File size: 80,470 Bytes
1beaa32
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
{"text": "In The original images underlying the updated PLOS ONE\u2019s Editorial Board confirmed that the revised version of A member of The authors apologize for the error in the published article.S1 File(PPT)Click here for additional data file.S2 File(ZIP)Click here for additional data file.S3 File(ZIP)Click here for additional data file.S4 File(ZIP)Click here for additional data file.S5 File(ZIP)Click here for additional data file.S6 File(XLSX)Click here for additional data file."}
{"text": "The raw data underlying the results of this paper are missing from the list of Supporting Information. The authors have provided the data as Supporting Information file S1 DataThis file includes supplementary data.(XLSX)Click here for additional data file."}
{"text": "This report describes the 2020 Competition on Software Testing (Test-Comp), the 2"}
{"text": "A grant number from the funder JSPS KAKENHI is missing from the Funding statement. The missing grant number is: 16H06279 (PAGS) (TT). The publisher apologizes for the error."}
{"text": "Attitudinal Acceptance of Intimate Partner Violence Among Adolescents and Young Adults in Nigeria and Tanzania: An Exploration Into Target Reference Groups Order and Affiliation of Authorship. J Adolesc Health 2020;66:S3\u2013S8. The title is incorrect. The correct title is, \u201cAttitudinal Acceptance of Intimate Partner Violence Among Adolescents and Young Adults in Nigeria and Tanzania: An Exploration Into Target Reference Groups.\u201d"}
{"text": "The following information is missing from the Funding statement: This study was also supported by the Engineering and Physical Sciences Research Council (grants GR/R99393/01 and EP/C015452/1) to GK."}
{"text": "There is an error in Please see the Supporting Information files below for the underlying blots for The authors indicate that underlying images for other figures are available upon request.S1 File(ZIP)Click here for additional data file.S2 File(ZIP)Click here for additional data file."}
{"text": "In S1 Appendixv.Appendix indicating calculation of the new metric (DOCX)Click here for additional data file."}
{"text": "There are errors in the Funding statement. The publisher apologizes for the errors. The correct Funding statement is as follows: This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government under Grant NRF-2019R1A4A1029769 and Grant NRF-2019R1I1A3A01058959."}
{"text": "The following information is missing from the Funding statement: This project has received funding from an EPSRC Impact Acceleration Grant (Grant number: EP/R511717/1)."}
{"text": "The sample in Additionally, the \u00d720 magnification image for The primary data underlying the rest of the results reported in this article are no longer available.S1 File(ZIP)Click here for additional data file."}
{"text": "The following information is missing from the Funding statement: This study has been funded by Instituto de Salud Carlos III through the project \"PI16/00748\"  awarded to MI."}
{"text": "Scientific Reports 10.1038/s41598-023-40348-6, published online 21 August 2023Correction to: The Acknowledgements section in the original version of this Article was incomplete.\u201cThis paper is supported by Zhejiang Provincial Philosophy and Social Sciences Planning Project and Hangzhou Philosophy and Social Sciences Planning Project [grant number Z23JC066].\u201dnow reads:\u201cThis paper is supported by Zhejiang Provincial Philosophy and Social Sciences Planning Project, National Natural Science Foundation of China [grant number 72304246] and Hangzhou Philosophy and Social Sciences Planning Project [grant number Z23JC066].\u201dThe original Article has been corrected."}
{"text": "There are errors in the Funding section. The correct Funding statement is: The study was funded by Kuwait University Research Sector\u2019s grants RM01/13 and SRUL02/13."}
{"text": "Correction to: Journal of Epidemiology and Global Health (2023) 10.1007/s44197-023-00097-1In the original version of this article, the middle name and ORCiD of Ramy Mohamed Ghazy were missing and the sentence \u2018The figures were built using Microsoft Office 2016 and ggplot2 package built under R version 4.2.\u2019 should have read \u2018The figures were built using Microsoft Office 2016.\u2019The original article has been corrected."}
{"text": "There is an error in The original data underlying the Fig 2A results are provided in S1 File(XLS)Click here for additional data file."}
{"text": "Authors declare no conflict of interests for this article.I read with great interest the paper by Sinha et al. about Takotsubo syndrome (TS) in subjects undergoing catheter ablation for atrial fibrillation (AF) based on multicenter retrospective database.I have two comments and questions for the author: (1) Have you taken into consideration coronary spastic angina (CSA)? It is well known that CSA can be caused by direct thermal damage resulting from radiofrequency (RF) energy or an autonomic nervous system imbalance."}
{"text": "The Acknowledgment should becorrected to include the following: Sevban Do\u011fan Ekici sincerelyacknowledges the Turkish Ministry of National Education for theirsponsorship of her PhD studies. Joana do Mar Machado would like toacknowledge funding from the EPSRC Centre for Doctoral Training inSmart Medical Imaging (EP/S022104/1)."}
{"text": "S1 FileContains descriptions of various methods used in the study.(DOCX)Click here for additional data file."}
{"text": "Scientific Reports 10.1038/s41598-022-13624-0, published online 09 June 2022Correction to: The original version of this Article contained an error in the Acknowledgments section.\"This work is supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2021R1A2C2007397 and 2017M3D9A1073784), the Ministry of Education (2018R1A6A1A03024940) through Basic Science Research Program and the Korea Ministry of Environment (MOE) (2020002960004). We are also thankful for the financial support by a grant of the Korea Health Technology R&D project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (Grant Number HI17C1238030021).\"now reads:\"This work is supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2021R1A2C2007397 and 2017M3D9A1073784), the Ministry of Education (2018R1A6A1A03024940) through Basic Science Research Program and the Korea Ministry of Environment (MOE) (2020002960004). We are also thankful for the financial support by a grant of the Korea Health Technology R&D project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (Grant Number HI17C1238).\"The original Article has been corrected."}
{"text": "In the following article,The correct Figure 3 is shown below:The Supplementary Figure 2 has been corrected online.The authors apologize for the errors."}
{"text": "There are errors in the Funding section. The correct Funding statement is: This study was supported by four different funds: 1) Community Service Fund (83CT), The Hong Kong Polytechnic University; 2) Chinese Mainland Affairs Office Fund, The Hong Kong Polytechnic University; 3) Lions Clubs International MD300 Taiwan Eye Care Network Committee; and 4) InnoHK, HKSAR Government."}
{"text": "This Correction addresses errors in Figs Specifically, the incorrect underlying data were used in In The corrected The authors apologize for any inconvenience and confusion these errors may have caused.S1 File(XLSX)Click here for additional data file.S2 File(XLSX)Click here for additional data file."}
{"text": "Scientific Reports 10.1038/s41598-023-40954-4, published online 23 August 2023Correction to: The original version of this Article contained an error in the Funding section.\u201cThis paper is supported by the National Social Science Foundation of China Project Number: 21JBY179.\u201dnow reads:\u201cThis paper is supported by the National Social Science Foundation of China Project Number: 21BJY179.\u201dThe original Article has been corrected."}
{"text": "The ponceau loading control panels in The authors provide an updated version of The raw data underlying The authors apologize for the error in the published article.S1 File(PPTX)Click here for additional data file.S2 File(XLSX)Click here for additional data file."}
{"text": "The second author\u2019s name is spelled incorrectly. The correct name is: Eun A. Park.The following information is missing from the Funding statement: This study was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government  [grant number 2021R1F1A1045993]"}
{"text": "BMC Medical Genomics in the supplement containing selected articles from the IEEE International Conference on Bioinformatics and Biomedicine 2012 (IEEE BIBM 2012) [Our original article was published in"}
{"text": "To the Editor: I read with great interest the article regarding lymphocytic choriomeningitis virus (LCMV) meningitis in a New York City resident ("}
{"text": "There were errors in the typesetting of Tables in the article. Correct versions of the Tables are available below.Table 1: Table 2: Table 3: Table 4: Table 5:"}
{"text": "A funding organization was incorrectly omitted from the Funding Statement. The following sentence should be included with the Funding Statement: \"Co-author Phillip Olsen was supported partially by the Research Experiences for Undergraduates (REU) Program of the National Science Foundation.\"In addition, the following sentence should be read with the Acknowledgments: \"Authors would like to acknowledge Mutant Mouse Regional Resource Center U42OD010918 for providing mouse strain 011981-MU [Nagy ES cell line R1 with EGFP (B5)].\""}
{"text": "Retrovirology for publishing these erroneous data.The authors would like to retract the article \"The cellular source for APOBEC3G's incorporation into HIV-1\" (cited a"}
{"text": "The following information is missing from the Funding section: This study was supported by NIH grants R01CA118708 and R01CA166825."}
{"text": "The Supporting Information files were erroneously supplied as LaTeX files. Please see Appendix S1 and Appendix S2 at the following links:Click here for additional data file.Click here for additional data file."}
{"text": "Sensors in 2011 [The coefficient of the expression of Equation (6) was not properly written. Equation (6) should be corrected as"}
{"text": "There is an error in the key for Figure 2. The correct key for Figure 2 is:black dots: iso1green dots: iso10blue dots: ctrred dots: ate"}
{"text": "There is an error in Text S1. The correct file can be found here: Click here for additional data file."}
{"text": "The island outline in Figure 1 is inaccurate. The following link contains the corrected Figure 1 file: ."}
{"text": "The authors would like to add the following grant to their funding information: \"Faculty of Engineering research grant (2010), Burapha University Thailand (Grant #33/2553).\""}
{"text": "In Supplementary Table 1, the last line of the control primer sequence should read GAPDH GGGAGCCAAAAGGGTCATCATC TGGCATGGACTGTGGTCATGAG instead of GAPDH GGGAGCCAAAAGGGTCTCATC TGGCATGGACTGTGGCCGAG. Please find the corrected Supplementary Table 1 here: Click here for additional data file."}
{"text": "A revised version of Table S1 with additional information can be viewed here: Click here for additional data file.[^]"}
{"text": "The graphs are missing from Supplementary Figures S3 and S5. Please see the correct version of the figures here:Figure S3: Click here for additional data file.Figure S5: Click here for additional data file."}
{"text": "The following information was missing from the funding section: Austrian Science Fund (P21667-B09)."}
{"text": "The authors wish to add the following to their Funding section: \"This initiative is funded by the CTSI (grant by number 1 UL1 RR029893).\""}
{"text": "A second grant given by the National Cancer Institute was incorrectly omitted from the Funding statement. The number of the second grant is: 1RO1 CA109478."}
{"text": "The Appendix S1 Maternal Severity Index Calculator is currently unavailable for reader use. The accessible file can be found here: Click here for additional data file."}
{"text": "There are multiple errors in the titles for Figure 3 and 4. The correct titles for the figures are:In figure 3D: the tile should be: Luminal A In figure 4A: the title should be: All patients In figure 4B: the title should be HER2 In figure 4C: the title should be Basal In figure 4D: the title should be Luminal-A In figure 4E: the title should be Luminal-B"}
{"text": "Figure S1 of the Supporting Information section is missing several parts. Please see the corrected Figure S1 here: Click here for additional data file."}
{"text": "The number of the grant from Kaohsiung Medical University Hospital is incorrect. The correct grant number is: KMUH100-0M08."}
{"text": "A funding organization and funding program were incorrectly omitted from the Funding Statement. The Funding Statement should read: \"This work was supported by NIH/NINDS 5P50NS037409 (XOB and NS) and by the Parkinson's and Movement Disorder's Foundation (PMDF 2011).\""}
{"text": "The Supporting Information files, Data S1 and Data S2, are corrupt. The correct files can be viewed here:Click here for additional data file.(Data S1)Click here for additional data file.(Data S2)"}
{"text": "Two additional grants from the National Eye Institute were incorrectly omitted from the Funding Statement. The numbers of the two grants are: R24EY022012 and R01EY017549."}
{"text": "The following funding source was omitted from the published article: The Multicenter AIDS Cohort Study is funded by the National Institutes of Health grant NIH 2 U01 AI035039-22."}
{"text": "The files for Figures S6 and S7 are incorrect. Please view the correct Figure S6 here: Click here for additional data file.and view the correct Figure S7 here: Click here for additional data file."}
{"text": "The authors with to add the following funding source to their financial disclosure information: The work was partly supported by Scott & White RGP Award (R8000 R3536) to SG."}
{"text": "A file was erroneously omitted from the list of Supporting Information. The full derivation of Equation 1 can be viewed here: Click here for additional data file."}
{"text": "The formatting of Table 5 contained an error. The correct version of Table 5 can be seen here: [^]"}
{"text": "There is an error in Figure S3. The correct mutations for Sample ISBLAC3803 are S571L TCG>TTG and S614* TCA>TGA. Please view the corrected Figure S3 here: Click here for additional data file."}
{"text": "The following information was missing from the Funding section: This work was also funded by Taipei Medical University (TMU100-AE3-Y15)."}
{"text": "An error in the file extension was introduced during the production process for Figure S1. Figure S1 can be viewed here: Click here for additional data file."}
{"text": "There were errors in Supporting Tables S6 and S7.Please see the corrected Table S6 here: Click here for additional data file.Please see the corrected Table S7 here: Click here for additional data file."}
{"text": "In Reply: The Croatian Medical Journal strictly follows the rule that manuscripts based on unregistered clinical trials are immediately rejected (rejected -3."}
{"text": "The Supporting Information Table 1 was incorrectly uploaded. Please view the correct Supporting Information Table 1 file here: Click here for additional data file."}
{"text": "A funding source was omitted from the published funding statement. The authors would like to add: The research leading to these results has received funding from the European Union's Seventh Framework Programme (FP7/2007-2011) under grant agreement n\u00b0 259679 (IDEAL)."}
{"text": "Errors occurred in the preparation of Figure S3. Please see the corrected Figure S3 here: Click here for additional data file."}
{"text": "Figure S6 is incorrect. Please see the correct version of Figure S6 here: Click here for additional data file."}
{"text": "Two additional grants from the NIH to the fifth author (ELB) were incorrectly omitted from the Funding Statement. The numbers of the two grants are: NIMH R01 MH096093 and NINDS R01 NS062184."}
{"text": "A funding organization for the seventh and eighth authors was incorrectly omitted from the Funding Statement. The Funding Statement should read: The work is supported by R33 grant from NCI (4R33CA126209) through Clinical Proteomic Technologies for Cancer(CPTC)to XG and XZ."}
{"text": "The following information is missing from the funding statement: LKJ was funded in part by the ARRA supplement grant to the CoBRE \u201cCenter for the Analysis of Cellular Mechanisms and Systems Biology\u201d (3P20RR024237-02S1). Support for the NMR Facility at MSU was provided by the NIH Shared Instrumentation Grant program (grants # 1S10RR13878 and 1S10RR026659)."}
{"text": "Video S1 and Video S3 have been switched in the Supporting Information. Please view the correct videos and their description below.Video S1First day culture of normal newborn ovary. A square indicates somatic cell invasion of oocyte cyst.(MP4)Click here for additional data file.Video S3First day culture of Figla null newborn ovary.(MP4)Click here for additional data file."}
{"text": "The Supporting Information files in the paper do not appear properly. The correct files can be found here:Figure S1: Click here for additional data file.Figure S2: Click here for additional data file."}
{"text": "The column headings in Dataset S3 are incorrect due to a formatting error. The Column headings in Columns K-P were originally presented in an incorrect order. Please view the correct Dataset S3 here: Click here for additional data file."}
{"text": "Table S4 does not correctly download from the article. Please view the correct file for Table S4 here: Click here for additional data file."}
{"text": "The supporting information file Figure S1 is the wrong file. Please view the correct Figure S1 file here: Click here for additional data file."}
{"text": "The correct name of the third author is: Kevin ThurleyThe correct version of Figure 5 available here:"}
{"text": "This article is missing the Supporting Information File \"Text S1\". Please use the following link to access Text S1: Click here for additional data file."}
{"text": "A figure file was erroneously omitted from the list of Supporting Information. The publisher apologizes for the error. The figure's description is \"Detection of a splenic IL-2 transcript after 2 h of TCR-2 stimulation,\" and it can be viewed here: Click here for additional data file."}
{"text": "The file Text S1 was published in an incorrect format. Please view the correct Text S1 file here: Click here for additional data file."}
{"text": "The three p-values in the far right column of Table 2 should align with the categories of Long term (%), Day hospital (%), and Out-patient visit (%). Please see the corrected Table 2 here:"}
{"text": "The most recent version of Table 4 was not included in the final manuscript. Please see the correct Table 4 here: The current Table S1 mistakenly contains all the markers of the RosBREED SNP array. Please find the corrected Table S1 which only includes markers used in the manuscript here: Click here for additional data file.The wrong version of Figure S2 was included in the final article. Please see the correct Figure S2 here: Click here for additional data file."}
{"text": "There was an error in the text \"B(i)B(i)\" in the third paragraph under the \"Sequence Centrality\" heading. The correct text is \"B(i)\"."}
{"text": "The Competing Interests statement is incorrect. The correct Competing Interests statement is: The University Medical Centre Hamburg-Eppendorf has filed patent US8101352B2 \u201cDetection of ESR1 Amplification in Breast Cancer\u201d and accordant patent applications in EU and CA for certain technology described in this paper."}
{"text": "Please see Figure 1 with the correct names here: The caption names for G"}
{"text": "There were errors in Table S1. The correct version of the file is available here: Click here for additional data file."}
{"text": "Scientific Reports6: Article number: 23351;10.1038/srep23351 published online: 03302016; updated: 04222016This Article contains typographical errors in a grant number in the Acknowledgements section.\u201cThis work was supported by grants National Natural Science Foundation of China ,\u201dshould read:\u201cThis work was supported by grants National Natural Science Foundation of China ,\u201d"}
{"text": "There is an error in the Supporting Information File S1Implementation of the SI algorithm in Matlab. The software includes a manual and user friendly interface Song_gui.(ZIP)Click here for additional data file."}
{"text": "In the Funding section, the grant number NNJ10ZSA001N from the funder National Aeronautic and Space Administration has been updated by the funder. The updated grant number is: NNX11AD22G."}
{"text": "The following information is missing from the Funding section: This study was supported by the S\u00e3o Paulo Research Foundation (FAPESP) grant: 2015/15699-5."}
{"text": "Additionally, there is a sentence missing from the caption for S1 Blot(PPTX)Click here for additional data file."}
{"text": "There are errors in the equations of file S1 Text(PDF)Click here for additional data file."}
{"text": "The authors have prepared a revised manuscript to address comments left by readers regarding the species examined in this article as well as the classification of pestiviruses. Please view a revised manuscript provided as Supporting Information , a revisS1 File(PDF)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file."}
{"text": "There is an error in the Supporting Information where the incorrect database is linked. Please view the correct S1 Text(XLSX)Click here for additional data file."}
{"text": "A 27 year old patient presented with primary infertility of 3 years' duration and also a history of myomectomy (5 years ago) was referred to our infertility clinic for investigation of infertility. The latest Hysterosalpingography (HSG) revealed an obstructed left fallopian tube with apparently a unicornuate uterus with luminal contour irregularity and normal left fallopian tube . Signifi"}
{"text": "The legends for S1 FilePDF version of the questionnaire made of screenshots from the online survey tool.(PDF)Click here for additional data file.S2 FileA PDF file containing further screenshots from 3D PDF reports described in this article. This file also contains download links for complete 3D PDF reports.(PDF)Click here for additional data file."}
{"text": "The article has been correctedonline.In the article \u201cA Retrospective Study of the Impact of Intraoperative IntactParathyroid Hormone Monitoring During Total Parathyroidectomy for SecondaryHyperparathyroidism: STARD Study,"}
{"text": "The following information is missing from the Funding and Acknowledgments sections: This research was supported by a grant (NRF-2013R1A1A2058169) from the National Research Foundation."}
{"text": "S1 FileCharacteristics of the sample and individual responses to high-intensity interval exercise bout.(XLSX)Click here for additional data file."}
{"text": "After publication of this Research Article , we noteCorrected version of articleBMC Cancer14:503.(PDF 433 KB)Additional file 1:"}
{"text": "The following information is missing from the Funding section: This study was supported by grant EU-ERDF (PI12/00378) from the Instituto de Salud Carlos III."}
{"text": "There is an error in S1 TableThis table lists the genes included in the siRNA library alongside the gene accession number and the median Z scores from three replicate screens for each cell line.(XLSX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: Instituto de Salud Carlos III and Fondos Feder (PI12/00104) partially supported this research."}
{"text": "There are errors in the annotation column of S2 TableHT: genes were only found in the HT group; HC: genes were only found in the HC group; *: padj>0.05.(XLSX)Click here for additional data file."}
{"text": "The incorrect S1 File appears in the published paper. Please view the correct S1 TextThis file contains a list of the 36 questions included in the mSRS. Please view the correct S1 Text here.(DOCX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This work was funded by the Medical Research Council (grant number MR/J50032X/1)."}
{"text": "There is an error in Fig 2 of the published article. Panel (a) was replaced with a copy of Fig 1.The Supporting Information file S1 Equations contains the incorrect set of differential equations.Please see corrected S1 Equations(PDF)Click here for additional data file."}
{"text": "Due to a clerical error by the authors, S1 File(PPTX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: HR and BDL were funded by United States\u2019 Public Health Service Grant R01 AI089826."}
{"text": "The following information is missing from the Funding section: Funding was provided by NCI  1 R03CA162505-1 with an Administrative Supplement from the Office of Dietary Supplements."}
{"text": "The following information is missing from the Funding section: This work was funded by the Medical Research Council (grant number MR/J50032X/1)."}
{"text": "There is an error in the legend for Table S1Average binding energy  and Rosetta energy obtained for each residue mutation of Vif complexed to EloBC-A3G N-CDA.(DOC)Click here for additional data file."}
{"text": "There are errors in the Supporting Information. In In Please view the corrected Datasets S1 Data(DOCX)Click here for additional data file.S2 Data(CSV)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This work was supported by National Institute of Health R01HD072848-01A1."}
{"text": "There are errors in the Funding section. The publisher apologizes for these errors. The correct funding information is as follows: This work is supported by the National Research Foundation of Korea (NRF) grants funded by the Korean government (MSIP) GRANT numbers: 2015R1A5A001906 and 2013M3A9C4078158."}
{"text": "There is an error in the Supporting Information Analysis S1(DOCX)Click here for additional data file."}
{"text": "The authors would like to correct S1 Data and Images(ZIP)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: Support for this publication was obtained with Grant 2014/1898-7 from the Sao Paulo Research Foundation (FAPESP)."}
{"text": "The first concern was about Figure 2c ('middle right panel: The right 2 lanes look very similar') whilst the second was about Figure 3b ('PK-panel: A rectangle with a much lighter background than the rest of the blot appears to be visible in the first 4 lanes.').Concerns have been raised about two of the figures published in this article , who is satisfied with the authors' response to the concerns.Please find the original gels included below as supporting information files.S1 Gel(TIF)Click here for additional data file.S2 Gel(TIF)Click here for additional data file."}
{"text": "File S1 is an accidental duplicate of File S2. The correct File S1 can be viewed below.File S1Level assignments in the Lapakahi detailed study area for plotting with Google Earth.(ZIP)Click here for additional data file."}
{"text": "One line on each page of Figure S5Corrected FigurePDFClick here for additional data file."}
{"text": "The second group heading in column one of S2 Table(XLSX)Click here for additional data file."}
{"text": "The HIV-1 sequence data are missing from the published article. Please view these data as file S1 Data(DOCX)Click here for additional data file."}
{"text": "The authors would like to correct The authors have provided a corrected version of S1 File(PPT)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This study was supported by the Geophysical Fluid Dynamics Institute (GFDI) (Contribution Number 470). Both LG and CH were partially supported by GFDI."}
{"text": "Table S1 in the published article is missing three primers. Please view the corrected version of Table S1 here for the complete list of primers, with omissions highlighted in yellow.Table S1Primers used in this study, including specifications for the amplification PCR .(XLSX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This study was supported by a grant from the Deutsche Forschungsgemeinschaft (SCHE 307/7-1) to GSB. The publisher apologies for this error."}
{"text": "Please view the correct In There are a number of errors in tmlY, and the gene name at coordinate 79587..80669 should be tmuA. Please view the correct Table S1 here.In Table S1, the gene names at coordinates 78712..79242 and 79587..80669 are incorrectly switched. The gene name at coordinate 78712..79242 should be Table S1Predicted gene products of pTML1.(DOC)Click here for additional data file."}
{"text": "There are errors in the Supporting Information file S1 Text(DOC)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This study was supported by CNPq grant 485757/2007-9."}
{"text": "The following information is missing from the Funding section: This research is supported by UM Grant Challenge Grant GC003A-14HTM."}
{"text": "There is an error in There are formatting errors in the Supporting Information files Appendix S1Some properties of the proposed functional diversity measures.(PDF)Click here for additional data file.Appendix S2Decomposition of the proposed functional diversity measures.(PDF)Click here for additional data file.Appendix S3Four classes of functional similarity/differentiation measures.(PDF)Click here for additional data file.Appendix S4Functional beta diversity and functional diversity excess lead to the same classes of similarity and differentiation measures.(PDF)Click here for additional data file.Appendix S5Supplementary examples and comparisons.(PDF)Click here for additional data file."}
{"text": "S1 DataThe association of ICP with locus-specific Indigenous American ancestry was tested with logistic regression. S1 Data shows the admixture mapping results for all 109917 markers across the genome.(ZIP)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This work was also partially supported by the Worldwide Cancer Research grant (N\u00b014-0346 to S.T.)."}
{"text": "There are errors to the Accession and Code in Analyses columns of Table S1. Please view the correct Table S1 below.Table S1Sample Information including GenBank accession numbers for newly published sequences used in this study.(PDF)Click here for additional data file."}
{"text": "In The authors would like to correct Figs The authors confirm that these changes do not alter their findings. The authors have provided the underlying images for all figures in the original article as Supporting Information.S1 File(ZIP)Click here for additional data file.S2 File(ZIP)Click here for additional data file.S3 File(ZIP)Click here for additional data file."}
{"text": "There are a number of errors in S5 Table(XLSX)Click here for additional data file."}
{"text": "Scientific Reports6: Article number: 2642810.1038/srep26428; published online: 05262016; updated: 07072016This Article contains errors in the Acknowledgements section.\u201cThe authors acknowledge funding support from the National Health and Medical Council of Australia (1004926).\u201dshould read:\u201cThe authors acknowledge funding support from the National Health and Medical Research Council of Australia (1004926) and Diabetes Australia.\u201d"}
{"text": "Scientific Reports5: Article number: 1161710.1038/srep11617; published online: 07012015; updated: 06202016In this Article, there is an error in Figure 3 where the formation of the ATP molecule between the reaction steps 3PGA and 2 Pyruvate should be omitted. The correct Figure 3 appears below as"}
{"text": "The top panel of western blots in S1 Blots(ZIP)Click here for additional data file."}
{"text": "There are formatting errors in Table S1Proportions of Parkinson's Disease Patients Prescribed Anti-Parkinson Drugs According to Two Age Groups.(DOC)Click here for additional data file."}
{"text": "Table S2 contains track changes in both the XML and PDF versions of the article. Please see the corrected Table below.Table S2Annotation entry statistics for 1555 human transporter genes.(DOC)Click here for additional data file."}
{"text": "Scientific Reports6: Article number: 25035; 10.1038/srep25035 published online: 04282016; updated: 06102016The Acknowledgements section in this Article is incomplete.\u201cThanks very much for the contributions on statistical work by Dr Qian Zhou\u201d.should read:\u201cThanks very much for the contributions on statistical work by Dr Qian Zhou. This work was supported by grants from the National Natural Science Foundation of China (Grant 81370786)\u201d."}
{"text": "The original version of this article  referredAdditional file 1:Plasmonic molecules via glass annealing in hydrogen: supplementary materials."}
{"text": "The following information is missing from the Funding section: BG is supported by NIH P30 AG10133."}
{"text": "There is an error in the layout of question 7 in S1 Reduced Model(PDF)Click here for additional data file."}
{"text": "The Supporting Information files S1 MOVIEResults from this data processed with MATtrack can be seen in Fig 6.(MOV)Click here for additional data file.S2 MOVIEResults from this data processed with MATtrack and AndorIQ2 can be seen in Fig 7.(MOV)Click here for additional data file.S1 FileInstallation and operation instructions for MATtrack.(PDF)Click here for additional data file.S2 File(ZIP)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: Caroline Brennan was supported by (UK) Medical Research Council grant G1000053."}
{"text": "The correct Data Availability Statement should read: Data are available from Dryad Digital Repository (doi:"}
{"text": "The following information is missing from the Funding section: This work was also supported by Czech Science Foundation no. P505/11/2387."}
{"text": "PLOS ONE editorial team would like to express our gratitude to all those individuals who participated in the peer review process of submissions to PLOS ONE over this past year. During 2015 PLOS ONE published over 28,000 research articles. This would not have been possible without the contribution of more than 76,000 reviewers from around the world and a wide range of disciplines.PLOS and the PLOS ONE reviewers are listed in PLOS ONE authors in the evaluation of their work. Your efforts are a key reason for PLOS ONE\u2019s success as an innovative and influential publication.The names of our 2015 S1 Reviewer List(PDF)Click here for additional data file.S2 Reviewer List(PDF)Click here for additional data file.S3 Reviewer List(PDF)Click here for additional data file.S4 Reviewer List(PDF)Click here for additional data file.S5 Reviewer List(PDF)Click here for additional data file."}
{"text": "The article has since been corrected online.In the article \u201cEvaluation of Safety and Efficacy of Salvage Therapy With Sunitinib, Docetaxel (Tyxane) and Cisplatinum Followed by Maintenance Vinorelbine for Unresectable/Metastatic Nonsmall Cell Lung Cancer Stage 1 of a Simon 2 Stage Clinical Trial\u201d,"}
{"text": "The following information is missing from the Funding section: this work is supported by the National Science & Technology Pillar Program (2014BAJ04B02)."}
{"text": "The following information is missing from the Funding section: This study was also supported by grant NIH P30 DK056341 from the Washington University Nutrition Obesity Research Center."}
{"text": "Scientific Reports 10.1038/s41598-023-29909-x, published online 27 February 2023Correction to: The Acknowledgments section in the original version of this Article was incomplete.\u201cThis research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2021R1C1C2005307 and 2017R1A6A1A03015876).\u201dnow reads:\u201cThis research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2021R1C1C2005307 and 2017R1A6A1A03015876). It was also supported by the grant of the Korea Health Industry Development Institute .\u201dThe original Article has been corrected."}
{"text": "DOI: 10.1039/D1RA04855D.Correction for \u2018An indenocarbazole-based host material for solution processable green phosphorescent organic light emitting diodes\u2019 by Eun Young Park  The authors regret that an incorrect version of The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
{"text": "Journal of Healthcare Engineering has retracted the article titled \u201cClinical Study on the Relationship between the SNP rs8192675 (C/C) Site of SLC2A2 Gene and the Hypoglycemic Effect of Metformin in Type 2 Diabetes\u201d [Following an investigation conducted by the Hindawi Research Integrity team , signifiThe authors do not agree to the retraction."}
{"text": "The errors appear only in PDF versions downloaded on or before April 7, 2022."}
{"text": "The authors would like to make a correction in a recently published paper . There wOriginal Figure 1:We would like it to be corrected as shown below.New Figure 1:Original Figure 2:New Figure 2:Original Figure 4:New Figure 4:The authors apologize for any inconvenience caused and state that the scientific conclusions are unaffected. The original publication has also been updated."}
{"text": "The results of sensitivity analyses using the isometric log transformed activity variables were incorrect. The results have been corrected in In the fifth paragraph of the Results section, the third sentence is incorrect. The paragraph should read:Results of sensitivity analyses using \u201cother day\u201d imputed data were broadly consistent with the results of our main analyses using the complete days data . Results of sensitivity analyses excluding BMI and ill health as covariates were comparable to our main analyses (S4\u2013S6 Tables). Results using isometric log ratio transformed activity variables were largely consistent with our main analyses \u2013S12 FigsS10 Fig(PDF)Click here for additional data file.S11 Fig(PDF)Click here for additional data file.S12 Fig(PDF)Click here for additional data file."}
{"text": "The original version of this article unfortunately contained a mistake. The peptide sequence (R)ICSINSPGVRPFGAK(D) on pages 3 and 7 is incorrect. The correct sequence is: (R)GEKGEAGPPGAAGPPGAK(G). The authors state that this mistake in displaying the peptide sequence does not affect other results or interpretation of the data. The original article has been corrected."}
{"text": "S1 TextCriteria, thresholds, and levels used in model of impact and resource needs.(PDF)Click here for additional data file."}
{"text": "Since online publication of this article (1) The statistical graph of BrdU (+) cells number for C33A cells after LGALS1 overexpression in Figure (2) The flow cytometric image of Control-shRNA group for C33A cells in Figure (3) The statistical graph showing the relative level of Fascin protein for C33A cells in Figure The correction does not affect the original results and conclusions of this study. The authors apologize for any inconvenience or misunderstanding caused."}
{"text": "In the original article , there wThe Original Figure 1:The Correct Figure 1:"}
{"text": "The following information is missing from the Funding statement: This work was supported by NIH grant 1R01NS114007-01A1."}
{"text": "In the original publication of this article , the product OSOM Ultra Flu A&B Test was incorrectly referred to as OSOM Ultra Plus Flu A&B Test. This has been corrected in the version currently available online."}
{"text": "In our paper, the Western Blot bands #01 and #03 in Figure"}
{"text": "The following information is missing from the Funding statement: This article was supported by Gazi University Scientific Research Projects Unit with grant number 5959, code 64/2020-03."}
{"text": "There are errors in the Supporting Information. S1 TextRNA isolation using phase extraction and ETOH precipitation\u2014suitable for samples with high carbohydrate content.(DOCX)Click here for additional data file.S2 Text(PDF)Click here for additional data file."}
{"text": "Funding statement was erroneously omitted. The correct Funding statement appears below.In the published article, the \u201cThis work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIP) (NRF-2018R1D1A1B07050568).\u201dThe authors apologize for this error and state that this does not change the scientific conclusion of the article in any way. The original article has been updated."}
{"text": "An error was identified in the S1 Data(XLSX)Click here for additional data file."}
{"text": "The authors regret that some articles reporting probes for detecting human NAD(P)H:quinone oxidoreductase 1 were not cited in the original article. The missing references are listed below as 1\u20136Herein, we designed and synthesized a novel fluorescent probe 1 for detection of hNQO1 based on TCF-OH as a chromophore and quinone propionic acid (QPA) as a recognition group.The authors sincerely apologise for this oversight.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
{"text": "DOI: 10.1039/D1RA01427G.Correction for \u2018Nano zero valent iron (nZVI) particles for the removal of heavy metals (Cd The correct reference is given below as reference 1.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
{"text": "Funding/Support should have included grants R01AG038791 and U19AG063911 from the National Institutes of Health to Dr Boxer. This article has been corrected.1In the Original Investigation titled \u201cDiagnostic Accuracy of Magnetic Resonance Imaging Measures of Brain Atrophy Across the Spectrum of Progressive Supranuclear Palsy and Corticobasal Degeneration,\u201d"}
{"text": "The following grant number is missing from the Funding statement: ES/P000681/1. The correct Funding statement is as follows: This study was carried out with PhD funding received by CDF from the Economic and Social Research Council (ESRC) under the grant reference numbers ES/R5009381/1 and ES/P000681/1."}
{"text": "The original version of this article  unfortunIn recent research work, the mistake occurred on primer sequence of NR2B for RT-PCR shown in Table The corrected primer sequence of NR2B should be as followingsForward: GCTCATCGCCAAGGGTACATCReverse: TGCACTATTTCAAGTCACATGCCTAThe correct version of Table"}
{"text": "Pegasus species individuals in Plate B are incorrect. Please see the correct In Pegasus species individuals in The COI GenBank Accession Numbers for the S2 Table(XLSX)Click here for additional data file."}
{"text": "PLOS ONE\u2019s figure preparation guidelines, instead the lower bands should have been included in the published panel, and the text should have commented on the inconsistency.Following the publication of this article  concernsThis Correction notice is issued to update the S1 File(BMP)Click here for additional data file.S2 File(TIF)Click here for additional data file.S3 File(BMP)Click here for additional data file.S4 File(TIF)Click here for additional data file."}
{"text": "The Funding/Support statement should have included the following sentence: \u201cMs Ricket was supported in part by BD2K T-32 Training Grant (T32 LM012204) from the National Institutes of Health.\u201d This addition does not affect the Role of the Funder/Sponsor information. This article has been corrected.1In the Original Investigation titled \u201cDevelopment of Electronic Health Record\u2013Based Prediction Models for 30-Day Readmission Risk Among Patients Hospitalized for Acute Myocardial Infarction,\u201d"}
{"text": "An error was made in preparing the Actin panel of The authors apologize for the S1 FileIndividual-level data for (XLSX)Click here for additional data file."}
{"text": "Advocate Aurora Health was incorrectly placed in Category 4 rather than Category 3 due to a typographical error. This has been fixed, and all other information in the Supplement remains correct.The Original Investigation titled \u201cFactors Associated With Overuse of Health Care Within US Health Systems: A Cross-sectional Analysis of Medicare Beneficiaries From 2016 to 2018,\u201d"}
{"text": "The following information is missing from the Funding statement: LD and EBP are supported by Medical Research Council (MRC) (MC/PC/19067). LL acknowledges funding from a QMUL\u2019s COVID Response Grant."}
{"text": "After this article  was publThis article\u2019s Results section includes six statements that reference data not shown. The results underlying these statements are in The data underlying results reported in this article are available upon request from the first author.S1 File(ZIP)Click here for additional data file.S2 File(PPTX)Click here for additional data file.S3 File(ZIP)Click here for additional data file."}
{"text": "The Funding statement is incorrect. The correct Funding statement is as follows: HF was funded by a Medical Research Council Clinical Research Training Fellowship (grant reference number MR/T001585/1). The remaining authors received no specific funding for this work."}
{"text": "There are errors in the Funding statement. The correct Funding statement is as follows: This study was supported by a grant of the Korean Health Technology R&D Project, Ministry for Health & Welfare, Republic of Korea (HI14C1851) and the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. NRF-2018R1A2B6007648 and 2020R1I1A1A01072520)."}
{"text": "The following information is missing from the Funding statement: The publication of this article was supported by the Federal University of Par\u00e1 (UFPA) (PROPESP-PAPQ 01/2020\u2014QUALIFIED PUBLICATION SUPPORT PROGRAM)."}
{"text": "The following information is missing from the Funding statement: This work was supported by the National Research Foundation of Korea (NRF); the Korea government (MSIT) (No. NRF-2020R1C1C1007913)."}
{"text": "There are misleading errors in the mathematics deriving an algorithm in S2 TextMathematical process for deriving the PIPPET and PATIPPET filters from existing point process filtering equations.(PDF)Click here for additional data file."}
{"text": "The authors regret that:The EPSRC grant number currently stated in Funding Source section is `EP/K030957/1', which is incorrect. The correct funding source is `EP/N024818/1'.The authors would like to apologise for any inconvenience caused."}
{"text": "In Clark (2022)The updated Figure 2 is shown below:The online version has been updated to reflect this change."}
{"text": "Environ Health Perspect 113:1366\u20131372 (2005)], the authors noted errors in In the article by Rosenman et al. [3.The correct mean exposure levels for the DWA categories in"}
{"text": "Accession numbers for 8 assemblies included in this analysis are missing from These accession numbers are also missing from the Data Availability statement. The correct statement is: All complete genome assemblies are available from the NCBI Genbank database . All sequencing data is available from the NCBI Sequence Read Archive database .S2 Table(DOCX)Click here for additional data file."}
{"text": "One data point is inadvertently omitted from the upper left graph in Several data points were inadvertently omitted from the data set used for analysis . These dPlease see the complete, correct S1 Dataset(XLSX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: PB and MB were also funded by MRC grant MR/M02010X/1."}
{"text": "Scientific Reports6: Article number: 2775410.1038/srep27754; published online: 06132016; updated: 03232017The Acknowledgements section in this Article is incomplete.\u201cThis study was supported by grants from the Australian Research Council . The authors thank Petra C van den Bogert for help with data collection\u201d.should read:\u201cThis study was supported by grants from the Australian Research Council . The authors thank Petra C van den Bogert for help with data collection. This work was also supported by an International Research Staff Exchange Scheme (612681) of the EU 7th Framework Programme\u201d."}
{"text": "The following information is missing from the funding statement: PPAS was supported by an AXA Research Fellowship, British Ecological Society grant 4785/5824 and the National Socio-Environmental Synthesis Center (SESYNC)\u2014NSF award DBI-1052875.The \u03f5 labeling the key for Fig 1 should be replaced with the symbol r. The authors have provided a corrected Figure here."}
{"text": "There are two errors in Additionally, in S1 File(ZIP)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This work was supported by the Biotechnology and Biological Sciences Research Council (grant BB/J014508/1)."}
{"text": "Scientific Reports6: Article number: 2360910.1038/srep23609; published online: 03292016; updated: 10192016The original Supplementary Information published with this Article contained an error in the order of the Figures. Figures S9 and S10 were published as Figures S10 and S9 respectively. This error has now been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "In In Supplementary Table A of S1 TablesSupplementary Table A: Patient Characteristics . Supplementary Table B: Patterns of Corticosteroid user characteristics among Veteran with and without corticosteroids for IBD only.(DOCX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: National Institute of Mental Health also provided funding under award number R01GM105045 ."}
{"text": "The figure legend for Fig 1 is incorrect. I5 in the figure legend is missing. The figure caption is also missing. Please see the complete and correct Additonally, the Supporting Information files S1 Fig(DOCX)Click here for additional data file.S2 Fig(DOCX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: Funding for this open access publication was provided by the FP7 Post-Grant Open Access Pilot."}
{"text": "The authors would like to correct The authors confirm that these changes do not alter their findings. The authors have provided raw, uncropped blots as Supporting Information.S1 File(TIF)Click here for additional data file.S2 File(TIF)Click here for additional data file."}
{"text": "An incorrect version of the Supporting Information file S1 Script appears with the paper. Please see the correct version here.S1 Script(ZIP)Click here for additional data file."}
{"text": "Additional file 2: Table S1 should indicate the list of differentially expressed WSD/Chow genes (instead of WSD/CR).The title for The correct title on the figure and within the article should therefore be:Additional file 2: Table S1. The list of differentially expressed WSD/CHOW genes identified in the present study.Additional file 2: Table S2 should indicate the list of differentially expressed CR/Chow genes (instead of CR/WSD).The title for The correct title on the figure and within the article should therefore be:Additional file 2: Table S2. The list of differentially expressed CR/CHOW genes identified in the present study.After the publication of this article  the authThe original article has been corrected."}
{"text": "The correct version of Table S2 now appears online.The authors apologise to readers for this mistake."}
{"text": "The following information was missing from the Funding section: This study was supported by a Postdoctoral Award (#11POST5820019) from the American Heart Association (R.T.)."}
{"text": "S1 File. PRISMA 2009 Checklist.The caption for the PRISMA Checklist in the Supporting Information files is incorrect. The caption should read: S1 Fig(TIF)Click here for additional data file."}
{"text": "Scientific Reports5: Article number: 1409910.1038/srep14099; published online: 09152015; updated: 02062017The authors of Article made an error in preparation of the final version of Figure 2 and inadvertently used panel 2C as both panel 2Ab and panel 2C. A revised version of This correction does not affect the conclusions of the Article. The authors apologize for the error and any inconvenience caused by it."}
{"text": "Nature Communications8: Article number: 14357; DOI: 10.1038/ncomms14357 (2017); Published 02272017; Updated 04112017The original version of the Supplementary Information attached to this Article did not include Supplementary Note 1 The HTML has now been updated to include a corrected version of the Supplementary Information."}
{"text": "The reference for the origin of the strain WM210 is missing in S1 Table(DOCX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This work was supported by NIH grant R01/R37HD41900."}
{"text": "There are a number of errors in Tables S1 Table(XLSX)Click here for additional data file."}
{"text": "The uploaded S1 FileParameters measured for each subject of the database.(XLSX)Click here for additional data file."}
{"text": "In the Data Availability Statement, the GenBank ID is listed incorrectly. The correct statement is: The novel cDNA and protein sequence of the GTF2I-BRAF 19\u201310 fusion gene has been deposited to GenBank (BankIt) at NCBI under Accession Number KY884638."}
{"text": "The following information is missing from the Funding section: This study was supported by the UCLA CFAR Gene and Cellular Therapy Core Facility (UCLA Center for AIDS Research NIH/NIAID 5P30 AI028697)."}
{"text": "Elizabeth Blackwell Institute early career fellowship and by the Wellcome Trust International Strategic Fund ISSF2: 105612/Z/14/Z.The authors regret that the following funder acknowledgement was not clearly made: MJK was funded by an The authors would like to apologise for any inconvenience caused."}
{"text": "The following information is missing from the Funding section: This study was supported by the Italian \"Ministry of Health\"  via CUP number H91J11000220001."}
{"text": "The member list of the REHAP Investigators is missing from the Acknowledgements section. The full member list has been included in the Supporting Information file S1 File(DOC)Click here for additional data file."}
{"text": "There is an error in the legend for Figure 9. \"(C)-(D) same as (A)-(B) for the model (mean only)\" should instead read \"(B),(D) same as (A),(C) for the model (mean only)\".The publisher apologizes for this error."}
{"text": "The files published for S1 Fig(TIF)Click here for additional data file.S2 FigOperations of municipalities aggregated at the state level. Considerable spatial hetegonenity in the number of loan pleas by federated entity can be observed.(TIF)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: DK is an Economic and Social Research Council (UK) postdoctoral fellow (ES/P009735/1)."}
{"text": "The following information is omitted from the Funding section: This research has been conducted using the UK Biobank Resource under Application Number 8256 and supported in part by Medical Research Council grant MR/N025083/1."}
{"text": "The graphical abstract is omitted from the list of Supporting Information. It can be viewed below.S1 File(DOCX)Click here for additional data file."}
{"text": "Due to a technical error during the production process the article was originally published with incorrect bibliographical information. The article has been updated with the following correct bibliographical information:Living Rev Relativ (2016) 19:3Received: 4 December 2015Accepted: 21 July 2016Published online: 17 February 2017The earlier version incorrectly identifying the article as Living Rev Relativ (2016) 19:1 should be disregarded."}
{"text": "In the original version of this article [1], published on 4 April 2018, there was 1 incorrect author family name. The redundant affiliation (5) has also been removed. The original article has been updated.Kari GalvinThe incorrect author name was published as:Kari GlavinThe correct author name are:The original publication of this article has been corrected."}
{"text": "The initially published PDF copies of the Supporting Information are provided below.S1 File(PDF)Click here for additional data file.S2 File(PDF)Click here for additional data file.S3 File(PDF)Click here for additional data file."}
{"text": "The following information is missing from the funding section: This study was supported by NIH grant 5T32GM008203 to EP."}
{"text": "In S2 TextExplanation of methodology for inferring fragment-specific error parameters in the optional BAM mode of DICE.(PDF)Click here for additional data file."}
{"text": "The equation in the file S1 Appendix(DOC)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This study was supported by the project Instituto de Salud Carlos III (FIS PI15/01114)."}
{"text": "The following information is missing from the Funding section: SJD is supported by the Biotechnology and Biological Sciences Research Council (BBSRC grant number BB/K002260/1)."}
{"text": "The Data Availability statement for this paper is incorrect. The correct statement is: Data is available at NCBI sequence read archive (SRA) under accession number SRP125165."}
{"text": "The Supporting Information section is omitted. The publisher apologizes for the error. Please view the Supporting Information section here:S1 TextThis file includes supplementary data.(PDF)Click here for additional data file."}
{"text": "The authors wish to add the following acknowledgement to the article:\u201cThis research was conducted under the auspices of the Austrian National Election Study (AUTNES), a National Research Network (NFN) sponsored by the Austrian Science Fund (FWF) (S10902-G11)\u201d."}
{"text": "The affiliations for authors Liguo Zhang and Wei Li are incorrect. Liguo Zhang and Wei Ling are not affiliated with #1 but with #2 Heilongjiang Academy of Agricultural Sciences, Harbin, China."}
{"text": "The following information is missing from the Funding section: A mass spectrometer used in this study was purchased using NIH Shared Instrumentation Grant 1S10OD020062-01."}
{"text": "Part of the data are not included in the Supporting Information file S1 Table(XLSX)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: This work was supported by Spanish MINECO and the European Regional Development Fund (ERDF) grant CONSOLIDER INGENIO 2010 CSD00065 (A.G.E)."}
{"text": "The following information is missing from the Funding section: The authors acknowledge support from the German Research Foundation (DFG) and the Open Access Publication Fund of Charit\u00e9 \u2013Universit\u00e4tsmedizin Berlin."}
{"text": "Unfortunately, the original version of this article  did not \u2018This research was supported by the Global Innovative Research Center (GiRC) Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (NRF-2012K1A1A2A01056093).\u201d"}
{"text": "Nature Communications7: Article number: 13874 ; DOI: 10.1038/ncomms13874 (2016); Published 12222016; Updated 09062017The financial support for this Article was not fully acknowledged. The Acknowledgements should have included the National Institutes of Health grants R01GM098749 and National Institutes of Health Transformative Research Award R01NS096786."}
{"text": "Scientific Data 4:170052 doi: 10.1038/sdata201752 (2017); Published 25 April 2017; Updated 1 August 2017The financial support for this Data Descriptor was not properly acknowledged. The Acknowledgements section should have recognised a grant from the National Research Foundation of Korea (NRF), funded by the Ministry of Science, ICT & Future Planning of the Government of South Korea (grant no. 2017R1A2B2006032)."}
{"text": "The graph B2 in S2 FigTornadoplot for estimated transmission parameter (1), percentage contribution to LTBI from TB transmission within the Netherlands (2), from immigration (3), or from travel to country of origin (4) for Moroccan (A), Turkish (B) and Indonesians (C). Percentage deviation from the estimate in main text (Table 2) is given for the minimum and maximum values for the parameters in Table 1 in the main text.(PDF)Click here for additional data file."}
{"text": "Table S3 is incomplete. Please view the complete file here: Click here for additional data file."}
{"text": "The first four columns in Table S1 were missing . The correct version of Table S1 can be viewed here: Click here for additional data file."}
{"text": "The bottommost graph in Figure S6 is labeled incorrectly. It should read: Input Signal (n=1). The file extension for the figure is also incorrect. Please view the correct figure here:"}
{"text": "In the Materials and Methods subsection \"Characterization of the stimulatory clone 52B7,\" the second sentence of the last paragraph was incorrect. The correct sentence should read: \"One hundred and ninety two transposed clones of 52B7 were picked and tested for a revertant phenotype toward NF-\u03baB activation.\""}
{"text": "A funding source was omitted from this article. Part of this work was financed by the ARC (Association pour la Recherche sur le Cancer), grant A08 / 5 / 1062 to MH."}
{"text": "An incorrect version of Table S1 was published. The correct Table S1 file can be found here:Click here for additional data file."}
{"text": "The following information was missing from the Funding section. This study was supported by NIH/NIAID grant 1UO1-AI062636."}
{"text": "To the Editor: Recent reports of cats positive for H5N1 type A influenza virus , a common antigen of type A influenza viruses, expressed by both avian and human strains (Serologic tests for antibodies to type A influenza virus were performed with a competitive ELISA to detect NPA antibodies (All cats were negative for type A influenza virus antibodies. The ELISA we used has been validated in several species, including humans ("}
{"text": "An incorrect version of Dataset S1 was presented. The full Dataset S1 file can be found here:Click here for additional data file."}
{"text": "The file for Table S2 is incorrect. Please view the correct file at: Click here for additional data file."}
{"text": "There was an error in Figure 1. Panel (B) was not included and panel (C) was incorrectly labeled as (B). The corrected figure is available here:"}
{"text": "The Table S3 link leads to an incorrect file. Please view the correct Table S3 here:Click here for additional data file."}
{"text": "The incorrect table was published in place of Table S2. The correct table can be viewed here: Click here for additional data file."}
{"text": "The published Table S2 is the incorrect version. Please view the correct table here:Click here for additional data file."}
{"text": "For patients 22 and 37 the clinical parameters  are incorrect. Please view the corrected table here:Click here for additional data file."}
{"text": "The Supporting Information text file does not appear. It should be cited as \"Text S1\", with a caption \"Mathematical modeling and derivation of analytical expression, and supplementary figures legends\". Please view Text S1 here: Click here for additional data file."}
{"text": "In Text S1, some taxonomic names were incorrectly specified. The taxonomic corrections of Text S1 are based on the phylogeny of Figure S3. Please view the correct Text S1 here: Click here for additional data file."}
{"text": "The file for Dataset S4 is a duplicate of Dataset S3. Please view the correct file for Dataset S4 here:Click here for additional data file."}
{"text": "The following information was omitted from the Funding section: These studies were supported in part by the Eunice Kennedy Shriver NICHD/NIH through cooperative agreement U01-HD060496 (to MMM)."}
{"text": "A file was unintentionally omitted from the Supporting Information section of the published article: \"Text S1. Training data.\" The file can be viewed here: Click here for additional data file."}
{"text": "The following information was missing from the Funding section: Additional funding was provided by NIH grant 5R01DK081587-01."}
{"text": "In Text S2, the references are missing. Please view the correct Text S2 here: Click here for additional data file."}
{"text": "Table S7 is incorrect. The correct version can be viewed here: Click here for additional data file."}
{"text": "In the Funding section, the second grant number from the NIH Models of Infectious Disease Agent Study program was incorrect. The correct grant number is: 1U54GM088558."}
{"text": "The hyperlink to Supplementary Figure S2 connects to the wrong document. Please view the correct Figure S2 here:Click here for additional data file."}
{"text": "The following information is missing from the Data Availability statement: Raw data supporting Fig 4 and S1 Fig are found in the S1 File(XLSX)Click here for additional data file."}
{"text": "The following information is missing from the Data Availability statement: NS5B sequences have also been deposited to GenBank under accession numbers LC484047-LC484058 and LC506601."}
{"text": "The authors regret that the published article contained an error in Eqs. (2) and (3). The correct equations should be:The authors would like to apologise for any inconvenience caused."}
{"text": "Following publication of this article , concernHere the authors provide a revised The original images and the nerve fiber density and length data underlying the panels in S1 Table of the original article reports a gene expression array experiment. The data from the microarray experiment have been deposited at GEO, accession number [GSE130393]. The data underlying the other figures are no longer available.S1 File(TIFF)Click here for additional data file.S2 File(TIFF)Click here for additional data file."}
{"text": "There is an error in The authors provide the following methodological clarification: Some Western blot \u03b2-actin loading control images are duplicated within the figures Click here for additional data file.S2 FileRaw data for (RAR)Click here for additional data file.S3 FileFurther raw data for (RAR)Click here for additional data file."}
{"text": "The macro included in the Supporting Information file, S1 Macro(XLS)Click here for additional data file."}
{"text": "HB40 gene are duplicated. The authors have provided the correct version of There is an error in S4 Table(XLSX)Click here for additional data file."}
{"text": "In Table 3, all the means (SEs) and medians (interquartile ranges) should have been labeled as adjusted. This article has been corrected.1In the Original Investigation titled \u201cEffect of Exposure to Gun Violence in Video Games on Children\u2019s Dangerous Behavior With Real Guns: A Randomized Clinical Trial,\u201d"}
{"text": "The correct email address for Sun-Joon Bai is: The underlying data for this study is omitted from the article. The authors have now provided the dataset. The underlying data can be viewed in S1 Dataset below.S1 Dataset(XLSX)Click here for additional data file."}
{"text": "The following information is missing from the Funding statement: This study was supported by the Social Science Korea (SSK) Project through the NRF funded by the Ministry of Education, Republic of Korea (Grant number: 2017S1A3A2067165 to Y. Youm)."}
{"text": "The units for the vertical axis for panels K and L should be: zmol PSII cell-1. Please see the correct In"}
{"text": "This system has been extensively tested in the lab  and validated in field studies. Comparing measurements obtained with the use of the new passive sampling system with equivalent measurement with the use of an active filter pack H2S sampler yielded an accuracy of greater than 85%. The new H2S passive sampling system can be used to measure ambient H2S concentrations ranging from 0.02 to 7 ppb based on a 1-month exposure period. There is no significant interference found from other sulfur compounds in air. This system has been used in many air monitoring projects.A new Maxxam All-Season Passive Sampling system for monitoring H2S in air has been developed. This passive sampling system employs the same approaches as the Maxxam All-Season Passive Sampling Systems for monitoring SO"}
{"text": "Ahmed that was accidentally missed. The publisher apologizes for the error.This article was republished on April 11S1 File(PDF)Click here for additional data file.S2 File(PDF)Click here for additional data file."}
{"text": "Dr. Cui\u2019s email address is: There is an error in With this Correction, the authors provide the underlying image files for Figs S1 FileThis file contains underlying image data for Figs (ZIP)Click here for additional data file."}
{"text": "Nature Communications 10.1038/ncomms15700; published online 16 June 2017Correction to: The original version of this Article omitted the following from the Acknowledgements:\u2018This project was supported by CRC128/Project A03 of the Deutsche Forschungsgemeinschaft (DFG).\u2019This has not been corrected in either the PDF or HTML versions."}
{"text": "There are errors in the Funding statement. The correct Funding statement is as follows: This work was supported by the National Research Foundation (NRF) of Korea Grant funded by the Korean Government (MSIT) (2019R1G1A1006073)."}
{"text": "In the Funding section, one of the grant numbers from the funder Instituto de Salud Carlos III (ES)\u2014European Regional Development Fund is listed incorrectly. The correct grant numbers are: PI 12/01142 and PI 15/01311."}
{"text": "The supplementary dataset is omitted from the list of Supporting Information. It can be viewed below as S1 File(CSV)Click here for additional data file."}
{"text": "There is an error in the data presentation of Supporting Information file S2 TableDifferences regarding WHtR categories. Z test proportions. The differences are between the same gender groups.* p<0.05.(DOCX)Click here for additional data file."}
{"text": "Scientific Reports 10.1038/srep15204, published online 06 November 2015Correction to: The original version of this Article contained an error where Supplementary Data 10 was a duplication of Supplementary Data 11. This error has now been corrected in the Supplementary Data that accompanies this Article."}
{"text": "The Program for Medical Key Department of Shanghai (no: ZK 2015B17);2. The Key Disciplines Group Construction Project of Pudong Health Bureau of Shanghai (no: PWZxq2017\u201311)."}
{"text": "Scientific Reports 10.1038/s41598-018-29363-0, published online 20 July 2018Correction to: This Article contains typographical errors in the Acknowledgements section.\u201cAuthors KHK and RSM are indebted to Global Frontier Program through the Global Frontier Hybrid Interface Materials (GFHIM) of the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (2013M3A6B1078869) for financial support.\u201dshould read:\u201cAuthors KHK and RSM are indebted to Global Frontier Program through the Global Frontier Hybrid Interface Materials (GFHIM) of the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (2013M3A6B1078874) for financial support.\u201d"}
{"text": "Following publication of this article , concernIn In In In The authors acknowledge that in Figs A revised A revised The underlying blots for Figs S1 File(ZIP)Click here for additional data file."}
{"text": "After this article was corrected and republished , 2 to adThe authors explained that these images were cropped incorrectly when the original figure was composed such that they included control lanes Click here for additional data file.S2 File(XLS)Click here for additional data file.S3 File(PDF)Click here for additional data file."}
{"text": "The graph for S4 FigMaster\u2013apprentice relations among Nobel laureates in Chemistry (North America). Underlined names are from other regions.(EPS)Click here for additional data file.S5 FigMaster\u2013apprentice relations among Nobel laureates in Physiology or Medicine (Europe). Underlined names are from other regions.(EPS)Click here for additional data file.S6 FigMaster\u2013apprentice relations among Nobel laureates in Physiology or Medicine (North America). Underlined names are from other regions.(EPS)Click here for additional data file."}
{"text": "The toxic threshold concentration  values for Sunitinib and Imatinib are swapped in The toxic threshold concentration and safety margin values for Sunitinib and Imatinib are also incorrect in S1 Table(DOCX)Click here for additional data file."}
{"text": "There are a number of errors in the caption for The caption listed within Supporting Information file Note, there is an error in the caption for S1 Text(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(DOCX)Click here for additional data file."}
{"text": "After publication of this article , concernThe authors provide a revised version of S1 File(TIF)Click here for additional data file.S2 File(TIF)Click here for additional data file."}
{"text": "The data underlying Table 2 are omitted from the list of Supporting Information. The data can be viewed below.S1 FileThis file includes the data underlying Table 2.(XLSX)Click here for additional data file."}
{"text": "The ninth author\u2019s name is spelled incorrectly. The correct name is: Jun Nyung Lee.In the Funding Statement, one of the grant numbers from the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIP) is missing: 2019R1F1A1062343 for SS."}
{"text": "This article has been corrected.1In the Original Investigation titled \u201cAssessment of Health Care Utilization and Cost of Targeted Drug Delivery and Conventional Medical Management vs Conventional Medical Management Alone for Patients With Cancer-Related Pain,\u201d"}
{"text": "There are errors in the caption for S1 File(XLSX)Click here for additional data file."}
{"text": "There is an instance of data duplication in the Supporting Information item Please view the corrected version of S1 File(XLSX)Click here for additional data file."}
{"text": "The publisher apologizes for the errors.S1 Table(DOCX)Click here for additional data file.S1 File(DOCX)Click here for additional data file."}
{"text": "The supporting information item The final, peer-reviewed version of The publisher apologizes for this error.S1 Code(ZIP)Click here for additional data file."}
{"text": "Giardia and Cryptosporidium. In this correction article the updated additional file (Additional file In the original publication of this article  the suppAdditional file 1: Table S1. Updated polymerase chain reaction conditions for detection of Giardia and Cryptosporidium."}
{"text": "The authors also provide raw data underlying The authors provide an updated PLOS ONE article [Antonie Van Leeuwenhoek article [PLOS ONE article [Antonie Van Leeuwenhoek article [Antonie Van Leeuwenhoek article [Moreover, the authors reused Fig 2A from the  article  in the A article  in the A article . The autS7 FigPLOS ONE article as picl1 panel, these lanes represent experimental results for the pdnaA panel as reported in [Note that the data shown in the upper row (lanes 11\u201318) correspond to the data that were originally and mistakenly used in the orted in  (this is(TIF)Click here for additional data file.S8 Fig(TIF)Click here for additional data file.S9 Fig(TIF)Click here for additional data file."}
{"text": "The following information is missing from the Funding statement: This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2019R1F1A1058719 and 2019R1G1A1006073). The publisher apologizes for the error."}
{"text": "The Data Availability statement is incorrect. The raw data underlying the study are not provided in the published paper and its Supporting Information files. The authors have provided the data as Supporting Information file S1 File(CSV)Click here for additional data file."}
{"text": "The Health Research Fund (FIS) grant number is missing. The correct grant number is PI18/00045."}
{"text": "The data in the S2 Data File(XLSX)Click here for additional data file."}
{"text": "Article ID: pez511Table 2 has been updated to remove first two rows showing r and P values of correlations for wheat vs wheat, and last two columns showing r and P of correlation for animal fat vs animal fat. All the r and P values between same ingredients are now removed where P values in the original Table were incorrect."}
{"text": "The correct name is Arpad Todor. The correct citation is: Todor A (2018) Willing to pay to save the planet? Evaluating support for increased spending on sustainable development and environmentally friendly policies in five countries. PLoS ONE 13(11): e0207862."}
{"text": "The following information is missing from the Funding statement: This study was supported by the German Research Foundation (DFG) and the Open Access Publication Fund of Charit\u00e9 \u2013Universit\u00e4tsmedizin Berlin."}
{"text": "The following information is missing from the Funding section: This study was funded by the National Evidence-based Healthcare Collaborating Agency (Grant Number: HC16C2299)."}
{"text": "The intervention type consisted of an experimental group (REDStory) and a control group (wait-list control group). The study participants were randomly assigned to either wait-list control group or experimental group by 3 of the researchers.The 2.5 Procedure should read: This study adopted a group randomized controlled trial design,"}
{"text": "The authors have provided an updated version of S2 Table(XLS)Click here for additional data file."}
{"text": "The following information is missing from the Funding section: The work was conducted using the facilities of the Roslin Institute funded by the BBSRC. NS is supported by BBSRC through the Institute Strategic Programme funding (BB/J004235/1 and BB/P013740/1)."}
{"text": "In the above named article [1] the details for the Financial Support section are incomplete. The complete details are as follows:This work was supported by the Spanish Health Research Fund (Fondo de Investigaci\u00f3n Sanitaria) (PI96/0201) and the \u2018Carlos III\u2019 Institute of Health  (PI15CIII/00037).The authors apologise for this omission."}
{"text": "The following information is missing from the Funding statement: This study was supported by Deutsche Forschungsgemeinschaft and Universit\u00e4t Rostock within the funding programme Open Access Publishing (to RU)."}
{"text": "The data underlying this study were omitted from the original article. The authors have provided the complete dataset below as S1 File(XLSX)Click here for additional data file.S2 File(XLSX)Click here for additional data file."}
{"text": "The originally published, uncorrected article is provided here for reference.S1 File(PDF)Click here for additional data file."}