The study covered three areas, contaminated and uncontaminated parts of the town and a control town. An estimated 8453 residents fell ill during the outbreak, the excess number of illnesses being 6501. Attack rates were 53% [95% confidence interval (CI) 49.556.4] in the contaminated area, 15.6% (95% CI 13.118.5) in the uncontaminated area and 6.5% (95% CI 4.88.8) in the control population. On Wednesday, 28 November 2007, maintenance work was conducted at the waste water plant in Nokia. The same day, technical problems were encountered in the municipal drinking-water system, and during the days following, customers complained of a bad smell and taste in their tap water. These were first misinterpreted as being caused by harmless deposits loosened from the inner walls of the pipeline and discharged during the maintenance work on 28 November. From 30 November, environmental health and municipal waterworks officials received reports of bouts of diarrhoea and vomiting among residents, and during that same day an increase in the number of patients with gastroenteritis was observed at the health centre. Extensive water and pipeline sampling was initiated and a boil-water notice issued, and water chlorine concentration was increased. The water contamination and its source became evident the same day. A valve in the waste-water plant connecting the drinking-water line and a waste-water effluent line had been opened during the maintenance work and inadvertently left open for 2 days. As a consequence, the drinking-water network became contaminated with sewage effluent. In the contaminated area, adenoviruses and noroviruses were repeatedly detected in water-supply samples despite chlorination and pipeline flushing. Finally, after extensive decontamination procedures including shock chlorination, precautionary restrictions were discontinued in the contaminated area on 18 February 2008, almost 3 months after the incident. A case was defined as a person suffering acute diarrhoea (o3 loose stools/day) or vomiting between 28 November 2007 and 20 January 2008. The occurrence of gastroenteritis during a 10-month period prior to the outbreak was also enquired about to ensure the comparability of the study groups. Faecal specimens for bacterial pathogens were not investigated from all the patients or from representative samples from consecutive cases. Instead, bacterial samples were available from cases with more severe symptoms. Specimens for detection of norovirus were collected from five randomly selected patients within the first week of the outbreak. Other viral pathogens were studied in samples from children admitted to the emergency department of the University Hospital. In order to detect enteric parasites specimens were taken from ten consecutive patients during the second week of the outbreak. Subsequently, when cases with giardiasis were detected, parasites were investigated in all symptomatic patients. Specimens were taken at the health centre or in the University Hospital. Stool specimens were cultured for the presence of Campylobacter, Salmonella, Yersinia and Shigella spp. The most common symptoms reported were diarrhoea (n=813, 79%), vomiting (n=601, 59%), fever (n=337, 33%) and abdominal pain (n=291, 28%). Enteropathogens were detected in faecal specimens (Table 3). The most frequently encountered was Campylobacter sp., with C. jejuni representing most of them, followed by Giardia. Five random samples investigated for norovirus were collected on 2 December 2007 and all were positive. Other findings included non-typhoidal salmonellas, Clostridium difficile and rotavirus. Four stool cultures grew Shigella boydii. After the outbreak, the national authorities required waterworks across the country to rule out the presence of similar cross-connection constructions. Drinking-water contamination was considered to be the obvious source of this outbreak, and this study provides strong evidence to support the assumption.

What were the associated pathogens of concern?

{'answer_start': [4164], 'text': ['non-typhoidal salmonellas, Clostridium difficile and rotavirus']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What type of samples were analyzed?

{'answer_start': [724], 'text': ['stool samples']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What caused the event?

{'answer_start': [3458], 'text': ['drinking water contamination caused by congestion of the combined rainwater drainage and sewage system']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What did the local authorities investigate?

{'answer_start': [1603], 'text': ['online questionnaire']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What is the initial cause of the event?

{'answer_start': [3129], 'text': ['backflow of sewage water into the gravel surrounding the borehole']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What is the date of the event?

{'answer_start': [41], 'text': ['June 2009']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What is the location of the event?

{'answer_start': [131], 'text': ['Danish town']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What pathogen was connected to the outbreak?

{'answer_start': [880], 'text': ['coliform bacteria']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

How was the event first detected?

{'answer_start': [1129], 'text': ['unusual increase in patients with acute gastroenteritis.']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

How many people were ill?

{'answer_start': [492], 'text': ['163 cases']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What is the attack rate?

{'answer_start': [526], 'text': ['16%']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What are the pathogens?

{'answer_start': [650], 'text': ['Campylobacter jejuni']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What are the symptoms?

{'answer_start': [1916], 'text': ['diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What is the event?

{'answer_start': [144], 'text': ['The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. ']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What are the first steps of mitigation?

{'answer_start': [1362], 'text': ['tap-water boiling advice']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What type of samples were examined?

{'answer_start': [848], 'text': ['Water samples']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What did the authorities do to mitigate the event?

{'answer_start': [2897], 'text': ['boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What was the age of the affected people?

{'answer_start': [2447], 'text': ['mean age 42 years)']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What is the source of contamination?

{'answer_start': [3310], 'text': ['drinking water']}

Contamination Question Answering

Following an unusually heavy rainfall in June 2009, a community-wide outbreak of Campylobacter gastroenteritis occurred in a small Danish town. The outbreak investigation consisted of (1) a cohort study using an e-questionnaire of disease determinants, (2) microbiological study of stool samples, (3) serological study of blood samples from cases and asymptomatic members of case households, and (4) environmental analyses of the water distribution system. The questionnaire study identified 163 cases (respondent attack rate 16%). Results showed a significant dose-response relationship between consumption of tap water and risk of gastroenteritis. Campylobacter jejuni belonging to two related aA types were isolated from stool samples. Serum antibody levels against Campylobacter were significantly higher in cases than in asymptomatic persons. Water samples were positive for coliform bacteria, and the likely mode of contamination was found to be surface water leaking into the drinking-water system. In the week beginning 15 June 2009, general practitioners (GPs) in the town of Tune, 30 km south of Copenhagen, noticed an unusual increase in patients with acute gastroenteritis. Campylobacter spp. were detected in stool cultures from some patients. The suspicion of a waterborne gastroenteritis outbreak was raised, an outbreak investigation began and a tap-water boiling advice was issued on 20 June. In the following, we present the outbreak analysis, including a serological follow-up study of persons affected by this waterborne Campylobacter outbreak. A cohort study was initiated using an online questionnaire with questions about signs and symptoms, onset date, duration of illness and exposure to potential sources of Campylobacter infection (e.g. consumption of unboiled tap water, poultry or raw milk, eating ready-to-eat meals from local shops, etc.). A clinical case was defined as a person with diarrhoea (>3 loose stools in 24 h) or abdominal pain with either fever or vomiting, with symptom onset during the period 13-26 June 2009. A confirmed case was defined as a clinical case with a stool culture positive for Campylobacter spp. Water samples were repeatedly taken at the waterworks and at multiple points of the water pipe network following the suspected contamination event. The questionnaire survey was completed by a total of 1039 individuals, response rate 21%, (61% females, 39% males) ranging from 1 to 86 years (mean age 42 years). Of the remaining 933 persons, 159 (153%) were classified as cases and 774 as non-cases, based on their reported symptoms and onset dates. Of these, 41 were culture-positive for Campylobacter jejuni. Cultures for other enteric bacteria were negative. Virological investigations detected sapovirus in two (10%) out of 20 samples tested, and one patient tested positive for both sapovirus and C. jejuni. During 20 June to 30 July, a boiling order was in place for the whole town and the inhabitants were supplied with drinking water from tank trucks. The technical assessment revealed a faulty installation adjacent to one of the boreholes which may have allowed a backflow of sewage water into the gravel surrounding the borehole, when the sewage system was congested due to the heavy rainfall on 12 June. The outbreak was most likely caused by drinking water as shown by several lines of evidence. Second, an exceptionally heavy rainfall occurred a few days before the outbreak, leading to a drinking water contamination caused by congestion of the combined rainwater drainage and sewage system. ailable at

What were the associated pathogens of concern?

{'answer_start': [1186], 'text': ['Campylobacter spp']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What symptoms did the people had?

{'answer_start': [1115], 'text': ['abdominal pain, nausea and headache']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What type of samples were analyzed?

{'answer_start': [724], 'text': ['water samples']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What symptoms did people report?

{'answer_start': [647], 'text': ['omiting, nausea, abdominal pain, fever']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What is the date of the event?

{'answer_start': [6], 'text': ['March 2012']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What is the location of the event?

{'answer_start': [158], 'text': ['Norwegian']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What pathogen was connected to the outbreak?

{'answer_start': [1425], 'text': ['Cryptosporidium oocysts ']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What is the source that started the event?

{'answer_start': [2496], 'text': ['oocysts in the faeces of infected lambs and/or goat kids']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

How was the event first detected?

{'answer_start': [18], 'text': ['the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

How many people were ill?

{'answer_start': [1775], 'text': ['40']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What is the attack rate?

{'answer_start': [1843], 'text': ['19%']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What are the pathogens?

{'answer_start': [182], 'text': ['Cryptosporidium oocysts ']}

Contamination Question Answering

On 25 March 2012, the Norwegian Institute of Public Health (NIPH) was notified about several cases of gastroenteritis in schoolchildren following a stay at a Norwegian holiday farm. Cryptosporidium oocysts were identified in faecal samples from some of the children. A retrospective cohort study was conducted in school- children, teachers and farm staff who had been on the holiday farm during the period 5-23 March 2012. For the analytical study, the case definition was restricted to a person who had been on the farm in the relevant period, and had experienced diarrhoea or at least two of the following symptoms within 2 weeks of the visit: vomiting, nausea, abdominal pain, fever, with duration of illness >1 day. The water samples were analysed using the NVH internal method for Cryptosporidium oocysts and Giardia cysts. Of the 209 respondents, 78 reported gastrointestinal illness following the visit (75 children, three adults). The first case reported symptoms on the evening of 5 March and the last on 18 April. Illness onset of the farm staff was between 15 and 21 March. The most common symptoms were abdominal pain, nausea and headache (Table 1). Median duration of symptoms was 45 days, ranging from a few hours to >2 weeks. Most cases included in the analytical study (43%, 17/40) reported symptoms 79 days after arrival at the farm (Fig. 1). Of the pupils answering the questionnaire and reporting illness, Cryptosporidium oocysts were detected in faecal samples from eight cases. Most laboratory-diagnosed cases (100%, 8/8) expressed abdominal pain, diarrhoea (7/8), fever (7/8), nausea (6/8) and headache (5/8). Half of the cases reported vomiting (50%, 4/8) (Table 1). Only three of the cases reported contact with ill persons before symptom onset. Only 40 matched the case definition of the analytical study (attack rate 19%), and all were aged between 10-14 years. Nine faecal samples received early in the investigation were analysed for Salmonella, Shigella, Yersinia, Campylobacter, norovirus, sapovirus, Giardia cysts and Cryptosporidium oocysts; all were positive for Cryptosporidium and negative for other enteropathogens. Most of these samples contained low oocyst concentrations, but the faecal sample from one lamb contained a very high concentration of Cryptosporidium oocysts (>1*10^6 oocysts/g faeces). This investigation indicates that the outbreak was probably due to direct or indirect contact with infected animals. The source of this outbreak was probably oocysts in the faeces of infected lambs and/or goat kids.

What is the concentration of the contaminant after analysis?

{'answer_start': [2311], 'text': ['>1*10^6 oocysts/g faeces']}